Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

?????? PCR ????? ??????? ?? ?????????? ????? ???????? ????? ?? ????? ??? ?????? ?? ????????? ?????? Published: September 5, 2013 doi: 10.3791/50779

ERRATUM NOTICE

Abstract

?????????? ????? ???????? MEC (SCC MEC) ??????? ?? ???? ?????? ???? ??? ???? ??????? ???????? ????? ??????? ?? ????????? ?????? ???????? ????????? ??????? (????????)? ????? ?? ???? ??????? ?? ??????? ???????? MRSA (CA-MRSA) ???? ???? ??? ?????? ???????. ?????? ??????? PCR ????????? ????? SCC MEC ?? ???? ??????? ?????? MEC ??????? ?CCR ????? ????? ?????? ???? ????? ??????? ?????? ?? ??????? ???????? ??????? ??????? PCR ???????. ???? ?????? ???? ?????? ????? ???? PCR ???? ??? ????? ?????? MEC SCC ???????? ??????? ?? ????? ??? ??????? ???? ?????? ??? ???? ????????? ????? ??????? ???????. ??? ????? ???? ??????? ??????? ????? MEC SCC ?? ?? ??? ????? ?? ????? ????? ???????? ??? ???? ???? ?? ???? ????? ??????. ??? ???? ????? ?NAT ????????? ?????? ?? ????? ?????? ?????? ?? ??????? ?????? ?? ?? ???? ???? ?????? ??????? ?????? ?? ??? ???????? ?????? ???????. ?????? ????? ????? MRSA SCC MEC ??????? ???? ??? ???? ????? ????? ????? ?????? PCR ??????? ??????? ??? ??????? ??????? ??????? ??????? ????????? ???? ???????.

Introduction

??? ????? ????????? ?????? ???????? ????????? ??????? (????????) ?????? ?? ??????? ?????? ??????? ?????? ??????? 21-67 ???? ????? ???? ???????? ????? ?????????? MEC (SCC MEC) ???? ???????? ????????? (MECA) ??????? ?????? ?? ???????? ???????? ???????? ??????? 1 . ????? SCC MEC ?? ???? ???? ???? ???????? ????????? ?????? ?? ???????? ??????? ???????? (???? ??????? MEC ????? ??????? CCR)? ?-J ??????? (????? 1). ?????? ?????? ?? ??????? MEC IS 431mec? ????? ???????? ????? ?? ?????? ?? ??????? ?????????? mecR1 ?MECI? ?? ??? ?? ???? ??????? CCR ?????? recombinases (CCR / ccrAB) ???? ????? ????? SCC MEC ?? ??????? ??? ?? ???????? ????????? 1. ????? ????? ?? ????? MEC ??????? ???????? (mecB ????? ????? ????? ??????) ????? ????? ???? ?????? ????? ????? ?? MECA ????? 2. ?????? ???? ?????? MEC SCC ?? ??????? J (J1? J2? ?J3) ???? ??? ??? ????? ??????? ????????? CCR ???? ?????? ??? ??????? ??????? ?? ?????. ???? ??? ????? ?? MEC ??????? (??? A? B? C? D ? E) ?allotypes ?? ???? ?????? ????????? ??????? (??? 1-8) ?????. ??????? ?????? ?? ??? ?????? ?allotypes ???? ????? ????? ????? MEC SCC. ???? ??????? ????????? ?? SCC MEC ??????? ???????? ?? ??? ?????? ????? ??????? ???? ????? ?????????? ????? ????? ???????? (IWG-SCC)? ??? ????? SCC ????? MEC ??? ????? ????? ??? ????? MEC ??????? ??????? CCR? ????? ???? ?? ??????? ??? ????? ????? ???? ?????????? ?? ????? ?????? J ??????? 1. MRSA??? ???? ????? ????????? ????????? ?? ??? ????? SCC ????????? ??????? MEC ???????? ?? ??? ???? ????? (??? / ??????) ?????? ??????? ?????? ??? ???????? ??? multilocus ??????? ????? (ST) ? / ?? ?????? ?????????? A ????? (SPA) ??????? (??? ???? ?????? ST8 -T008-MRSA-IVA). ?????? SCC MEC ??????? ?? ???? ?????? ???? ??? ???? ??????? ???????? ?????? ????? ?? MRSA? ?? ???? ?? ???? ??????? ?? ??????? ???????? MRSA (CA-MRSA) ???? ???? ??? ?????? ???????.

?????? ??????? PCR ????????? ????? SCC MEC ?? ???? ??????? ?????? MEC ??????? ?CCR ????? ????? ?????? ???? ????? ??????? ???? ?? (20 ??? 30) ??????? ???????? ??????? ??????? ??????? PCR. ?????? ??????? ??? ???? ??????? ???? 21 ??????? ??????? ?? ????? ??????? PCR ???? ?? ????? SCC MEC I-??? 3. ????? ??????. ??????????? quently ??? ???? ??????? ?????? ???? ?????? ?????????? MEC? ????????? ????? ?? ??????? J-? ????? ????? ???? ??? ??? ???? ?? ??????? ????? ????? PCR ?????? 4. ?????? SCC MEC ???????? ??? ???? ?????? PCR (M-PCR) ????????? ?????? ??????? ???? ???? ??????? ?? ????? PCR ????. ?? Lencastre ??????? ?????? M-PCR ???? ???? ??SCC MEC I-IV? ???????? ?? ??? ???? ?SCC MEC ??????? ?? ?????? M-PCR ?????? SCC MEC ????? ?????? 5?6?7. ??? ???? ??? ????????? ???? ????? ?? ?????? ????? 2 ???? ????? ?? ??? ????? SCC MEC ????? ??????? ????? ??? ??? ????? ????? ??? typeable. ?? ?????? ?????? SCC MEC ???????? ???? ?????? ???? ?????? ????? ??? PCR ???? ???? ?? ????? ?????? MEC SCC ???????? ??????? ?? ????? ??? ?????? 8? ???? ????????? ??? ????? ????????? ??????? ?ecame ??????? 9. ??? ????? ???? ??????? ??????? ????? MEC SCC ?? ?? ??? ????? ?? ????? ????? ???????? ??? ???? ???? ?? ???? ????? ?????? (337 ?? SCOPUS? ????? 30 ????? 2013). ??? ??????? ??????? ?????? ?????? ?? ??????? ?????? ??? ???????? ?? ?????? ????? ??? ???????? ???? ?? ?? ?????? MRSA SCC MEC ???????. ???? ?????? ?????? ????? ???? ???? ?? ??????? ?????? ?? ?? ???? ???? ?????? ??????? ?????? ?? ??? ???????? ?????? ???????. ?????? ????? ????? MRSA SCC MEC ??????? ???? ???? ???? ????? ????? ????? M-PCR ?SCC MEC ???????? ???? ?? ?????? ??? ??????? ??????? ??????? ??????? ????????? ???? ???????.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

?????? ????? ??? ????????? ?? ???? ??????? ????????? ????? 2 ????? ?????. ????? ??????? ??????? ???????? ??? ???????? ???????? ????? ????? ?? ?????? ?? ???? ???????.

1. ????? ??????

  1. ?????? ??????? ???????? ???? ??? ???? ?????? ?? ??? ????????. ?? ????? ??? PCR ?? ???? ????? ?????? ??? ??? ??????? ????? ?? ??? ???????? ???? ??????? ??????? ?????? ?? ??????? ?? ????????? ??? ???? ?????? ????? (TSA) ????. ???? ????? ????? ?????? ??? ???? ?????. ?????? ??? ???? ?????? ?? 37 ???? ?????.
  2. ????? 75 ???????? ?? ????? ?????? ?????? ??? ????? microcentrifuge 1.5 ??. ??????? ??? ??????? ??????? ?????? ???? ????? ?? ????????? ?? ?? ??? ???? ?????? ???????. ????? ????????? ?? ????? ?????? ?????? ?? ??? (????? 2). ???? ?????? ???????.
  3. ?????? ???????? ?? ???? ??????? ?????? ???? ?? 95 ???? ????? ???? 10 ????? ???? ????????? ???????? ????? ??????.

??????: ??? ??? ?? ????????? ????? ??? ?? ????? ?????? ??? ????? ????? PCR. ???????? ??? ???? ???? ??????? ???? ?? 95 ???? ????? ?? ??????? ???? ?? 10 ????? ??? ????? ????? PCR.

  1. ????? ????? ?? ???? ??????? ??????? ?????? ?? ???? ????? ?????? ???? 5 ?????.
  2. ????? ????? ??????? ??????? ?? 13?000 ???? ?? ??????? ???? 1 ?????? ???? ?????? ??????? ????? ???? ????? ????? ??? ????? ??????. ????? ????? ??????? ?? -20 ???? ????? ?????????? ?? ????????.

??????: ??? ???????? ???? ???? ????? ????????? ?????? ????? microcentrifuge ?? ??????? ??????? ?????? ?? ???? ????? ?????? ?????? ?????? ?????. ??? ??? ?? ?? ????????? ????? ????? ????? ??????? ??????.

??????: gDNA ?? ??? ?? ????? ???? ????? ??? ?? ??? ??????? chelex 10? ?? ??????? ?????? (QIAmp DNA ??????? ???? QIAGEN) ?? ???? ?????.

itle "> 2. ????? PCR

??????: ????? ?? ???? ?? ????? ?????? ?? ????? PCR ?????? ??? ???? ?????? ?? ????? ?????? ?????? ???????? ?? ???? ??????? IIA? ???????? IVA? ???? IVC? ?????? ??? ?????? ??? ????? ?????? ????? ????? ????? ???? ???????. ????? ?????? ?????? ???? ?? ???? ??? ??????? ?? ??? ???? ???????? ?????? ????? ?? ????? ?? ???????.

  1. ????? ??????? PCR? ??? ?? ??? ?????? PCR 10X (???? MgCl 2)? 50 ??? MgCl 2? dNTPs ????????? ?? ??????? -20 ???? ????? ??????? ?????? ?????? ??? ????? ??????? PCR ????? (?? ????????? ?? ????? ?????? ????) ?? ???? ????? ??????. 0.2 ?? ?????? PCR ???? ????? ???? ?? ??? ?????.
    ??? ???? ???? ???? ??????? ????? ?? ??????? ?? dNTPs ???? ???? ?? ???? ??? ??????? ??? ????? ??????:
    1. ????? ??????? ?? ???? ????? ?????? ??????? ??? 10 ???????? ???? ???? ?????? ?????? ??????. ????? ?? ??? ?????? ???????? ????? ????? ??????? ??? ???? ????? -20 ???? ????? ?????????? ?? ???????? ?????.
    2. ????? dNTPs ?? ???? ????? ?????? ???????? ??? ?? ??????? ???? ????? ??? 2 ???????? ??? dNTP. ?? ??? ????? ??? ????? ????? / ??????? ?? dNTPs ??????? ???????? ?? 10 ???????? ??? dNTP ???? ?? ???? ??? ??????? ?? ??? ????? ? 50 ???????? ?????? ??? ?? 0.5 ?? ?????? microcentrifuge ???????? ?? -20 ???? ?????. ??? ??????? ??? ????? ????? ?? 10 ???????? ??????? ??? 2 ???????? ??? dNTP ?? ???? ????? 200 ???????? ?? ????? ?????? ???????.
  2. ????? ??? ?????? ????? ????? ????? ???? ???? ???????? ?? ????? ??? ?? ?????? ??? 1. ?? ????? ?? ??????? ???????? ?? ??????? DNA (??? ????? ?? ?? ???????) ??? ??? ??? ??? ?? ???? ??? ???? ???????. ????? ??? ????? ???? ???????? vortexed ????? ????? ???? ?aliquoted ?? ?????? PCR ???????.
  3. ????? ???? ?????? PCR ????????? ??? ????? ??????? ????? ?????. ????? ?????? ??? ?????? PCR ?????? pipetting 2 ???????? ?? ??????? ?? ??????? ????????? ???? ?????.
  4. ???????? ??? ???? ???? ??????? ???? ?????? ?? cycler ???????? ????? ?????????? ??????: 94 ???? ????? ???? 5 ?????? ????? 10 ????? ?? 94 ???? ????? ? 45 ????? ? 65 ???? ????? ? 45 ?????? 72

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Tryptic Soy Agar Fisher (BD) CA90002-700 (236920)
Sterile distilled water Life Technologies 10977-015
Platinum Taq: including 10x PCR buffer and 50 mM MgCl2 Life Technologies 10966-034
100 mM dNTP Life Technologies 10297-018
Tris base Sigma-Aldrich T6066
Boric acid Sigma-Aldrich B7901
EDTA Life Technologies 15576-028
Agarose Life Technologies 16500-500
Glycerol Life Technologies 15514-011
Bromophenol blue Sigma-Aldrich B8026
1Kb+ DNA ladder Life Technologies 10787-026
Ethidium bromide Sigma-Aldrich E7637
1.5ml Microcentrifuge tubes VWR (Axygen Scientific) 10011-700
Culture sticks VWR CA10805-018
PCR tubes Diamed AD0210-FCN (new #: DIATEC420-1250)
Centrifuge Eppendorf 5417c
Heat block VWR 13259-030 / 13259-286
Thermalcycler Applied Biosystems (2720) 4359659
Horizontal, submersible gel electrophoresis chamber with gel mold BioRad 170-4469
Power supply BioRad 164-5050
Rocker shaker VWR 40000-300
Molecular Imager Gel Doc System BioRad 1708170

DOWNLOAD MATERIALS LIST

References

  1. IWG-SCC. Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements. Antimicrobial Agents and Chemotherapy. 53 (12), 4961-4967 (2009).
  2. Ito, T., Hiramatsu, K., Tomasz, A., de Lencastre, H., Perreten, V., Holden, M., et al. Guidelines for Reporting Novel mecA Gene Homologues. Antimicrobial Agents and Chemotherapy. 56 (10), 4997-4999 (2012).
  3. Okuma, K., Iwakawa, K., Turnidge, J. D., Grubb, W. B., Bell, J. M., O'Brien, F. G., et al. Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community. Journal of Clinical Microbiology. 40 (11), 4289-4294 (2002).
  4. Kondo, Y., Ito, T., Ma, X. X., Watanabe, S., Kreiswirth, B. N., Etienne, J., et al. Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions. Antimicrobial Agents and Chemotherapy. 51 (1), 264-274 (2007).
  5. Oliveira, D. C., de Lencastre, H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 46 (7), 2155-2161 (2002).
  6. Milheirico, C., Oliveira, D. C., de Lencastre, H. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 51 (9), 3374-3377 (2007).
  7. Milheirico, C., Oliveira, D. C., de Lencastre, H. Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus: 'SCCmec IV multiplex'. Journal of Antimicrobial Chemotherapy. 60 (1), 42-48 (2007).
  8. Zhang, K., McClure, J. A., Elsayed, S., Louie, T., Conly, J. M. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. Journal of Clinical Microbiology. 43 (10), 5026-5033 (2005).
  9. Zhang, K., McClure, J. A., Conly, J. M. Enhanced multiplex PCR assay for typing of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. Molecular and Cellular Probes. 26 (5), 218-221 (2012).
  10. de Lamballerie, X., Zandotti, C., Vignoli, C., Bollet, C., de Micco, P. A one-step microbial DNA extraction method using "Chelex 100" suitable for gene amplification. Research in Microbiology. 143 (8), 785-790 (1992).
  11. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. J. Vis. Exp. (62), e3923 (2012).
  12. McClure, J. A., Conly, J. M., Elsayed, S., Zhang, K. Multiplex PCR assay to facilitate identification of the recently described Staphylococcal cassette chromosome mec type VIII. Molecular and Cellular Probes. 24 (4), 229-232 (2010).
  13. Zhang, K., McClure, J. A., Elsayed, S., Conly, J. M. Novel staphylococcal cassette chromosome mec type, tentatively designated type VIII, harboring class A mec and type 4 ccr gene complexes in a Canadian epidemic strain of methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 53 (2), 531-540 (2009).

Erratum

Formal Correction: Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus
Posted by JoVE Editors on 03/19/2019. Citeable Link.

An erratum was issued for: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus.  There was a typo in Table 1.

In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from:

TTCTCATTGATGCTGAAGCC

To:

GAAACTAGTTATTTCCAACGG

?????? PCR ????? ??????? ?? ?????????? ????? ???????? ????? ?? ????? ??? ?????? ?? ????????? ??????<em&gt; ???????? ????????? ???????</em
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

McClure-Warnier, J. A., Conly, J.More

McClure-Warnier, J. A., Conly, J. M., Zhang, K. Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus. J. Vis. Exp. (79), e50779, doi:10.3791/50779 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter