Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

הקרנת גנטיקה קדימה VIGS בתיווך לזיהוי גני המעורבים בהתנגדות Nonhost

doi: 10.3791/51033 Published: August 23, 2013

Summary

וירוס-Induced השתקת הגן היא כלי שימושי לזיהוי גני המעורבים בהתנגדות nonhost של צמחים. אנו מדגימים את השימוש בחיידקים פתוגנים המבטאים GFPuv בזיהוי גנים מושתקים צמחים רגישים לפתוגנים nonhost. גישה זו היא קלה, מהירה ומאפשרת הקרנה בקנה מידה גדולה ופרוטוקול דומה ניתן ליישם בחקר אינטראקציות צמח חיידק אחרים שונות.

Abstract

עמידות למחלות של צמחי Nonhost נגד חיידקים פתוגנים נשלטת על ידי מסלולים הבטחוני מורכבים. הבנת מנגנון זה היא חשובה לפיתוח צמחים עמידים למחלה עמידות כנגד מגוון רחב של פתוגנים. וירוס-Induced השתקת גן (VIGS) הקרנה מבוססת קדימה גנטיקה היא גישה שימושית לזיהוי של גנים להגנת צמחים הקניית התנגדות nonhost. וירוס רעשן טבק (TRV) וקטור VIGS הוא וקטור VIGS יעיל ביותר עד כה, וכבר בשימוש על בסיס יעילות כדי להשתיק גני המטרה אנדוגניים בניקוטיאנה benthamiana.

בכתב היד הזה, אנחנו מדגימים את גישת הקרנת גנטיקה קדימה להשתקה של שיבוטים בודדים מספריית cDNA בנ benthamiana והערכת התגובה של צמחים הושתקו גן לנפרץ התנגדות nonhost נגד פתוגנים nonhost, Pseudomonas syringae PV. עגבניות T1, פ syringae PV. glycinea, וX. campestris PV. סיקטור. חיידקים פתוגנים אלה מהונדסים לחלבון GFPuv המפורש וניתן לראות על ידי עין בלתי מזוינת מושבות fluorescing הירוקות שלהם תחת אור UV בצמחים מחוסן הפתוגן nonhost אם גן היעד השתיק מעורבת בהקניית עמידות nonhost. זה מאפשר זיהוי אמין ומהיר של גנים מושתקים צמחים רגישים לפתוגנים nonhost. יתר על כן, מידע גן המועמד מבטיח יכול להיות מוכר על ידי הוספת רצף גן הצמח בTRV וקטור. כאן אנו מדגימים את יכולת התפוקה הגבוהה של גנטיקה קדימה VIGS בתיווך לזהות גני המעורבים בהתנגדות nonhost. כ, 100 cDNAs יכול להיות מושתק באופן אישי בכ שבועות עד שלושה שבועות ואת הרלוונטיות שלהם בהתנגדות nonhost נגד מספר חיידקים פתוגנים nonhost ניתן ללמוד בשבוע שלאחר מכן. בכתב היד הזה, אנו למנות מעורבים בהקרנה זו את הצעדים המפורטים. VIGS בתיווך קדימה הגנטיקה screeniגישת ng ניתן להרחיב לא רק לגנים מעורבים בזיהוי התנגדות nonhost אלא גם כדי ללמוד כמה גני הקניית העמידות מתח יוטיים ואביוטי במינים צמחים שונים.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

התנגדות Nonhost היא ההתנגדות של כל מיני צמחים נגד גזעים של 1,2 הפתוגן מסוים. זה מקנה קשת רחבה ועמידות למחלות בצמחים עמידים 2,3. עם זאת, המנגנון שלה, במיוחד נגד חיידקים פתוגנים, אינו מובן היטב 4. הקרנה למוטציות או צמחים השתיקו כי התנגדות nonhost פשרה, ואפיון תמליל תפוקה גבוהה לזיהוי של גנים באופן דיפרנציאלי לידי ביטוי במהלך nonhost התנגדות 5-9 שתי גישות עיקריות המשמשות בעבר להתנגדות לנתח nonhost חיידקים. בגלל התנגדות nonhost נשלטת על ידי מנגנון מורכב (ים) 4 עם המעורבות של גנים רבים, גישה פונקציונלי תפוקה גבוהה גנומי לזיהוי גן הוא קריטי להבנת מנגנון התנגדות nonhost (ים) טובה יותר.

וירוס-Induced השתקת גן (VIGS) שימש בהצלחה להשתיק צמח אנדוגניהגנים במיני צמחים רבים 10,11. ניקוטיאנה benthamiana הוא אחד הצמחים המתאימים ביותר עבור VIGS 10,12 וטיוטת רצף הגנום שלו זמין כעת 13. וירוס רעשן טבק (TRV) מבוסס VIGS כבר בשימוש נרחב ככלי גנטיקה הפוך כדי לאפיין את הגנים מעורבים בnonhost התנגדות 2,4,14. וקטורים ונגזרים VIGS זה זמינים כעת דרך מרכז משאבים ביולוגי ארבידופסיס (ABRC, http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html). VIGS שימש גם ככלי לזיהוי גנטיקה קדימה גני המעורבים בחסינות צמח 15-17, התנגדות nonhost במיוחד 6,18. הערכת תגובת רגישות יתר (HR) בתיווך מוות של תאים הנגרם על ידי צמחים נגד הפתוגן nonhost ספציפי והערכת המוות של תאים הנגרם המחלה הן שני מבחני עיקריים המשמשים בעיקר לidentifyinגן רגיש גרם השתיק צמחים. עם זאת, המוות של תאי HR מושרה רק נגד פתוגנים nonhost מסוג II ולא נגד סוג I-nonhost פתוגנים 2. לפיכך, מבחני HR לא ניתן להשתמש באופן אוניברסלי לזהות אסטרטגיות התנגדות nonhost בשימוש על ידי צמחים, במיוחד נגד מגוון רחב של סוג I-פתוגנים nonhost. כמו כן, אובדן חלקי של התנגדות nonhost במפעל הושתק גן לא תמיד להוביל למחלות סימפטומים 6 ולכן ניקוד מחלה לא יכול לשמש לזיהוי צמחים להתפשר התנגדות nonhost. בניגוד, בהערכת הצמיחה של פתוגנים nonhost במפעלי גנים המושתקים היא שיטה טובה יותר ללימוד הפסד של התנגדות nonhost בצמחי גנים מושתקים.

בהשוואה לגידול קונבנציונלי assay 6,19, שיטה מהירה יותר להערכת התפתחות חיידקי nonhost על צמחי הגן המושתקים יכול לקצר את הזמן הנדרש להקרנת גנטיקה קדימה. מוקדם יותר דיווחו לנו שיטה להתבוננות חיידקיםצמיחת הפתוגן לשמאל על ידי עלים עין בלתי מזוינת באולטרה סגול (UV) אור באמצעות חיידקים לבטא חלבון (GFP) 19 ניאון ירוק. בכתב היד הזה אנחנו מדגימים את השימושיות של GFPuv להביע חיידקים פתוגנים nonhost לזיהוי קל של צמחי גנים מושתקים שנפרצו להתנגדות nonhost. מתודולוגיה זו היא מדויקת לזיהוי של צמחים רגישים ונוחה להקרנת תפוקה גבוהה.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. גידול צמחים והשתקת גני יעד

  1. תנאי גידול צמחים:
    1. נ 'תזרע זרעי benthamiana על אדמה פחות תערובת שתילה, מטרו-Mix 350 ואת הזרעים לנבוט בתא גידול. כל אדמה אחרת או אדמה פחות בינונית יכולה לשמש גם במקום מטרו-Mix.
    2. השתלת שלושה בשבוע שתילים ישנים לתוך סירים בודדים ולגדל אותם בחממה המתנהלת ב21 ± 2 ° C יחד עם תנאי גידול אחרים, כמפורט בספרות קודמת 12. שניים עד שלושה ימים לאחר ההשתלה, צמחים יכולים לשמש לTRV חיסון.
  2. גידול TRV2 שיבוטים:
    TRV הוא וירוס bipartite והגנום שלו מורכב מRNA1 וRNA2. RNA1 מקודד RNA פולימראז RNA תלוי וחלבון תנועת 20,21. RNA2 מקודד חלבון מעיל (CP) ושני חלבוני nonstructural מRNAs subgenomic 21. שניהם RNA1 וRNA2 נדרשים להיווצרות של vir התבגרשלנו חלקיקים והתפשטותם 20,21. בניית ספריית cDNA בוקטור TRV2 מתוארת בספרות קודמת 22,23. בקצרה, ספריית VIGS השתמשה במחקר זה נבנתה מRNA חילוץ מרקמות עלים החשופים לelicitors יוטיים ואביוטי שונים.
    1. קח את Agrobacterium (GV2260 זן) המכיל את השיבוטים cDNA בוקטור TRV2 (96 גם צלחת) מהמקפיא. בהדרגה להפשיר אותם ואחרי התרבויות להגיע לטמפרטורת חדר, לחסן את תרבות Agrobacterium פרט על צלחת אגר לוריא-Bertani (LB) עם ריפאמפיצין (10 מיקרוגרם / מ"ל) וkanamycin (50 מיקרוגרם / מ"ל) באמצעות משכפל 96 פינים.
    2. דגירה הצלחות על 28 מעלות צלזיוס במשך יומיים. בדרך כלל אנחנו גדלים ארבע מושבות לשכפל לכל שיבוט, כך שבידוד Agrobacterium נאות זמין עבור חיסון זין של שני מפעלים. לבצע את כל השלבים בתנאים סטריליים.
  3. VIGS:
    1. לגדולAgrobacterium (GV2260) נשא TRV1 על 28 מעלות צלזיוס במדיום נוזלי LB עם אנטיביוטיקה שהוזכר לעיל. קציר תאים על ידי צנטריפוגה מתרבויות גדלו לילה, מחדש להשעות בחיץ החיסון (10 מ"מ MES, pH 5.5; acetosyringone מיקרומטר 200), ו דגירה במשך 3 שעות בטמפרטורת חדר על שייקר ב50 סל"ד.
    2. קציר התאים על ידי צנטריפוגה מחדש להשעות ב5 מ"מ MES חיץ (pH 5.5) ולחסן (OD 600 = 0.3) לצד abaxial של 3-4 נ benthamiana משאיר באמצעות מזרק מחטים. הליך חיסון מפורט בא לידי ביטוי בספרות קודמת 24. מאוחר יותר, באתר של TRV1 חיסון, לחסן TRV2 מושבות בהתאמה ידי לדקור את העלים עם קיסם.
    3. לשמור על הצמחים עם תזונה נאותה כצמיחה נמרצת חשובה לVIGS יעיל 12. כשני שבועות חיסון הודעה את תעתיקי גנים ממוקדים יתחילו להפחית את הצמחים והם מוכנים לחנ"ל הפתוגןulation בשלושה שבועות לאחר TRV חיסון.

2. הכנת תרבויות הפתוגן Nonhost וחיסון צמח

  1. פרטים של פתוגנים השתמשו במחקר זה:
    Pseudomonas syringae PV. Tabaci, פ syringae PV. עגבניות T1, פ syringae PV. glycinea וXanthomonas campestris PV. סיקטור משמשים במחקר זה. לגדול פ זני syringae בB של המלך (KB) מדיום הנוזלי בתוספת ריפאמפיצין (10 מיקרוגרם / מ"ל), kanamycin (50 מיקרוגרם / מ"ל) ב 28 מעלות צלזיוס למשך 12 שעות. לגדול X. campestris PV. סיקטור במדיום נוזלי LB עבור 16 שעות. כל הפתוגנים נמל פלסמיד שיכול להביע GFPuv כפי שמתואר בספרות קודמת 19.
  2. הכנה של תרבויות פתוגן לחיסון צמח:
    1. קציר תאים חיידקיים על ידי צנטריפוגה ולאשר את קיומו של הקרינה ירוקה באמצעות ארוך waמנורת UV velength בחושך. לשטוף את התאים פעמיים עם מים סטריליים מחדש להשעות אותם לריכוז הרצוי להשתמש במים סטריליים.
    2. לחסן הפתוגן בהתאמה (ים) לצד abaxial של עלים הושתקו גן המטרה (5 עד 8 ​​ה ה) כנקודות (כ -1.5 ס"מ קוטר). פתוגנים nonhost כמה ניתן לבדוק בו זמנית לצמיחה שלהם במפעלים הושתקו גן המטרה. במקביל לחסן הפתוגן המארח כמו זה יכול לשמש כביקורת חיובית לצפייה בהתפתחות חיידקי planta. גם וקטור שליטה לחסן (TRV :: 00) צמחים.

3. התבוננות בצמיחת planta של חיידקים פתוגנים

  1. לחשוף את העלים מחוסן לאור UV אורך גל ארוך בחושך. ניתן לצפות במושבות חיידקים כנקודות ניאון ירוקות בצד abaxial של העלה ברקע של הקרינה הנפלטת על ידי אדום פני עלה.
  2. שים לב לצמיחת הפתוגןמימים שלאחר חיסון 2 (dpi) עד 5 dpi. תצפית יומיומית במהלך פרק זמן זה היא הכרחית.
  3. לאחר המסך הראשון, רשימה קצרה את תוצאות השיבוטים בצמיחה של פתוגן nonhost אחד או יותר (ים) השתקתם.
  4. חזור על VIGS לשיבוטים הנבחרים ושוב לבדוק את התגובה של צמחי גן מושתקים לפתוגן nonhost (ים). רמה שנייה זה של הקרנה נעשה כדי להסיר את התוצאות החיוביות השגויות שהושגו במהלך המסך הראשון.

4. אישור על צמחי המועמדים להתנגדות Nonhost נפרצה

  1. להשתיק את השיבוטים cDNA שנבחרו מתוך המסך כמתואר לעיל. לחסן את המפעל כולו עם הפתוגן nonhost (ים) על ידי השריית את הצמחים עם תרבויות פתוגן בהתאמה עם 0.01% (V / V) Silwet L-77 והעמדת צמחים השקועים לשאוב במשך 3 - 5 דקות. לכמת את התפתחות החיידקים על ידי assay גידול הקונבנציונלי 6,18,19 כפי שיתואר להלן.
  2. בשעות שלאחר החיסון 0 (HPI),3 dpi ו5 dpi, לאסוף שתי דגימות עלים מחמישה עלים ביולוגיים משכפל עבור כל פתוגן nonhost (ים) מחוסן באמצעות אגרוף עלה (0.5 ס"מ) 2. טוחנים את דגימות עלים, הסידורי לדלל וצלחת SAP במדיום אגר בייט בתוספת אנטיביוטיקה ודגירה מתאימות על 28 מעלות צלזיוס למשך 2 ימים. לספור את מושבות חיידקים באמצעות מונה מושבה ולחשב את התפתחות החיידקים בעלים כפי שמתוארים בספרות קודמת 6.
  3. צמחים רגישים לפתוגן nonhost (ים) צריכים להראות מספר גבוה יותר של צמיחת הפתוגן בהשוואה לבקרת וקטור.

5. רצף הוספה וזיהוי גן המטרה

  1. בצע מושבה PCR לשיבוט שנבחר באמצעות attB1 וattB2 פריימרים או תוך שימוש בפריימרים איגוף אתר שיבוט בוקטור TRV2. הפעל את המוצר ה-PCR בג'ל ולבדוק להגברה של להקה אחת.
  2. הוספת צמח בגן וקטור TRV2 יכולה להיות רצף באמצעות attBפריימרים או primers איגוף אתר השיבוט.
  3. בצע תפציץ באמצעות הרצף ולזהות פרטי הגן.
  4. להשיג רצף גן באורך מלא יחד עם האזורים בלתי המתורגמים (UTRs).
  5. בחר 300-400 ברים נ"ב משלושה אזורים של הרצף שונים ולשכפל אותם לTRV2 וקטור. באופן עצמאי לבצע VIGS תוך שימוש בכל שלושת מבני VIGS ולאשר את הפשרה של התנגדות nonhost בכל שלושת הצמחים השתיקו גנים.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

מטרה העיקרית של מחקר זה היא להדגים שיטה לזיהוי קל ומדויק של הגן השתיק נ צמחי benthamiana שנפרצו להתנגדות nonhost. ישנם ארבעה שלבים עיקריים בשיטה זו. צעד הראשון הוא בנפרד כדי להשתיק מספר רב של גנים באמצעות TRV-VIGS. אנחנו השתקנו כ -5,000 גנים 6,18 על פני תקופה של כ -1.5 שנים באמצעות הפרוטוקול המתואר באיור 1. חלק מצמחי הגן המושתקים הראה שינויים פנוטיפי שונים, כולל עיכוב גדילה, מצהיב ותמונת הלבנת-פנוטיפים (איור 2).

שלב שני הוא זיהוי של צמחי גן מושתקים מראים רגישות לפתוגן nonhost (ים). אנחנו השתמשנו חיידקים המבטאים GFPuv ומעקב הצמיחה שלהם בplanta (ציורי A3-C3). כדי להמחיש את התהליך של איתור הגן השתיק צמחים רגישים לnonhost עמ 'athogen (ים), השתמשנו בשלושה nonhost פתוגנים, פ syringae PV. עגבניות T1, פ syringae PV. glycinea וX. campestris PV. סיקטור. כצפוי, לא השתיק (וקטור שליטה) נ צמחי benthamiana מחוסן עם פתוגנים אלה לא גדלו כמו שהם לא יכולים להתגבר על חסינות הצמח. עם זאת, פ T1. עגבניות PV syringae הקים מושבות ניאון ירוקות על NbSGT1 גן (גן מעורב בהתנגדות nonhost 25) השתיקו צמחים (איור 3D). נתונים אלה מדגימים את התהליך של זיהוי צמחי גנים מושתקים שנפרצו להתנגדות nonhost. פרוטוקול זה יכול להיות מיושם באופן ישיר כדי להעביר הקרנת גנטיקה. לדוגמה, התוצאות המייצגות נלקחו מאחד הקודם קדימה הגנטיקה המסך שלנו (איור 4) ניתן לראות שני צמחים השתיקו גנים עצמאיים עם מידה שונה של פ PV צמיחת T1. עגבניות syringae (איור 5

צעד שלישי הוא האישור של התפתחות חיידקים בצמחי גנים המושתקים שזוהו מהמסך על ידי כימותי התפתחות החיידקים. דוגמה להערכה בהתפתחות חיידקי planta בNbSGT1 צמחי הגן המושתק מוצגת באיור 3E. תוצאות מחקר הראה כי בצמיחת planta של פ syringae PV. עגבניות T1 היה גבוה הרבה יותר בNbSGT1 צמחים השתיקו בהשוואה לצמחי ביקורת שאינן מושתקים (TRV :: 00) (איור 3E). הפסד של התנגדות nonhost בשל השתקת גנים מסוימת יכול להיות חלקי או מלא. בהתאם לכך, היקף צמיחת הפתוגן nonhost על הצמחים השתיקו גנים יכול להשתנות.

השלב הרביעי הוא רצף להכניס בTRV2 וקטור. תפציץ מתבצע באמצעות רצף זה כדי לזהות את הגן ואת פרטיו.

איור 1 איור 1. קריקטורה מראה המעורבות בהשתקת מספר רב של גנים באמצעות VIGS מבוסס TRV המדרגות. שלוש הזקן נ 'בשבוע צמחי benthamiana הם הושתלו סירים נפרדים ואפשרו לגדול לכמה ימים. Agrobacterium ביצוע TRV1 מבנה הוא שחדר לשלושה עד ארבעה עלים באמצעות מזרק מיותר. מאוחר יותר, 96 שיבוטים cDNA גדלו על צלחת אגר LB נלקחים בנפרד באמצעות קיסם ודקרו למקום מחוסן TRV1 של צמחים בהתאמה. כ 3 שבועות לאחר חיסון, השתקת גני היעד מתרחשת בעלים חדשים שגדלו העליונים שאינם מחוסן. עלים אלה (5 ​​עד 8 ​​ה ה) משמשים לבדיקת הצמיחה של פתוגן nonhost (ים).

איור 2
איור 2. הקרנת גנטיקה קדימה VIGS בתיווךנ benthamiana מציג שינויים שונים בפנוטיפ הצמח. הזקן נ 'בת שלושה שבועות צמחי benthamiana מחוסן באופן עצמאי עם TRV המתאים מושגים שdescried באיור 1 כחלק ממסך גנטיקה קדימה מוצגים. תמונות צולמו ב 21 ימים לאחר TRV חיסון.

איור 3
איור 3. ירוקה הקרינה מGFPuv להביע חיידקים פתוגנים ושימוש בו לצורך זיהוי של גני המעורבים בהתנגדות nonhost. Pseudomonas syringae PV. Tabaci, הפתוגן מארח, שנשא GFPuv לבנות מפוספסת על צלחת KB בינונית מציג פלואורסצנטי ירוק תחת אור UV גל ארוך בחושך ( א). חיידקים אלה גדלים על מדיום KB ומחדש תלויים במים (ב ') ומחוסן לנ benthamiana 4 CFU / מ"ל). בגיל 3 ימים לאחר החיסון (dpi) מושבות חיידקים נתפסות ככתמים ירוקים ניאון על ידי עין בלתי מזוינת מצד abaxial של תאי אפידרמיס עלים (C, משמאל). אותו עלה תמונה תחת אור רגיל (בטווח נראה לעין) מוצג גם (C, מימין). GFPuv להביע פ syringae PV. tabaci שלוש nonhost פתוגנים (Pstab, 1 x 10 4 CFU / מ"ל) ו, פ syringae PV. עגבניות T1 (PstT1, x 10 4 CFU 1 / מ"ל), פ . Syringae PV glycinea (PSG, 3 x 10 5 CFU / מ"ל) וXanthomonas campestris PV סיקטור (XCV, 3 x 10 4 CFU / מ"ל) מחוסנים לצד abaxial של עלים מוקטור שליטה (TRV :: 00. ד ', משמאל) וNbSGT1 צמחים השתיקו גן (ד', מימין). מושבות חיידקים של Pstab נתפסות על שני עלים ואלה של PstT1 נתפסים רק על NbSGT1 גן השתיק עלים. PstT1 צמיחה בNbSGT1 גן השתיק עלים לכמת ב 24, 24 ו -72 שעות לאחר חיסון (HPI, E) מוצג בגרף. לחץ כאן לצפייה בדמות גדולה.

איור 4
איור 4. סקירה כללית של פרוטוקול ואחריו להקרנת גנטיקה קדימה VIGS בתיווך לזיהוי גני המעורבים בהתנגדות nonhost. ספריית cDNA בוקטור TRV2 נבנה באמצעות RNA מן הפתוגן nonhost (ים) מחוסן נ עלים benthamiana יכולים לשמש להקרנה. שיבוטים בודדים מספריית cDNA מושתקים בנ benthamiana ידי TRV-VIGS. GFPuv בהתאמה להביע פתוגן חיידקי nonhost (ים) הוא מחוסן לעלי הצמח המושתקים גנים. בין 2 ל4 dpi הנקודות מחוסן הם נצפו באמצעות מנורת UV בחושך ואת הצמחים המראים צמיחת הפתוגן nonhost מזוהים. לאחר סינון ראשוני זה, השיבוטים שנבחרו שוב והשתיקו את צמיחת הפתוגן nonhost היא אושר. מסך רמה שני זה נעשה כדי להסיר את התוצאות החיוביות השגויות. מאוחר יותר, אישר שיבוטים מושתקים בפעם שלישית וצמיחת חיידקים בהתאמה מוערכת. הוספת של שיבוטים המתאימים בוקטור TRV2 הם רצף והמידע גנטי מזוהה. במקביל assay משאבי אנוש יכול גם להתבצע על צמחי הגן המושתקים לזיהוי גנים התורמים למשאבי אנוש מושרה נגד פתוגנים nonhost מסוג II.

איור 5
איור 5. צמיחת Nonhost חיידקים פתוגנים בצמחי גנים מושתקים שזוהו כחלק ממסך גנטיקה קדימה. תמונות מforwarהקרנת הגנטיקה ד שהגנים שזוהו היו מעורבים בהתנגדות nonhost של נ ' צמחים נגד benthamiana PstT1, PSG וXCV. תמונות שצולמו לשני מפעלי גנים מושתקים יציגים ב3 dpi לאחר החיסון מוצגות כאן. ריכוזי חיידקים המשמשים לחיסון מתוארים באיור 3. 43D4 או 94C1 מציין את מספר 96 גם הצלחת ואחריו גם את המספר.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

חסינות צמח מגבילה את הצמיחה של פתוגנים nonhost ולכן, מעט או ללא הקרינה ירוקה נפלט ממפעל בקרת וקטור משאיר מחוסן עם הפתוגן nonhost תחת אור UV אורך גל ארוך (איור 3D). עם זאת, כאשר גן המעורב בהתנגדות nonhost מושתק, הצמחים השתיקו גנים להעדיף הצמיחה של הקרינה הפתוגן והירוקה nonhost נתפס (איור 3E). זהו העיקרון הבסיסי המעורב בשיטה המתוארת בכתב היד הזה. יש מתודולוגיה זו שני יתרונות גדולים על פני assay מבוסס משאבי אנוש. אחד, זיהוי של צמחים השתיקו רגישים לפתוגן nonhost ידי assay מבוסס GFPuv מגדיל את הדיוק כמו בצמיחת planta ניתן לצפות. שנית, שיטה זו מאפשרת זיהוי של גני המעורבים בשניהם 2,26 סוגי התנגדות nonhost (לא לגרום למוות של תאים גלויים) והתנגדות nonhost סוג II 2,26 (תוצאות במוות של תאים בתגובת רגישות יתר).לדוגמה, זיהינו שיבוט נקרא 6C8 והשתיקו את הצמחים היו רגישים לשני סוג 1 והסוג 2 פתוגנים 18 בעבר.

כמו כן, זה אפשרי ששני אנשים או יותר שיבוטים עצמאיים המשמשים לVIGS הביאו צמחים הושתקו גן עם פנוטיפים דומים כפי שהם קורים כדי להשתיק גן מסוים. יתירות זו שימושית כפי שהוא מאשר את הפנוטיפ ההשתקה. מופע של חזרות כאלה תלויה בספרייה המשמשת להקרנה וסוג של גן (כחלק מהגנים באים לידי ביטוי ביותר ולכן מתרחשים שוב ושוב בספרייה). יתר על כן, כמעט בכל שיבוט גנים המקודדים על ידי נ הגנום benthamiana לתוך ספריית VIGS cDNA ולהשתיק אותם באופן עצמאי הוא אפשרי.

על מנת ליישם את הקרנת הגנטיקה קדימה לזיהוי גני המעורבים בהתנגדות nonhost באמצעות VIGS אחרי assay הקרינה GFPuv ביעילות, בעצות הבאות הן שימושיות.

על מנתלVIGS המוצלח, (1) שימוש 3 - 4 צמחי הבמה עלה לTRV חיסון; (2) אופטימלי TRV1 וTRV2 כייל הוא חשוב. מאז TRV2 כייל יכול להיות גורם מגביל לייזום של VIGS, לחסן לפחות 4 מושבות חיידקים שגדלו באופן מלא של Agrobacterium מחסה TRV2, וכן (3) לשמור על תנאי סביבה אופטימליים 12. טמפרטורה סביבתית משחקת תפקיד מרכזי בגרימת VIGS האופטימלי.

שלבים קריטיים לאיתור יעיל של הקרינה ירוקה מפתוגנים כוללים: (1) משתמשים תמיד תרבויות פתוגן טריות שנקטפו בשלב גידול מעריכי ולא לאחסן אותם לפני החיסון, וכן (2) המוות של תאי HR יש להימנע ככל שהם יכולים אוטומטי לזרוח תחת UV האור ולהשפיע לרעה על התצפיות. זה חשוב במיוחד כאשר הפתוגן nonhost מסוג II (לדוגמה, פ syringae PV. עגבניות T1) משמש למחקר. השתמש בריכוז נמוך יותר של הפתוגן nonhost אם יש חשד HR המיקרוסקופי או EVidenced.

פתרון בעיות:

(1) חוסר עקביות בהשתקת גן ומופע של הפנוטיפ השתקה משתנה בין משכפל:

שנת כפפות לכל שיבוט במהלך חיסון TRV. כמו כן, ודא שמושבת Agrobacterium TRV2 אינו מכילה שיבוטים מרובים על ידי המושבה PCR. אם המושבה PCR מגלה להקה יותר מפעם אחת, זה אפשרי, כי שיבוט אחד או יותר נמצא במושבה. על מנת להפריד את השיבוטים, פסם על הצלחת אגר LB והמסך את השיבוטים במושבת PCR. לאחר זיהוי של שיבוטים בודדים, לבצע באופן עצמאי VIGS לכל אחד מהם ולזהות את התנגדות nonhost להתפשר הצמח השתיק גן.

(2) צמיחת פגמים חמורים בצמחים השתיקו:

אם גן היעד השתיק (ים) מעורב בחילוף חומרים בסיסי של צמחים, פגמי צמיחה צפויים. עם זאת, חלק של הגן השתיק תכניתTS עשוי להראות כפל גבוה יותר של TRV בהשוואה לצמחי בקרת וקטור וזה עלול לגרום להשפעה נוספת על חומרת הפנוטיפ. ניתן לבצע assay הנגע מקומי 12 על צמחי amaranticolor אווז כדי לברר אם יש את הצמחים השתיקו כייל TRV גבוה יותר בהשוואה לצמחי בקרת וקטור. בנסיבות אלה, צמחים כ 4 שבועות ישנים יכולים לשמש לVIGS כדי להפחית את חומרת הפנוטיפ.

(2) השתקת גנים מחוץ היעד:

השתקת גן שאינו ספציפית, המכונה לעתים קרובות כהשתקה מחוץ ליעד יכולה להתרחש במהלך VIGS. המצב זה מתרחש כאשר הומולוגיה ברצף חלקי מאפשרת siRNA שנוצר לגן המטרה להכפיש mRNA לגנים שאינם מטרות ההשתקה המיועדות 27. השתמש ברצפי UTR כהוספה בוקטור TRV2. ללמוד downregulation גן אנדוגני של כל הגנים מחוץ היעד הצפוי ולוודא שתיקות לבנות גן יחיד של עניין. T o להקל על זיהוי של גן עם שברי מינימום או אף את היעד, יכולים לשמש כלים לביואינפורמטיקה (לדוגמה, http://plantgrn.noble.org/pssRNAit/).

(3) לא פלואורסצנטי ירוק ממושבות חיידקים בplanta:

זו מתרחשת ככל הנראה על ידי השימוש של מעל תרבויות גדלו. סיבה נוספת יכולה להיות הבידוד חיידקים פחותים. למרות ריכוזי חיידקים ניתן למדוד באופן עקיף על ידי מדידת צפיפות אופטית OD 600, תאי חיידקים מתים יכולים לעשות עד קוטר חיצוני גבוה יותר. מומלץ לחשב ריכוז חיידקים אופטימלי המבוסס על הקמת יחידות מושבה (CFU) על ידי ספירת תאי חיים על הצלחת בינונית אגר בייט. יכולים להיות מותאמים המבוססים על ערכי OD CFU. כמו כן, הפתוגן לעתים קרובות ככל האפשר ממניות גליצרול פס, לגדל אותו על הצלחת אגר KB ולחסן מושבה אחת טרי להכנת תרבויות לחיסון.

"Jove_content"> (4) בעיות ברצף את הכנס:

גורם המתרחש בדרך כלל אחד לקשיים עם רצף להכניס בTRV2 וקטור (על ידי המושבה-PCR) הוא נוכחותם של מושבות מרובות. כדי להתגבר על זה, שיבוטים מחסה מבנה TRV2 אדם צריכים להיות מבודדים כאמור לעיל (מס '1).

מגבלות של השיטה והדרכים להתגבר על GFPuv:

פתוגנים עלולים לאבד GFPuv נושא פלסמיד בכפל ולכן, להשפיע לרעה על התצפיות. כמו כן, חלק מצמחי הגן המושתקים מציג תמונה מצהיבה והלבנה-עלים והעלים האלה פולטים הקרינה שונה (יותר מאדום). זה הופך את הקרינה הירוקה קשה לראות. אחת הדרכים להפחית את ההשפעה של הקרינה אוטומטית מן העלים הצהובים או לבנים הוא ללכוד תמונות של חיידקי הניאון הירוקים באמצעות מצלמה מצוידת במסננים שניתן להסיר או לצמצם את effe הרקעCT. תמונות יכולות לשמש כדי להסיק אם החיידקים גדלו או לא. תוכנות מסוימות (לדוגמה, Adobe Photoshop) יכולות לשמש כדי להפחית את אפקט הרקע במהלך הניתוח של תמונות כאלה.

אמצעי זהירות בטיחות ביולוגית כמו לרשות המתאימה של חיידקים פתוגנים מהונדס צריך להיות אחריו במהלך ניסויים. כמו כן, יש להשתמש בעור מתאים ומגיני הגנה על עיניים בעת טיפול במנורת UV.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

יש לנו מה למסור.

Acknowledgments

פרויקט זה מומן על ידי קרן נובל סמואל רוברטס. מחברים מודים למיז. Elles ג'ייני Gallaway וקולין לטיפול בצמח מצוין, והגב 'קייטי בראון ליצירות אמנות. כמו כן, אנו רוצים להודות למיז. טרינה קוטרל, פוג'ה Uppalapati, Moumita סאהה, Swetha Vinukonda ומר יצחק גרינהוט לעזרה טכנית בהקמתה של פרוטוקול זה.

Materials

Name Company Catalog Number Comments
96-well U-bottom plates Becton Dickinson Labware (Franklin Lakes, NJ, USA) 35-3077
96-pin replicator stainless steel Nalge Nunc International (Naperville, IL, USA) 250520
High Intensity UV Inspection Lamps, Model B-100ap Thomas scientific (Swedesboro, NJ, USA) 6283K50 Manufacturer ID 95-0127-01
Stuart SC6 colony counter Bibby Scientific Limited, Staffordshire, UK SC6PLUS
Soil-less potting mixture, Metro-Mix 350 SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)
Primers:
attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT)
attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)
Integrated DNA Technologies, Inc (Coralville, IA, USA) Custom synthesized
MES, Monohydrate VWR international (Radnor, PA, USA) CAS No. 145224-94-8
Acetosyringone (Dimethoxy-4’-hydroxyacetophenone) Sigma Aldrich (St. Louis, MO, USA) D134406
Vac-In-Stuff (Silwet L-77) Lehle Seeds (Round Rock, TX, USA) VIS-30

DOWNLOAD MATERIALS LIST

References

  1. Heath, M. C. Nonhost resistance and nonspecific plant defenses. Currrent Opinion in Plant Biology. 3, 315-319 (2000).
  2. Mysore, K. S., Ryu, C. -M. Nonhost resistance: how much do we know. Trends in Plant Science. 9, 97-104 (2004).
  3. Ellis, J. Insights into nonhost disease resistance: can they assist disease control in agriculture. The Plant Cell. 18, 523-528 (2006).
  4. Senthil-Kumar, M., Mysore, K. S. Nonhost resistance against bacterial pathogens: retrospects and prospects. Annual Review of Phytopathology. 51, (2013).
  5. Lu, M., Tang, X., Zhou, J. -M. Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria. The Plant Cell. 13, 437-447 (2001).
  6. Rojas, C. M., et al. Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways. The Plant Cell. 24, 336-352 (2012).
  7. Daurelio, L. D., et al. Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco. Journal of Plant Physiology. 168, 382-391 (2011).
  8. Moreau, M., et al. EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora. Molecular Plant-Microbe Interactions. 25, 421-430 (2012).
  9. Senthil-Kumar, M., Mysore, K. S. Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response. Plant, Cell & Environment. 35, 1329-1343 (2012).
  10. Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. Applications and advantages of virus-induced gene silencing for gene function studies in plants. The Plant Journal. 39, 734-746 (2004).
  11. Senthil-Kumar, M., Mysore, K. S. New dimensions for VIGS in plant functional genomics. Trends in Plant Science. 16, 656-665 (2011).
  12. Senthil-Kumar, M., Mysore, K. S. Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato. Plant Biotechnology Journal. 9, 797-806 (2011).
  13. Bombarely, A., et al. A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research. Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).
  14. Sharma, P. C., et al. Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana. Mol Gen Genomics. 269, 583-591 (2003).
  15. Baulcombe, D. C. Fast forward genetics based on virus-induced gene silencing. Current Opinion in Plant Biology. 2, 109-113 (1999).
  16. Lu, R., et al. High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO Journal. 22, 5690-5699 (2003).
  17. Pozo, O., Pedley, K. F., Martin, G. B. MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease. EMBO Journal. 23, 3072-3082 (2004).
  18. Wang, K., Senthil-Kumar, M., Ryu, C. -M., Kang, L., Mysore, K. S. Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast. Plant Physiology. 158, 1789-1802 (2012).
  19. Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv. New Phytologist. 174, 212-223 (2007).
  20. Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing. The Plant Journal. 25, 237-245 (2001).
  21. MacFarlane, S. A. Molecular biology of the tobraviruses. Journal of General Virology. 80, 2799-2807 (1999).
  22. Anand, A., et al. Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing. Molecular Plant-Microbe Interactions. 20, 41-52 (2007).
  23. Liu, E., Page, J. Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus. Plant Methods. 4, 5 (2008).
  24. Velásquez, A. C., Chakravarthy, S., Martin, G. B. Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato. J. Vis. Exp. (28), e1292 (2009).
  25. Peart, J. R., et al. Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants. Proceedings of the National Academy of Sciences. 99. 99-10869 (2002).
  26. Oh, S. -K., et al. Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco. Planta. 223, 1101-1107 (2006).
  27. Senthil-Kumar, M., Mysore, K. RNAi and Plant Gene Function Analysis. Methods in Molecular Biology. Kodama, H., Komamine, A. 744, Humana Press. 13-25 (2011).
הקרנת גנטיקה קדימה VIGS בתיווך לזיהוי גני המעורבים בהתנגדות Nonhost
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).More

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter