Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

VIGS-Mediated Forward Genetics Screening voor de identificatie van genen betrokken bij Nonhost Resistance

doi: 10.3791/51033 Published: August 23, 2013

Summary

Virus-geïnduceerde gene silencing is een nuttig hulpmiddel voor het identificeren van genen betrokken bij nonhost resistentie van planten. We demonstreren het gebruik van bacteriële pathogenen tot expressie GFPuv het identificeren gen zwijgen planten vatbaar voor nonhost pathogenen. Deze benadering is eenvoudig, snel en faciliteert grootschalige screening en soortgelijk protocol kan worden toegepast op het bestuderen van verschillende andere planten-microbe interacties.

Abstract

Nonhost ziekte resistentie van planten tegen bacteriële ziekteverwekkers wordt bestuurd door complexe verdedigingsmechanismen. Inzicht in dit mechanisme is van belang voor het ontwikkelen van duurzame ziekte-resistente planten tegen brede waaier van ziekteverwekkers. Virus-geïnduceerde gen silencing (VIGS) gebaseerde forward genetics screening is een nuttige aanpak voor de identificatie van het verdedigingsmechanisme van planten genen meegeven nonhost weerstand. Tobacco rattle virus (TRV) gebaseerde VIGS vector is de meest efficiënte VIGS vector to-date en is efficiënt gebruikt om endogene doelwitgenen zwijgen in Nicotiana benthamiana.

In dit manuscript, demonstreren we een forward genetics screening aanpak voor het tot zwijgen brengen van de individuele klonen uit een cDNA-bibliotheek in N. benthamiana en de beoordeling van de respons van gen tot zwijgen planten voor gecompromitteerde nonhost verzet tegen nonhost pathogenen, Pseudomonas syringae pv. tomaat T1, P. syringae pv. glycINEA, en X. campestris pv. vesicatoria. Deze bacteriële pathogenen zijn ontworpen om express GFPuv eiwitten en hun groene fluorescerende kolonies zichtbaar met het blote oog onder UV-licht in de nonhost pathogeen geënte planten als draaid doelgen is betrokken in het meegeven nonhost weerstand. Dit vergemakkelijkt betrouwbare en snellere identificatie van gen tot zwijgen planten vatbaar voor nonhost pathogenen. Verder kan veelbelovende kandidaat-gen gegevens worden gekend door sequencing de plant geninsert in TRV vector. Hier laten we de high throughput capaciteit van VIGS gemedieerde forward genetics genen betrokken bij nonhost weerstand identificeren. Ongeveer, kan 100 cDNA individueel tot zwijgen worden gebracht in ongeveer twee tot drie weken en hun relevantie in nonhost weerstand tegen verscheidene nonhost bacteriële pathogenen kan worden bestudeerd in een week daarna. In dit manuscript, sommen we de gedetailleerde stappen die betrokken zijn bij deze screening. VIGS-gemedieerde forward genetics screening aanpak kan worden uitgebreid niet alleen om de identificatie van genen die betrokken zijn bij nonhost verzet, maar ook aan het bestuderen van genen meegeven van verschillende biotische en abiotische stress tolerantie in verschillende plantensoorten.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nonhost weerstand is de weerstand van alle plantensoorten tegen rassen van een bepaalde ziekteverwekker 1,2. Dit zorgt voor breed spectrum en duurzame ziekte resistentie in planten 2,3. Echter, het mechanisme, met name tegen bacteriële pathogenen, niet goed begrepen 4. Screening voor mutanten of zwijgen planten die compromis nonhost weerstand, en hoge doorvoer transcriptprofilering voor de identificatie van differentieel tot expressie genen tijdens nonhost weerstand 5-9 zijn twee belangrijke benaderingen eerder gebruikt voor het ontleden van bacteriële nonhost weerstand. Omdat nonhost weerstand wordt geregeld door een complex mechanisme (s) 4 met betrokkenheid van vele genen, een high throughput functionele genomics benadering voor genidentificatie is cruciaal voor een beter begrip van de nonhost weerstandsmechanisme (s).

Virus-geïnduceerde genuitschakeling (VIGS) is met succes gebruikt om endogene planten zwijgengenen in veel plantensoorten 10,11. Nicotiana benthamiana is een van de meest geschikte planten voor VIGS 10,12 en zijn ontwerp-genoom sequentie is nu verkrijgbaar 13. Tobacco rattle virus (TRV) gebaseerde VIGS is op grote schaal gebruikt als reverse genetics hulpmiddel om genen die betrokken zijn bij nonhost weerstand 2,4,14 karakteriseren. Dit VIGS vectoren en derivaten zijn nu beschikbaar via Arabidopsis Biological Resource Center (ABRC, http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html ). VIGS is ook gebruikt als een forward genetics hulpmiddel voor het identificeren van genen betrokken bij planten immuniteit 15-17, vooral nonhost weerstand 6,18. Beoordelen van overgevoeligheidsreactie (HR)-gemedieerde celdood geïnduceerd door planten tegen een specifiek nonhost ziekteverwekker en de beoordeling van de ziekte geïnduceerde celdood zijn twee belangrijke tests voornamelijk gebruikt voor identifying gevoelige gen zwijgen planten. Echter, wordt HR celdood geïnduceerd alleen tegen type-II nonhost pathogenen en niet tegen het type-I nonhost ziekteverwekkers 2. Vandaar, HR testen kunnen niet worden universeel gebruikt voor nonhost weerstand strategieën gebruikt door planten te identificeren, met name tegen de brede waaier van het type-I nonhost ziekteverwekkers. Ook, gedeeltelijk verlies van nonhost resistentie in een gen zwijgen installatie niet altijd tot ziekteverschijnselen 6 en derhalve ziekte puntentelling niet worden gebruikt voor het identificeren van planten compromitteren nonhost weerstand. In tegenstelling, de beoordeling van de groei van pathogenen in de nonhost gen zwijgen planten is een betere methode voor het bestuderen van het verlies van nonhost resistentie gen in planten zwijgen.

Vergeleken met conventionele groei assay 6,19, een snellere methode om nonhost bacteriegroei het gen zwijgen planten kan de tijd die forward genetics screening verkorten. We eerder gemeld een werkwijze voor het observeren van bacteriënl pathogeen groei op bladeren met het blote oog onder ultraviolet (UV) licht met behulp van bacteriën uiten van groen fluorescerend eiwit (GFP) 19. In dit manuscript demonstreren we de bruikbaarheid van GFPuv expressie nonhost bacteriële pathogenen voor gemakkelijke identificatie van gen tot zwijgen planten die worden gecompromitteerd nonhost resistentie. Deze methode is nauwkeurig voor de identificatie van gevoelige planten en vatbaar voor high throughput screening.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Plant Groei en Target gen silencing

  1. Plantengroei voorwaarden:
    1. Sow N. benthamiana zaden op bodem-minder potgrond, Metro-Mix 350 en ontkiemen de zaden in een kweekkamer. Elk ander bodem of aardeloos medium kan ook worden gebruikt in plaats van Metro-Mix.
    2. Transplant drie weken oude zaailingen in individuele potten en ze groeien in een broeikas bij 21 ± 2 ° C, samen met andere groeiomstandigheden zoals beschreven in eerdere literatuur 12. Twee tot drie dagen na het uitplanten, kunnen planten worden gebruikt TRV inoculatie.
  2. Groeiende TRV2 klonen:
    TRV is een tweedelig virus en zijn genoom bestaat uit RNA1 en RNA2. RNA1 codeert voor een RNA-afhankelijke RNA polymerase en een beweging eiwit 20,21. RNA2 codeert voor een manteleiwit (CP) en twee niet-structurele proteïnen van het subgenome RNA's 21. Zowel RNA1 en RNA2 zijn nodig voor de vorming van gerijpte virons deeltjes en hun verspreiding 20,21. cDNA bibliotheek bouw in TRV2 vector is beschreven in eerdere literatuur 22,23. Kort VIGS bibliotheek in deze studie werd geconstrueerd van het RNA geëxtraheerd uit bladweefsel blootgesteld aan verschillende biotische en abiotische elicitors.
    1. Neem Agrobacterium (stam GV2260) met de cDNA klonen in TRV2 vector (een 96-well plaat) van de vriezer. Ze geleidelijk ontdooien en na het kweken op kamertemperatuur komen, beënten afzonderlijke Agrobacterium kweek op Luria-Bertani (LB) agar plaat met rifampicine (10 ug / ml) en kanamycine (50 ug / ml) met een 96-pin replicator.
    2. Incubeer de platen bij 28 ° C gedurende twee dagen. We groeien meestal vier repliceren kolonies voor elke kloon, zodat adequaat Agrobacterium inoculum is beschikbaar voor prikken enting van twee fabrieken. Voer alle stappen onder steriele omstandigheden.
  3. VIGS:
    1. GroeienAgrobacterium (GV2260) uitvoeren TRV1 bij 28 ° C in LB vloeibaar medium met bovengenoemde antibiotica. Oogst cellen door centrifugatie uit nacht gekweekt kweken, resuspendeer de inoculatie buffer (10 mM MES, pH 5,5, 200 pM acetosyringoon) en incubeer gedurende 3 uur bij kamertemperatuur op een schudinrichting bij 50 rpm.
    2. Oogst de cellen door centrifugeren en resuspendeer in 5 mM MES buffer (pH 5,5) en enten (OD 600 = 0,3) in abaxiale kant van 3-4 N. benthamiana laat met behulp van een naaldloze injectiespuit. Gedetailleerde inoculatie procedure in voorafgaand literatuur 24. Later, op de plaats van inoculatie TRV1 Inoculeer respectieve TRV2 kolonies door een prik de bladeren met een tandenstoker.
    3. Onderhouden van de planten met adequate voeding als krachtige groei is belangrijk voor een efficiënte VIGS 12. Ongeveer twee weken na inoculatie van de transcripties van gerichte genen zal beginnen te verlagen en de planten zijn klaar voor pathogeen Inoculatie drie weken na de TRV inenting.

2. Voorbereiding van Nonhost Pathogen Culturen en Plant Enten

  1. Details van pathogenen die in deze studie:
    Pseudomonas syringae pv. Tabaci, P. syringae pv. tomaat T1, P. syringae pv. glycinea en Xanthomonas campestris pv. vesicatoria worden in deze studie. Groeien P. syringae stammen in King's B (KB) vloeibaar medium aangevuld met rifampicine (10 ug / ml), kanamycine (50 ug / ml) bij 28 ° C gedurende 12 uur. Groeien X. campestris pv vesicatoria in vloeibaar LB-medium gedurende 16 uur.. Alle ziekteverwekkers haven een plasmide die GFPuv kunnen uitdrukken, zoals beschreven in de voorgaande literatuur 19.
  2. Voorbereiding van de pathogeen culturen voor planten inenting:
    1. Oogsten bacteriële cellen door centrifugeren en bevestigen de aanwezigheid van groene fluorescentie met behulp van lange wavelength UV-lamp in het donker. Twee keer was de cellen met steriel water en resuspendeer ze naar de gewenste concentratie met steriel water.
    2. Inoculeer de betreffende ziekteverwekker (s) op abaxiale zijde van doelgen zwijgen bladeren (5e tot 8e) als puntjes (1,5 cm diameter). Verschillende nonhost pathogenen gelijktijdig getest voor hun groei in het doelgen zwijgen planten. Tegelijkertijd beënten gastheer pathogeen omdat dit kan worden gebruikt als een positieve controle voor weergave in planta bacteriegroei. Ook enten controle van vectoren (TRV :: 00) planten.

3. Observatie van in planta groei van bacteriële pathogenen

  1. Expose de geïnoculeerde bladeren om een ​​lange golflengte UV-licht in het donker. Bacteriële kolonies worden als groen fluorescerend stippen in de abaxiale kant van het blad op de achtergrond, rode fluorescentie uitgezonden door bladoppervlak.
  2. Observeren pathogeen groei2 dagen na inoculatie (dpi) tot 5 dpi. Alledaagse observatie gedurende deze periode nodig is.
  3. Na het eerste scherm, korte lijst van de klonen waarvan silencing resulteert in de groei van een of meer nonhost ziekteverwekker (s).
  4. Herhaal VIGS voor de geselecteerde klonen en opnieuw de respons van gen tot zwijgen planten om nonhost ziekteverwekker (s) te testen. Dit tweede niveau van screening wordt gedaan om de valse positieven behaald in het eerste scherm te verwijderen.

4. Bevestiging van Genomineerde Installaties voor Compromised Nonhost Resistance

  1. Geluid van de cDNA-klonen geselecteerd uit het beeld zoals hierboven beschreven. Inoculeer de hele plant met nonhost pathogeen (s) door onderdompeling van de planten met desbetreffende pathogeen kweken met 0,01% (v / v) Silwet L-77 en het onderwerpen van de ondergedompelde planten vacuüm gedurende 3 - 5 minuten. Kwantificeer de bacteriegroei door gebruikelijke groei 6,18,19 assay zoals hierna beschreven.
  2. Bij 0 uur na inoculatie (hpi),3 dpi en 5 dpi, verzamel twee blad monsters van vijf biologische herhalingen voor elke nonhost ziekteverwekker (s) geënt bladeren met behulp van een blad punch (0,5 cm 2). Maal het blad monsters, serieel verdund en plaat het sap op KB agar medium aangevuld met geschikte antibiotica en incubeer bij 28 ° C gedurende 2 dagen. Tel de kolonies met een kolonie teller en bereken de bacteriegroei in de bladeren, zoals beschreven in de voorgaande literatuur 6.
  3. Planten gevoelig voor nonhost ziekteverwekker (s) moet hoger aantal pathogeen groei ten opzichte van vector controle te tonen.

5. Sequencing de Invoegen en Identificatie van Target Gene

  1. Voer kolonie PCR voor de geselecteerde kloon met attB1 en attB2 primers of met de primers aan weerszijden van de kloneringsplaats van de vector TRV2. Voer het PCR-product op de gel en controleren voor amplificatie van de enkele band.
  2. Plantengen insert in de TRV2 vector kan worden gesequenced met behulp attBprimers of primers flankerende de kloneringsplaats.
  3. Voer BLAST met de sequentie en de identificatie van gen gegevens.
  4. Verkrijgen van volledige lengte gensequentie samen met de niet-vertaalde regio's (UTR).
  5. Selecteer 300-400 bp fragmenten uit drie verschillende gebieden van de sequentie en klonen ze in TRV2 vector. Zelfstandig VIGS behulp van alle drie VIGS constructies uit te voeren en bevestig het compromis van nonhost verzet in alle drie de genen tot zwijgen planten.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Belangrijkste doel van deze studie is om een methode aan te tonen voor een eenvoudige en nauwkeurige identificatie van gen tot zwijgen N. benthamiana planten die worden aangetast voor nonhost weerstand. Er zijn vier belangrijke stappen in deze methode. Eerste stap is om individueel zwijgen groot aantal genen met behulp van TRV-VIGS. We hadden ongeveer 5.000 genen 6,18 zwijgen over een periode van ongeveer 1,5 jaar gebruik van het protocol in figuur 1. Sommige genen tot zwijgen plantenstalen verschillende fenotypische veranderingen zoals groeiachterstand, vergeling en fotoblekingsreactie fenotype (Figuur 2).

Tweede stap is de identificatie van gen tot zwijgen planten met gevoeligheid voor nonhost pathogenen (s). We gebruikten GFPuv expressie bacteriën en bijgehouden hun groei in planta (Figuren 3A-3C). Om het proces van identificatie van het gen tonen zwijgen planten gevoelig nonhost pathogen (s), gebruikten we drie nonhost pathogenen, P. syringae pv. tomaat T1, P. syringae pv. glycinea en X. campestris pv. vesicatoria. Zoals verwacht, niet-zwijgen (vector control) N. benthamiana planten geënt met deze pathogenen niet groeien omdat ze niet kon overwinnen van de plant immuniteit. Echter, P. syringae pv. tomato T1 gevormd groen fluorescent kolonies NbSGT1 gen (een gen betrokken bij resistentie nonhost 25) zwijgen planten (Figuur 3D). Deze gegevens tonen het proces van identificatie van genen tot zwijgen planten gecompromitteerd voor nonhost weerstand. Dit protocol kan direct worden toegepast op genetische screening toekomen. Bijvoorbeeld, de representatieve resultaten uit een van onze vorige forward genetics scherm (figuur 4) toont twee onafhankelijke gen zwijgen planten met verschillende mate van P. syringae pv. tomaat T1 groei (figuur 5

Derde stap is de bevestiging van bacteriegroei in het gen zwijgen planten geïdentificeerd van het scherm door het kwantificeren van de groei van bacteriën. Een voorbeeld voor het schatten van in planta bacteriegroei in de NbSGT1 gen zwijgen planten wordt getoond in figuur 3E. Resultaten toonden aan dat in planta groei van P. syringae pv. tomaat T1 is veel hoger in de NbSGT1 zwijgen planten in vergelijking met niet-zwijgen (TRV :: 00) controleplanten (figuur 3E). Verlies van nonhost weerstand door een bepaald gen silencing kan gedeeltelijk of volledig. Afhankelijk hiervan kan de omvang van nonhost pathogeen groei het gen tot zwijgen planten variëren.

Vierde stap wordt sequencing de insert in TRV2 vector. BLAST is die met deze sequentie om het gen en de gegevens te identificeren.

Figuur 1 Figuur 1. Cartoon met de stappen die betrokken zijn bij zwijgen van een groot aantal genen met behulp van TRV-based VIGS. Drie weken oude N. benthamiana planten worden getransplanteerd in afzonderlijke potten en men liet groeien voor een paar dagen. Agrobacterium die TRV1 construct wordt geïnfiltreerd in 3-4 bladeren met onnodige spuit. Later, zijn 96 cDNA-klonen gekweekt op LB-agar plaat afzonderlijk genomen met een tandenstoker en geprikt op de TRV1 geënt plek van respectieve planten. Ongeveer 3 weken na inoculatie doelgen silencing gebeurt in de bovenste niet-geïnoculeerde pas gegroeide bladeren. Deze bladeren (5e tot 8e) worden gebruikt voor het testen van de groei van pathogenen nonhost (s).

Figuur 2
Figuur 2. VIGS-gemedieerde forward genetics screening inN. benthamiana toont verschillende veranderingen in plantfenotype. Drie weken oude N. benthamiana planten onafhankelijk geïnoculeerd met respectieve TRV constructen zoals descried in figuur 1 als deel van forward genetics schermgedeelte. Foto's werden genomen op 21 dagen na inoculatie TRV.

Figuur 3
Figuur 3. Groene fluorescentie van GFPuv uiten bacteriële pathogenen en het gebruik ervan voor de identificatie van genen betrokken bij nonhost weerstand. Pseudomonas syringae pv. Tabaci, een gastheer pathogeen, dragen GFPuv construeren strepen op KB-medium plaat toont groene fluorescentie onder lange golf UV-licht in het donker ( A). Deze bacteriën worden gekweekt op KB medium en opnieuw gesuspendeerd in water (B) en geënt op N. benthamiana 4 cfu / ml). Op 3 dagen na inoculatie (dpi) bacteriële kolonies zoals groen fluorescent plekken zijn bekeken met het blote oog vanaf abaxiale kant van blad epidermale cellen (C, links). Hetzelfde blad afgebeeld onder normaal licht (zichtbaar range) wordt ook getoond (C, rechts). GFPuv uiten P. syringae pv. tabaci (Pstab, 1 x 10 4 cfu / ml) en drie nonhost pathogenen, blz. syringae pv. tomato T1 (PstT1, 1 x 10 4 cfu / ml), blz. . syringae pv glycinea (PSG, 3 x 10 5 cfu / ml) en Xanthomonas campestris pv vesicatoria (XCV 3 x 10 4 cfu / ml) geïnoculeerd op de abaxiale zijde van bladeren van vector control (TRV :: 00.; D, links) en NbSGT1 gen zwijgen planten (D, rechts). Bacteriële kolonies Pstab worden gezien op beide vleugels en van PstT1 worden gezien alleen het NbSGT1 gen zwijgen bladeren. PstT1 groei in NbSGT1 gen zwijgen bladeren becijferd op 24, 24 en 72 uur na inenting (hpi, E) wordt weergegeven in de grafiek. Klik hier om een grotere afbeelding te bekijken .

Figuur 4
Figuur 4. Overzicht van protocol gevolgd voor VIGS-gemedieerde forward genetics screening voor de identificatie van genen betrokken bij nonhost weerstand. Een cDNA-bibliotheek in TRV2 vector geconstrueerd met behulp van RNA uit nonhost ziekteverwekker (s) geënt N. benthamiana bladeren kunnen worden gebruikt voor screening. Individuele klonen van de cDNA-bibliotheek zijn zwijgen in N. benthamiana door TRV-VIGS. Respectieve GFPuv uiten nonhost bacteriële pathogenen (s) is geënt op om het gen tot zwijgen bladeren van de planten. Tussen 2 en4 dpi de geïnoculeerde plaatsen worden waargenomen met behulp van een UV lamp in het donker en de planten die nonhost pathogeen groei geïdentificeerd. Na deze eerste screening, worden de geselecteerde klonen weer zwijgen en de nonhost pathogeen groei is herbevestigd. Dit tweede niveau scherm wordt gedaan om de valse positieven te verwijderen. Later worden bevestigd klonen zwijgen voor een derde keer en respectieve bacteriegroei wordt geschat. Inserts van de respectieve klonen in de TRV2 vector worden gesequenced en gen informatie wordt geïdentificeerd. Tegelijkertijd HR test kan ook worden uitgevoerd op het gen tot zwijgen planten genen bijdragen aan HR identificeren geïnduceerd tegen type-II nonhost pathogenen.

Figuur 5
Figuur 5. Nonhost bacteriële pathogenen groei in gen zwijgen planten die werden geïdentificeerd als onderdeel van een forward genetics scherm. Beelden van een doorschakelingd genetica screening dat geïdentificeerde genen betrokken bij nonhost weerstand van N. benthamiana planten tegen PstT1, PSG en xcv. Foto genomen voor twee representatieve gen zwijgen planten op 3 dpi na inoculatie worden hier getoond. Bacteriële concentraties gebruikt voor inoculatie worden beschreven in Figuur 3. 43D4 of 94C1 geeft de 96-well plaat gevolgd door het goed nummer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Plant immuniteit beperkt de groei van nonhost ziekteverwekkers en dus weinig of geen groene fluorescentie wordt uitgezonden van vector-controle bladeren van de planten geënt met nonhost ziekte onder lange golflengte UV-licht (Figuur 3D). Wanneer een gen voor nonhost weerstand zwijgen, het gen tot zwijgen planten bevorderen de groei van nonhost pathogeen en groene fluorescentie wordt waargenomen (figuur 3E). Dit is het uitgangspunt bij de in dit manuscript beschreven werkwijze. Deze methode heeft twee belangrijke voordelen ten opzichte van de HR-gebaseerde test. Een identificatie van zwijgen planten gevoelig zijn nonhost ziekteverwekkers GFPuv gebaseerde bepaling verhoogt de nauwkeurigheid in planta groei kan worden bekeken. Ten tweede, laat deze methode identificeren van genen betrokken bij zowel type I nonhost weerstand 2,26 (niet leidt toegankelijk celdood) en type II nonhost weerstand 2,26 (overgevoeligheidsreactie resulteert in celdood).Zo hebben we eerder geïdentificeerd een kloon genaamd 6C8 en het monddood planten waren gevoelig voor zowel type-1 en type-2 ziekteverwekkers 18.

Ook is het mogelijk dat twee of meer onafhankelijke klonen voor VIGS geleid gen zwijgen planten met gelijke fenotypen zij toevallig zwijgen een bepaald gen. Deze redundantie is nuttig als het bevestigt de silencing fenotype. Het optreden van dergelijke herhalingen afhankelijk van de bibliotheek die wordt gebruikt voor het screenen en het type gen (zoals sommige genen komen in grote en dus verschijnen herhaaldelijk in een bibliotheek). Verder klonen bijna alle genen gecodeerd door N. benthamiana genoom in een cDNA VIGS bibliotheek en zwijgen ze onafhankelijk is mogelijk.

Met het oog op de effectieve uitvoering van de forward genetics screening voor de identificatie van genen betrokken bij nonhost weerstand behulp VIGS gevolgd door GFPuv fluorescentie assay, de volgende tips zijn nuttig.

In ordevoor succesvolle VIGS, (1) Gebruik 3-4 bladstadium installaties voor TRV inoculatie, (2) optimum TRV1 en TRV2 titer is belangrijk. Aangezien TRV2 titer een beperkende factor voor initiatie van VIGS kan Inoculeer minstens 4 volwassen bacteriekolonies van Agrobacterium TRV2 en (3) handhaven optimale omgevingsomstandigheden 12. Omgevingstemperatuur speelt een belangrijke rol in het veroorzaken van een optimale VIGS.

Kritische stappen voor een efficiënte detectie van groene fluorescentie van pathogenen zijn onder andere: (1) Gebruik altijd vers pathogeen culturen geoogst bij exponentiële groeifase en bewaar dit dan niet voor enting, en (2) HR celdood moeten worden vermeden als ze kunnen auto fluoresceren onder UV licht en een negatieve invloed hebben op de waarnemingen. Dit is vooral belangrijk bij type II nonhost pathogeen (bijvoorbeeld P. syringae pv. Tomato T1) wordt gebruikt voor de studie. Gebruik lagere concentratie van de nonhost ziekteverwekker als microscopische HR wordt vermoed of evidenced.

Problemen oplossen:

(1) Inconsistentie in gene silencing en het optreden van de variabele silencing fenotype onder repliceert:

Wijzig handschoenen voor elke kloon tijdens de TRV inenting. Zorg er ook voor dat de TRV2 Agrobacterium kolonie niet meerdere klonen bevatten kolonie PCR. Als kolonie PCR blijkt meer dan een band, is het mogelijk dat meer dan een kloon aanwezig in de kolonie. Om het klonen te scheiden, deze strook op de LB agar plaat en het scherm de klonen door kolonie PCR. Na identificatie van individuele klonen voeren VIGS onafhankelijk voor elk van hen en identificeren van de genen tot zwijgen installatie afbreuk nonhost weerstand.

(2) Ernstige groeistoornissen in het zwijgen planten:

Als het zwijgen doelgen (en) betrokken bij basale metabolisme van planten wordt groeistoornis verwacht. Sommige van het gen tot zwijgen plannents kunnen hoger vermenigvuldiging van TRV zien vergeleken met controleplanten vector en kan additief effect veroorzaken van de ernst van het fenotype. Lokale laesie assay 12 op Chenopodium amaranticolor planten kan worden uitgevoerd om na te gaan of het zwijgen opgelegd planten hebben een hogere TRV titer in vergelijking met vector controle planten. Onder deze omstandigheden kunnen planten ongeveer 4 weken oud zijn gebruikt voor VIGS om de ernst van het fenotype verminderen.

(2) Off-target gene silencing:

Niet-specifieke gene silencing, vaak aangeduid als off-target silencing kan optreden tijdens VIGS. Dit gebeurt wanneer een partiële sequentie homologie kunnen siRNA gegenereerd voor beoogde doelwit gen mRNA degraderen naar genen die niet de beoogde doelen silencing 27. Gebruik UTR sequenties als insert in de TRV2 vector. Bestudeer de endogene gen downregulatie van alle verwachte genen off-target en zorg ervoor dat het construct stiltes een enkel gen van belang. To identificatie van gen-fragmenten met minimale of geen off-target te vergemakkelijken, kan bioinformatica instrumenten worden gebruikt (bijvoorbeeld http://plantgrn.noble.org/pssRNAit/ ).

(3) Geen groene fluorescentie van bacteriële kolonies in planta:

Dit komt waarschijnlijk door het gebruik van begroeid culturen. Een andere oorzaak zou minder bacterieel inoculum zijn. Hoewel bacteriële concentraties indirect kan worden gemeten door het meten van optische dichtheid OD 600, kan dode bacteriële cellen maken hogere OD. Het is raadzaam om een ​​optimale bacteriële concentratie op basis van kolonievormende eenheden (cfu) door het tellen van levende cellen aan de KB agar mediumplaat berekenen. OD-waarden kunnen worden aangepast aan het cfu. Ook streak de pathogeen zo vaak mogelijk uit de glycerol voorraad, groeit het op het KB agar plaat en enten enkele verse kolonie voor het bereiden van culturen te enten.

Een veel voorkomende oorzaak van problemen met de sequentie insert in TRV2 vector (door kolonie PCR) is de aanwezigheid van meerdere kolonies. Om dit te overwinnen, moeten afzonderlijke klonen TRV2 construct worden geïsoleerd zoals hierboven (# 1) genoemd.

Beperkingen van de GFPuv methode en manieren om te overwinnen:

Ziekteverwekkers kunnen de GFPuv uitvoeren plasmide tijdens vermenigvuldiging en dus verliezen, schaden de waarnemingen. Ook sommige van het gen tot zwijgen planten toont vergeling en fotoblekingsreactie bladeren en deze bladeren emitteren verschillende fluorescentie (dan rood). Dit maakt de groene fluorescentie moeilijk te zien. Een van de manieren om het effect van auto-fluorescentie te verminderen van de gele of witte blaadjes is om foto's van de groene fluorescerende bacteriën met een camera uitgerust met filters die kunnen verwijderen of te verminderen de achtergrond effe vangenct. Afbeeldingen kunnen worden gebruikt om te concluderen of de bacteriën te groeien of niet. Bepaalde software (bijvoorbeeld Adobe Photoshop) kan worden gebruikt om de achtergrond effect verminderen tijdens analyse van dergelijke beelden.

Bioveiligheid voorzorgsmaatregelen zoals correcte verwijdering van transgene bacteriële ziekteverwekkers moeten worden gevolgd tijdens het experimenteren. Ook moet de juiste huid-en oogbescherming schilden worden gebruikt bij het hanteren van de UV-lamp.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Wij hebben niets te onthullen.

Acknowledgments

Dit project werd gefinancierd door The Samuel Roberts Noble Foundation. Auteurs bedanken Mss. Janie Gallaway en Colleen Elles voor een uitstekende verzorging van planten, en mevrouw Katie Brown voor kunstwerk. We zouden ook graag Mss bedanken. Trina Cottrell, Pooja Uppalapati, Moumita Saha, Swetha Vinukonda en de heer Isaac Greenhut voor technische hulp tijdens de totstandkoming van dit protocol.

Materials

Name Company Catalog Number Comments
96-well U-bottom plates Becton Dickinson Labware (Franklin Lakes, NJ, USA) 35-3077
96-pin replicator stainless steel Nalge Nunc International (Naperville, IL, USA) 250520
High Intensity UV Inspection Lamps, Model B-100ap Thomas scientific (Swedesboro, NJ, USA) 6283K50 Manufacturer ID 95-0127-01
Stuart SC6 colony counter Bibby Scientific Limited, Staffordshire, UK SC6PLUS
Soil-less potting mixture, Metro-Mix 350 SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)
Primers:
attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT)
attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)
Integrated DNA Technologies, Inc (Coralville, IA, USA) Custom synthesized
MES, Monohydrate VWR international (Radnor, PA, USA) CAS No. 145224-94-8
Acetosyringone (Dimethoxy-4’-hydroxyacetophenone) Sigma Aldrich (St. Louis, MO, USA) D134406
Vac-In-Stuff (Silwet L-77) Lehle Seeds (Round Rock, TX, USA) VIS-30

DOWNLOAD MATERIALS LIST

References

  1. Heath, M. C. Nonhost resistance and nonspecific plant defenses. Currrent Opinion in Plant Biology. 3, 315-319 (2000).
  2. Mysore, K. S., Ryu, C. -M. Nonhost resistance: how much do we know. Trends in Plant Science. 9, 97-104 (2004).
  3. Ellis, J. Insights into nonhost disease resistance: can they assist disease control in agriculture. The Plant Cell. 18, 523-528 (2006).
  4. Senthil-Kumar, M., Mysore, K. S. Nonhost resistance against bacterial pathogens: retrospects and prospects. Annual Review of Phytopathology. 51, (2013).
  5. Lu, M., Tang, X., Zhou, J. -M. Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria. The Plant Cell. 13, 437-447 (2001).
  6. Rojas, C. M., et al. Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways. The Plant Cell. 24, 336-352 (2012).
  7. Daurelio, L. D., et al. Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco. Journal of Plant Physiology. 168, 382-391 (2011).
  8. Moreau, M., et al. EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora. Molecular Plant-Microbe Interactions. 25, 421-430 (2012).
  9. Senthil-Kumar, M., Mysore, K. S. Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response. Plant, Cell & Environment. 35, 1329-1343 (2012).
  10. Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. Applications and advantages of virus-induced gene silencing for gene function studies in plants. The Plant Journal. 39, 734-746 (2004).
  11. Senthil-Kumar, M., Mysore, K. S. New dimensions for VIGS in plant functional genomics. Trends in Plant Science. 16, 656-665 (2011).
  12. Senthil-Kumar, M., Mysore, K. S. Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato. Plant Biotechnology Journal. 9, 797-806 (2011).
  13. Bombarely, A., et al. A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research. Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).
  14. Sharma, P. C., et al. Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana. Mol Gen Genomics. 269, 583-591 (2003).
  15. Baulcombe, D. C. Fast forward genetics based on virus-induced gene silencing. Current Opinion in Plant Biology. 2, 109-113 (1999).
  16. Lu, R., et al. High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO Journal. 22, 5690-5699 (2003).
  17. Pozo, O., Pedley, K. F., Martin, G. B. MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease. EMBO Journal. 23, 3072-3082 (2004).
  18. Wang, K., Senthil-Kumar, M., Ryu, C. -M., Kang, L., Mysore, K. S. Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast. Plant Physiology. 158, 1789-1802 (2012).
  19. Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv. New Phytologist. 174, 212-223 (2007).
  20. Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing. The Plant Journal. 25, 237-245 (2001).
  21. MacFarlane, S. A. Molecular biology of the tobraviruses. Journal of General Virology. 80, 2799-2807 (1999).
  22. Anand, A., et al. Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing. Molecular Plant-Microbe Interactions. 20, 41-52 (2007).
  23. Liu, E., Page, J. Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus. Plant Methods. 4, 5 (2008).
  24. Velásquez, A. C., Chakravarthy, S., Martin, G. B. Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato. J. Vis. Exp. (28), e1292 (2009).
  25. Peart, J. R., et al. Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants. Proceedings of the National Academy of Sciences. 99. 99-10869 (2002).
  26. Oh, S. -K., et al. Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco. Planta. 223, 1101-1107 (2006).
  27. Senthil-Kumar, M., Mysore, K. RNAi and Plant Gene Function Analysis. Methods in Molecular Biology. Kodama, H., Komamine, A. 744, Humana Press. 13-25 (2011).
VIGS-Mediated Forward Genetics Screening voor de identificatie van genen betrokken bij Nonhost Resistance
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).More

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter