Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
JoVE Journal Biology
Click here for the English version

Biology

En Reprogramación vivo de células somáticas de adultos a Pluripotencia por la sobreexpresión de factores de Yamanaka

Published: December 17, 2013 doi: 10.3791/50837
Automatic Translation
1, 1, 1, 2
1Nanomedicine Lab, UCL School of Pharmacy, University College London, 2Nanomedicine Lab, Faculty of Medical & Human Sciences, University of Manchester

Materials

Name Company Catalog Number Comments
pCX-OKS-2A pDNA Addgene 19771 Obtained from Addgene as bacterial stab, plasmid production performed in Plasmid Factory (Germany)
pCX-cMyc Addgene 19772 Obtained from Addgene as bacterial stab, plasmid production performed in Plasmid Factory (Germany)
0.22 μm filter Milliopore SLGP033RS
Isoflurane Abbott B505
HBSS buffer Sigma-Aldrich H6648 Ca2+ and Mg2+ free, with bicarbonate
Liver Digest Medium Gibco 17703-034
Hepatocyte Wash Medium Gibco 17704-024
100 μm cell strainer BD Biosciences 352360
Nucleospin RNA II kit Macherey-Nagel 740955.25 Kit for RNA isolation from cells and tissues
iScript cDNA synthesis kit Bio-Rad 170-8890
iO SYBR Green Supermix Bio-Rad 170-8880
Oct3/4 forward primer Sigma sequence given in comments TGAGAACCTTCAGGAGATATGCAA
Oct3/4 reverse primer Sigma sequence given in comments CTCAATGCTAGTTCGCTTTCTCTTC
Sox2 forward primer Sigma sequence given in comments GGTTACCTCTTCCTCCCACTCCAG
Sox2 reverse primer Sigma sequence given in comments TCACATGTGCGACAGGGGCAG
C-myc forward primer Sigma sequence given in comments CAGAGGAGGAACGAGCTGAAGCGC
C-myc reverse primer Sigma sequence given in comments TTATGCACCAGAGTTTCGAAGCTGTTCG
Nanog forward primer Sigma sequence given in comments CAGAAAAACCAGTGGTTGAAGACTAG
Nanog reverse primer Sigma sequence given in comments GCAATGGATGCTGGGATACTC
Ecat1 forward primer Sigma sequence given in comments TGTGGGGCCCTGAAAGGCGAGCTGAGAT
Ecat1 reverse primer Sigma sequence given in comments ATGGGCCGCCATACGACGACGCTCAACT
Rex1 forward primer Sigma sequence given in comments ACGAGTGGCAGTTTCTTCTTGGGA
Rex1 reverse primer Sigma sequence given in comments TATGACTCACTTCCAGGGGGCACT
Alb forward primer Sigma sequence given in comments GTTCGCTACACCCAGAAAGC
Alb reverse primer Sigma sequence given in comments CCACACAAGGCAGTCTCTGA
Aat forward primer Sigma sequence given in comments CAGAGGAGGCCAAGAAAGTG
Aat reverse primer Sigma sequence given in comments ATGGACAGTCTGGGGAAGTG
Trf forward primer Sigma sequence given in comments ACCATGTTGTGGTCTCACGA
Trf reverse primer Sigma sequence given in comments ACAGAAGGTCCTTGGTGGTG
B actin forward primer Sigma sequence given in comments GACCTCTATGCCAACACAGT
B actin reverse primer Sigma sequence given in comments AGTACTTGCGCTCAGGAGGA
BD Cytofix fixation buffer BD Biosciences 560585
1x BD Perm/Wash buffer BD Biosciences 560585
anti-mouse OCT4-PerCP-Cy5.5 BD Biosciences 560585
anti-mouse Nanog-PE BD Biosciences 560585
2-Methylbutane Sigma-Aldrich M32631
X100-Triton Sigma-Aldrich X100-500ML
Goat serum Sigma-Aldrich G9023
BSA Sigma A2153
rabbit pAb anti-OCT4 Abcam ab19857 Use at a concentration of 3 μg/ml
rabbit pAb anti-SOX2 Abcam ab97959 Use at a concentration of 1 μg/ml
rabbit pAb anti-Nanog Abcam ab80892 Use at a concentration of 1 μg/ml
mouse mAb anti-SSEA1 Abcam ab16285 Use at a concentration of 20 μg/ml
goat pAb anti-rabbit IgG labeled with Cy3 Jackson ImmunoResearch Laboratories Inc. 111-165-003-JIR Use at a concentration of 1/250
goat pAb anti-mouse IgG labeled with Cy3 Jackson ImmunoResearch Laboratories Inc. 115-165-003-JIR Use at a concentration of 1/250
VECTASHIELD mounting medium with DAPI Vector Laboratories H-1200
BCIP/NBT liquid substrate system Sigma B1911
Aqueous mounting medium Sigma
16% Paraformaldehyde Fisher AA433689M Stock solution is 16%, use it at 4%
Hematoxylin and eosin Sigma GH53/HT110216
PAS staining Sigma 395B

DOWNLOAD MATERIALS LIST

References

  1. Blelloch, R., Venere, M., Yen, J., Ramalho-Santos, M. Generation Of Induced Pluripotent Stem Cells In The Absence Of Drug Selection. Cell Stem Cell. 1, 245-247 (2007).
  2. Stadtfeld, M., Nagaya, M., Utikal, J., Weir, G., Hochedlinger, K. Induced Pluripotent Stem Cells Generated Without Viral Integration. Science. 322, 945-949 (2008).
  3. Takahashi, K., et al. Induction Of Pluripotent Stem Cells From Adult Human Fibroblasts By Defined Factors. Cell. 131, 861-872 (2007).
  4. Takahashi, K., Yamanaka, S. Induction Of Pluripotent Stem Cells From Mouse Embryonic And Adult Fibroblast Cultures By Defined Factors. Cell. 126, 663-676 (2006).
  5. Yu, J., et al. Induced Pluripotent Stem Cell Lines Derived From Human Somatic Cells. Science. 318, 1917-1920 (2007).
  6. Gonzalez, F., et al. Generation Of Mouse-Induced Pluripotent Stem Cells By Transient Expression Of A Single Nonviral Polycistronic Vector. Proc. Natl. Acad. Sci. U.S.A. 106, 8918-8922 (2009).
  7. Okita, K., Nakagawa, M., Hyenjong, H., Ichisaka, T., Yamanaka, S. Generation Of Mouse Induced Pluripotent Stem Cells Without Viral Vectors. Science. 322, 949-953 (2008).
  8. Woltjen, K., et al. Piggybac Transposition Reprograms Fibroblasts To Induced Pluripotent Stem Cells. Nature. 458, 766-770 (2009).
  9. Yusa, K., Rad, R., Takeda, J., Bradley, A. Generation Of Transgene-Free Induced Pluripotent Mouse Stem Cells By The Piggybac Transposon. Nat. Meth. 6, 363-369 (2009).
  10. Warren, L., et al. Highly Efficient Reprogramming To Pluripotency And Directed Differentiation Of Human Cells With Synthetic Modified Mrna. Cell Stem Cell. 7, 618-630 (2010).
  11. Kim, D., et al. Generation Of Human Induced Pluripotent Stem Cells By Direct Delivery Of Reprogramming Proteins. Cell Stem Cell. 4, 472-476 (2009).
  12. Zhou, H., et al. Generation Of Induced Pluripotent Stem Cells Using Recombinant Proteins. Cell Stem Cell. 4, 381-384 (2009).
  13. Anokye-Danso, F., et al. Highly Efficient Mirna-Mediated Reprogramming Of Mouse And Human Somatic Cells To Pluripotency. Cell Stem Cell. 8, 376-388 (2011).
  14. Lin, S. -L., et al. Regulation Of Somatic Cell Reprogramming Through Inducible Mir-302 Expression. Nucleic Acids Res. , (2011).
  15. Miyoshi, N., et al. Reprogramming Of Mouse And Human Cells To Pluripotency Using Mature Micrornas. Cell Stem Cell. 8, 633-638 (2011).
  16. Subramanyam, D., et al. Multiple Targets Of Mir-302 And Mir-372 Promote Reprogramming Of Human Fibroblasts To Induced Pluripotent Stem Cells. Nat. Biotechnol. 29, 443-448 (2011).
  17. Dolgin, E. Flaw In Induced-Stem-Cell Model. Nature. 470, 13 (2011).
  18. Miura, K., et al. Variation In The Safety Of Induced Pluripotent Stem Cell Lines. Nat. Biotech. 27, 743-745 (2009).
  19. Pera, M. The Dark Side Of Pluripotency. Nature. 471, 46-47 (2011).
  20. Saha, K., Jaenisch, R. Technical Challenges In Using Human Induced Pluripotent Stem Cells To Model Disease. Cell Stem Cell. 5, 584-595 (2009).
  21. Okita, K., Ichisaka, T., Yamanaka, S. Generation Of Germline-Competent Induced Pluripotent Stem Cells. Nature. 448, 313-317 (2007).
  22. Varas, F., et al. Fibroblast-Derived Induced Pluripotent Stem Cells Show No Common Retroviral Vector Insertions. Stem Cells. 27, 300-306 (2009).
  23. Jia, F., et al. A Nonviral Minicircle Vector For Deriving Human Ips Cells. Nat. Meth. 7, 197-199 (2010).
  24. Gonzalez, F., Boue, S., Belmonte, J. C. I. Methods For Making Induced Pluripotent Stem Cells: Reprogramming A La. Nat. Rev. Genet. 12, 231-242 (2011).
  25. Stadtfeld, M., Hochedlinger, K. Induced Pluripotency: History, Mechanisms, And Applications. Genes Dev. 24, 2239-2263 (2011).
  26. Gore, A., et al. Somatic Coding Mutations In Human Induced Pluripotent Stem Cells. Nature. 471, 63-67 (2011).
  27. Hussein, S. M., et al. Copy Number Variation And Selection During Reprogramming To Pluripotency. Nature. 471, 58-62 (2011).
  28. Lister, R., et al. Hotspots Of Aberrant Epigenomic Reprogramming In Human Induced Pluripotent Stem Cells. Nature. 471, 68-73 (2011).
  29. Yilmazer, A., De Lázaro, I., Bussy, C., Kostarelos, K. In Vivo Cell Reprogramming Towards Pluripotency By Virus-Free Overexpression Of Defined Factors. Plos One. 8, (2013).
  30. Liu, F., Song, Y. K., Liu, D. Hydrodynamics-Based Transfection In Animals By Systemic Administration Of Plasmid Dna. Gene Ther. 6, 1258-1266 (1999).
  31. Zhang, G., Budker, V., Wolff, J. A. High Levels Of Foreign Gene Expression In Hepatocytes After Tail Vein Injections Of Naked Plasmid Dna. Hum. Gene. Ther. 10, 1735-1737 (1999).
  32. Yamanaka, S. Induced Pluripotent Stem Cells: Past, Present, And Future. Cell Stem Cell. 10, 678-684 (2012).
  33. Therapy Giacca, M. G. ene , Springer. (2010).
  34. Colella, P., Auricchio, A. Aav-Mediated Gene Supply For Treatment Of Degenerative And Neovascular Retinal Diseases. Curr. Gene Ther. 10, 371-380 (2010).
  35. Dayton, R. D., Wang, D. B., Klein, R. L. The Advent Of Aav9 Expands Applications For Brain And Spinal Cord Gene Delivery. Expert Opin. Biol. Ther. 12, 757-766 (2012).
  36. Mccown, T. J. Adeno-Associated Virus (Aav) Vectors In The Cns. Curr. Gene Ther. 11, 181-188 (2011).
  37. Vandenberghe, L. H., Auricchio, A. Novel Adeno-Associated Viral Vectors For Retinal Gene Therapy. Gene Ther. 19, 162-168 (2012).
  38. Herweijer, H., Wolff, J. A. Progress And Prospects: Naked Dna Gene Transfer And Therapy. Gene Ther. 10, 453-458 (2003).
  39. Wolff, J. A., Budker, V. The Mechanism Of Naked Dna Uptake And Expression. Adv. Genet. 54, 3-20 (2005).
<em>En</em> Reprogramación <em>vivo</em> de células somáticas de adultos a Pluripotencia por la sobreexpresión de factores de Yamanaka
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yilmazer, A., de Lázaro, I.,… More

Yilmazer, A., de Lázaro, I., Bussy, C., Kostarelos, K. In vivo Reprogramming of Adult Somatic Cells to Pluripotency by Overexpression of Yamanaka Factors. J. Vis. Exp. (82), e50837, doi:10.3791/50837 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter