ERRATUM NOTICE
Important: There has been an erratum issued for this article. Read more …
Abstract
Stafilococco Cassette Cromosoma mec (SCC mec) tipizzazione molecolare
Introduction
Staphylococcus aureus meticillino-resistente (MRSA) ha acquisito e integrato nel suo genoma di un elemento genetico mobile 21-67-kb, definito il stafilococco cassetta cromosoma mec (SCC mec) che ospita la resistenza alla meticillina (mecA) gene e altri fattori determinanti di resistenza agli antibiotici 1 . SCC mec
Subscription Required. Please recommend JoVE to your librarian.
Protocol
Queste procedure devono essere effettuate in un laboratorio certificato di livello 2 di biosicurezza. Adeguati dispositivi di protezione individuale, come guanti e camici da laboratorio deve essere utilizzato in ogni momento.
1. Preparazione del campione
- Sono tenuti fresche durante la notte culture piastra di MRSA. Il giorno prima della PCR deve essere fatto, selezionare una singola colonia di MRSA con una cultura bastoncino sterile e preparare una pesante striscia di batteri su una piastra di Tryptic Soy Agar (TSA). Campioni multipli possono essere strisciati su un singolo piatto. Incubare per una notte a 37
Subscription Required. Please recommend JoVE to your librarian.
Materials
Name | Company | Catalog Number | Comments |
Tryptic Soy Agar | Fisher (BD) | CA90002-700 (236920) | |
Sterile distilled water | Life Technologies | 10977-015 | |
Platinum Taq: including 10x PCR buffer and 50 mM MgCl2 | Life Technologies | 10966-034 | |
100 mM dNTP | Life Technologies | 10297-018 | |
Tris base | Sigma-Aldrich | T6066 | |
Boric acid | Sigma-Aldrich | B7901 | |
EDTA | Life Technologies | 15576-028 | |
Agarose | Life Technologies | 16500-500 | |
Glycerol | Life Technologies | 15514-011 | |
Bromophenol blue | Sigma-Aldrich | B8026 | |
1Kb+ DNA ladder | Life Technologies | 10787-026 | |
Ethidium bromide | Sigma-Aldrich | E7637 | |
1.5ml Microcentrifuge tubes | VWR (Axygen Scientific) | 10011-700 | |
Culture sticks | VWR | CA10805-018 | |
PCR tubes | Diamed | AD0210-FCN (new #: DIATEC420-1250) | |
Centrifuge | Eppendorf | 5417c | |
Heat block | VWR | 13259-030 / 13259-286 | |
Thermalcycler | Applied Biosystems (2720) | 4359659 | |
Horizontal, submersible gel electrophoresis chamber with gel mold | BioRad | 170-4469 | |
Power supply | BioRad | 164-5050 | |
Rocker shaker | VWR | 40000-300 | |
Molecular Imager Gel Doc System | BioRad | 1708170 |
References
- IWG-SCC. Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements. Antimicrobial Agents and Chemotherapy. 53 (12), 4961-4967 (2009).
- Ito, T., Hiramatsu, K., Tomasz, A., de Lencastre, H., Perreten, V., Holden, M., et al. Guidelines for Reporting Novel mecA Gene Homologues. Antimicrobial Agents and Chemotherapy. 56 (10), 4997-4999 (2012).
- Okuma, K., Iwakawa, K., Turnidge, J. D., Grubb, W. B., Bell, J. M., O'Brien, F. G., et al. Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community. Journal of Clinical Microbiology. 40 (11), 4289-4294 (2002).
- Kondo, Y., Ito, T., Ma, X. X., Watanabe, S., Kreiswirth, B. N., Etienne, J., et al. Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions. Antimicrobial Agents and Chemotherapy. 51 (1), 264-274 (2007).
- Oliveira, D. C., de Lencastre, H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 46 (7), 2155-2161 (2002).
- Milheirico, C., Oliveira, D. C., de Lencastre, H. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 51 (9), 3374-3377 (2007).
- Milheirico, C., Oliveira, D. C., de Lencastre, H. Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus: 'SCCmec IV multiplex'. Journal of Antimicrobial Chemotherapy. 60 (1), 42-48 (2007).
- Zhang, K., McClure, J. A., Elsayed, S., Louie, T., Conly, J. M. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. Journal of Clinical Microbiology. 43 (10), 5026-5033 (2005).
- Zhang, K., McClure, J. A., Conly, J. M. Enhanced multiplex PCR assay for typing of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. Molecular and Cellular Probes. 26 (5), 218-221 (2012).
- de Lamballerie, X., Zandotti, C., Vignoli, C., Bollet, C., de Micco, P. A one-step microbial DNA extraction method using "Chelex 100" suitable for gene amplification. Research in Microbiology. 143 (8), 785-790 (1992).
- Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. J. Vis. Exp. (62), e3923 (2012).
- McClure, J. A., Conly, J. M., Elsayed, S., Zhang, K. Multiplex PCR assay to facilitate identification of the recently described Staphylococcal cassette chromosome mec type VIII. Molecular and Cellular Probes. 24 (4), 229-232 (2010).
- Zhang, K., McClure, J. A., Elsayed, S., Conly, J. M. Novel staphylococcal cassette chromosome mec type, tentatively designated type VIII, harboring class A mec and type 4 ccr gene complexes in a Canadian epidemic strain of methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 53 (2), 531-540 (2009).
Erratum
Formal Correction: Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus
Posted by JoVE Editors on 03/19/2019.
Citeable Link.
An erratum was issued for: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus. There was a typo in Table 1.
In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from:
TTCTCATTGATGCTGAAGCC
To:
GAAACTAGTTATTTCCAACGG