Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

유전자의 식별을위한 VIGS - 중재 앞으로 유전학 검사는 Nonhost 저항에 참여

doi: 10.3791/51033 Published: August 23, 2013

Summary

바이러스에 의한 유전자 침묵은 식물의 nonhost 저항성에 관련된 유전자를 식별하기위한 유용한 도구입니다. 우리는 nonhost 병원균에 감염 유전자 침묵 식물을 식별 GFPuv을 표현 세균성 병원체의 사용을 보여줍니다. 이 방법은 빠르고, 간단하고 대규모 검사와 유사한 프로토콜이 다양한 식물 미생물 상호 작용을 연구에 적용 할 수있는 용이하게합니다.

Abstract

세균성 병원균에 대한 식물의 Nonhost 질병 저항은 복잡한 방어 경로에 의해 제어됩니다. 이 메커니즘을 이해하는 것은 병원균의 넓은 범위에 대한 내구성이 질병 저항성 식물 개발을위한 중요합니다. 바이러스에 의한 유전자 침묵 (VIGS) 기반의 앞으로 유전학 검사는 nonhost 저항을 부여 식물의 방어 유전자의 식별을위한 유용한 방법입니다. 담배 딸랑이 바이러스 (TRV) 기반 VIGS 벡터 날짜에 가장 효율적인 VIGS 벡터이며가 효율적으로 사용되었습니다 은 Nicotiana benthamiana에서 내생 대상 유전자를 침묵합니다.

이 논문에서, 우리는 N.에서의 cDNA 라이브러리에서 개별 클론의 침묵에 대해 앞으로 유전학 검사 방식을 보여 benthamiana와 nonhost 병원균에 대한 노출 nonhost 저항을 유전자 침묵 식물의 반응을 평가, 모나스 syringae pv를. 토마토 T1, P. syringae pv를. GLYCinea, 그리고 X. campestris pv를. vesicatoria. 이러한 세균성 병원균 표현 GFPuv 단백질을 설계하고 침묵 표적 유전자가 nonhost 저항을 부여에 관여하는 경우 그들의 녹색 형광 식민지가 nonhost 병원균 접종 공장에서 UV 빛의 밑에 육안으로 볼 수 있습니다. 이 nonhost 병원균에 감염 유전자 침묵 식물의 믿을 수있는 빠른 식별을 용이하게합니다. 또한, 유망 후보 유전자 정보는 TRV 벡터 식물 유전자 삽입 순서에 의해 알 수있다. 여기에 우리가 nonhost 저항성에 관련된 유전자를 식별하는 VIGS 매개 앞으로 유전학의 높은 처리 능력을 보여줍니다. 약 100 cDNA를 개별적 이후 주에서 공부 할 수있는 약 2~3주 여러 nonhost 세균성 병원균에 대한 nonhost 저항의 관련성에 침묵 할 수 있습니다. 이 논문에서, 우리는이 검사에 관련된 자세한 단계를 열거합니다. VIGS 매개 앞으로 유전학 screeniNG 접근 방식은 nonhost 저항에 관여 식별 유전자뿐만 아니라 다양한 식물 종의 다양한 생물과 비 생물 적 스트레스 공차를 부여 유전자를 공부하는뿐만 아니라 확장 할 수 있습니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nonhost 저항은 특정 병원체 1,2 인종에 대한 모든 식물 종의 저항이다. 이 넓은 스펙트럼과 식물 2,3 튼튼한 질병 저항을 부여. 그러나 특히 세균성 병원균에 대한 기전은 잘 4 이해되지 않습니다. 타협 nonhost 저항 및 nonhost 저항 5-9시 차등 발현 유전자의 식별을위한 높은 처리량 성적 프로파일은 이전 세균 nonhost 저항을 해부에 사용되는 두 가지 주요 방법임을 돌연변이 또는 침묵 식물 검사. nonhost 저항은 많은 유전자, 유전자 식별을위한 높은 처리량 기능 게놈 접근법의 참여와 복잡한 메커니즘 (들) 4에 의해 제어되기 때문에 nonhost 저항 메커니즘 (들)을보다 잘 이해 중요합니다.

바이러스에 의한 유전자 침묵 (VIGS)가 성공적으로 내생 식물 침묵하는 데 사용되었습니다많은 식물 종 10,11의 유전자.은 Nicotiana benthamiana는 VIGS 10,12하고 초안 게놈 시퀀스에 대한 가장 적합한 식물 중 하나입니다 지금 13 사용할 수 있습니다. 담배 딸랑이 바이러스 (TRV) 기반 VIGS 널리 역 유전학 도구로 사용되었다 nonhost 저항 2,4,14에 관련된 유전자의 특성을. 이 VIGS 벡터 및 파생 상품은 애기 장대 생물 자원 센터 (ABRC를 통해 지금 사용할 수 있습니다 http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html ). VIGS는 식물의 면역 15-17, 특히 nonhost 저항 6,18에 관련된 유전자를 식별 앞으로 유전학 도구로 사용되었습니다. 과민 반응 (HR) 매개 특정 nonhost 병원균에 대한 식물에 의해 유도 된 세포 죽음을 평가하고 질병에 의한 세포 죽음을 평가하는 것은 주로 identifyin에 사용되는 두 가지 주요 분석입니다G 감수성 유전자는 식물을 침묵. 그러나 HR 세포의 죽음이 유일한 유형-II nonhost 병원균에 대한 유도가 아닌 타입-I nonhost 병원균 2에 대하여. 따라서, HR의 분석은 보편적 특히 타입 I nonhost 병원체의 넓은 범위에 식물에 의해 사용 nonhost 저항 전략을 파악하는 데 사용할 수 없습니다. 또한, 유전자 침묵 공장에서 nonhost 저항의 부분적인 손실이 항상 질병의 증상 6 따라서 질병 점수가 nonhost 저항을 저하 식물을 식별하는 데 사용할 수 없습니다 이어질하지 않습니다. 반면에, 유전자 침묵 식물 nonhost 병원균의 성장을 평가하는 유전자 침묵 식물 nonhost 저항의 손실을 공부하기위한 좋은 방법입니다.

기존의 성장 분석 6,19, 유전자 침묵 식물에 nonhost 박테리아의 성장을 평가하기위한 빠른 방법에 비해 앞으로 유전학 검사에 필요한 시간을 단축 할 수 있습니다. 우리는 이전에 박테리아를 관찰하는 방법을보고자외선 아래에서 육안으로 잎에 L 병원균의 성장 (UV)는 밝은 녹색 형광 단백질 (GFP) 19를 표현하는 박테리아를 사용하여. 이 논문에서 우리는 nonhost 저항을 손상하는 유전자 침묵 식물의 쉽게 식별 nonhost 세균성 병원체를 표현 GFPuv의 유용성을 보여줍니다. 이 방법은 감염 식물의 식별을위한 정확하고 높은 처리량 검사에 대한 의무이다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. 식물 성장 및 타겟 유전자 침묵

  1. 식물의 성장 조건 :
    1. N.를 뿌리다 토양 덜 포팅 혼합물 메트로 믹스 350 성장 챔버에서 씨앗을 발아에 benthamiana 씨. 다른 토양 토양 적은 매체는 메트로 - 믹스 대신 사용할 수 있습니다.
    2. 이식 3 주 오래된 개별 화분에 모종 21 유지 온실에서 그들을 성장 ± 2 ° C 이전의 문헌 12에 설명 된 다른 성장 조건과 함께. 두 사흘 이식 후, 식물 TRV 접종에 사용할 수 있습니다.
  2. TRV2 클론을 성장 :
    TRV는 양자 바이러스 및 게놈 RNA1 및 RNA2으로 구성되어 있습니다. RNA1는 RNA 의존 RNA 중합 효소와 운동 단백질 20,21 인코딩합니다. RNA2는 외피 단백질 (CP) 및 subgenomic RNA를 21 개의 비 구조 단백질을 인코딩합니다. RNA1 및 RNA2 모두 성숙 비르의 형성에 필요한우리 입자들의 확산 20,21. TRV2 벡터의 cDNA를 라이브러리 건설 이전의 문학 22,23에 설명되어 있습니다. 간단히, 본 연구에서 사용 VIGS 라이브러리는 다양한 생물과 비 생물 적 elicitors에 노출 된 잎 조직에서 추출한 RNA에서 건설되었다.
    1. 냉장고에서 TRV2 벡터의 cDNA를 클론 (96 - 웰 플레이트)가 포함 된 아그로 박테 리움을 (GV2260 변형) 꺼냅니다. 점차적를 해동하고 문화가 실내 온도에 도달 한 후, 96 핀 Replicator를 사용하여 리팜피신 (10 ㎍ / ㎖) 및 카나마이신 (50 ㎍ / ㎖)과 루리아 - 베르 타니 (LB) 한천 배지에 각각의 아그로 박테 리움 문화를 접종.
    2. 이틀 동안 28 ° C에서 번호판을 품어. 그 적절한 아그로 박테 리움의 접종이 두 식물의 찌르기 접종 사용할 수 있도록 우리는 일반적으로 각 복제에 대한 네 가지 복제 식민지를 성장. 무균 조건 하에서 모든 단계를 수행합니다.
  3. VIGS :
    1. 성장28에 TRV1을 들고 아그로 박테 리움 (GV2260) ° 위에서 언급 한 항생제와 LB 액체 배지에서 C. 하룻밤 성장 문화에서 원심 분리하여 수확 세포는 (10 MM MES, 산도 5.5, 200 μM의 acetosyringone) 접종 버퍼에 다시 일시 중지, 50 rpm으로 진탕, 실온에서 3 시간 동안 배양한다.
    2. 원심 분리하여 세포를 수확하고 5 밀리미터 MES 버퍼 (산도 5.5) 및 접종 (OD 600 = 0.3)에 다시 일시 중지합니다 3-4 N.의 배축면에 benthamiana는 needleless 주사기를 사용 둡니다. 자세한 접종 절차는 이전의 문헌 24에 나와 있습니다. 나중에 TRV1 접종의 사이트에서, 이쑤시개와 잎을 찔러서 각각의 TRV2 식민지를 접종.
    3. 활발한 성장을 효율적으로 VIGS 12 중요하기 ​​때문에 충분한 영양과 식물을 유지합니다. 2 주간 포스트 접종에 대한 표적 유전자의 전사가 감소하기 시작하고 식물 병원균 INOC을위한 준비TRV 접종 후 3 주에 ulation.

2. Nonhost 병원체 문화 및 식물 접종의 준비

  1. 본 연구에 사용 된 병원균의 세부 사항 :
    모나스 syringae pv를. tabaci, P. syringae pv를. 토마토 T1, P. syringae pv를. glycinea과 크 산토 모나스 (Xanthomonas) campestris pv를. vesicatoria 본 연구에 사용됩니다. P. 성장 왕의 B (KB) 12 시간 동안 28 ° C에서 리팜피신 (10 ㎍ / ㎖), 카나마이신 (50 ㎍ / ㎖)를 첨가 액체 배지에 syringae 변종. X. 성장 16 시간 동안 LB 액체 배지에서 campestris pv를. vesicatoria. 모든 병원균 이전 문헌 19에서 설명한대로 GFPuv을 표현할 수있는 플라스미드를 항구.
  2. 식물의 접종에 대한 병원체 배양의 준비 :
    1. 원심 분리하여 세균 세포를 수확 긴 주를 사용하여 녹색 형광의 존재를 확인어둠 속에서 velength UV 램프. 멸균 수로 두 번 세포를 씻으하고는 멸균 물을 사용하여 원하는 농도에 다시 일시 중지합니다.
    2. 반점 (약 1.5 cm 직경)와 같은 표적 유전자 침묵 잎 (5 ~ 8 일)의 배축면에 각각의 병원체 (들)을 접종한다. 여러 nonhost 병원체를 동시에 표적 유전자 침묵 식물에서의 성장을위한 테스트 할 수 있습니다. 이것은 란타 박테리아의 성장에서 볼 수있는 양성 대조군으로 사용 할 수있는 동시에 호스트 병원체를 접종. 또한 접종 벡터 제어 (TRV :: 00) 식물.

3. 세균성 병원균의 란타 성장의 관찰

  1. 어둠 속에서 긴 파장 자외선에 접종 잎을 노출합니다. 세균성 식민지 잎 표면에서 방출되는 적색 형광 배경에 잎의 배축 측면에서 녹색 형광 점으로 볼 수 있습니다.
  2. 병원균의 성장을 관찰이일 포스트 접종 (dpi)로부터 5 DPI. 이 시간 간격 동안 매일 관찰이 필요합니다.
  3. 후 첫 번째 화면, 짧은 명단 침묵 하나 이상의 nonhost 병원체 (들)의 성장 결과 클론.
  4. 선택한 클론 VIGS를 반복하고 다시 nonhost 병원체 (들) 유전자 침묵 식물의 반응을 테스트합니다. 심사의 두 번째 레벨은 첫 번째 화면 중에 얻은 잘못된 반응을 제거하기 위해 수행됩니다.

4. 변조 된 Nonhost 저항을 위해 선발 된 식물의 확인

  1. 위에서 설명한대로 화면에서 선택의 cDNA 클론을 침묵. 5 분 - 0.01 % (v / v)의 Silwet L-77 3 진공 청소기로 청소하기 위하여 침수 식물을 복종과 각각의 병원체 문화와 식물을 잠수하여 nonhost 병원체 (들)과 전체 공장을 접종한다. 아래에 설명 된대로 기존의 성장 분석 6,18,19하여 박테리아의 성장을 계량.
  2. 0 시간 후 접종 (HPI)에서,3 dpi로 5부터, 잎 펀치 (0.5 cm 2)를 사용하여 다섯 개의 생물 각 nonhost 병원체 (들) 복제 접종 잎에서 두 잎 샘플을 수집합니다. 잎 샘플 2 일 동안 28 ° C에서 적절한 항생제와 부화로 보충 KB 한천 배지에 시리얼 희석 판 수액을 갈기. 식민지 카운터를 사용하여 세균성 식민지를 계산하고 이전의 문헌 6에 설명 된 잎 박테리아의 성장을 계산합니다.
  3. nonhost 병원체 (들)에 민감한 식물 벡터 제어에 비해 병원균의 성장의 높은 숫자를 표시해야합니다.

5. 대상 유전자의 삽입 및 확인을 시퀀싱

  1. attB1 및 attB2 프라이머를 사용하거나 TRV2 벡터에 클로닝 사이트를 측면에서는 프라이머를 사용하여 선택한 복제에 대한 식민지 PCR을 수행합니다. 겔에 PCR 제품을 실행하고 단일 대역의 증폭을 확인합니다.
  2. TRV2 벡터의 식물 유전자 삽입은 attB를 사용하여 염기 서열 할 수 있습니다프라이머하거나 복제 사이트를 측면에서는 프라이머.
  3. 시퀀스를 사용하여 BLAST를 수행하고 유전자의 세부 사항을 확인합니다.
  4. 유엔 번역 된 지역 (UTRs)와 함께 전체 길이 유전자 서열을 구하십시오.
  5. 시퀀스의 세 가지 영역 300-400 bp의 단편을 선택하고 TRV2 벡터로 그들을 복제. 독립적 세 VIGS 구문을 사용하여 VIGS을 수행하고 세 가지 유전자 침묵 식물 nonhost 저항의 타협을 확인합니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

본 연구의 주요 목적은 N. 침묵을 지켰 유전자의 쉽고 정확하게 식별하는 방법을 보여주는 것입니다 nonhost 저항을 손상하는 benthamiana 공장. 이 방법의 네 가지 주요 단계가 있습니다. 첫 번째 단계는 개별적으로 TRV-VIGS를 사용하여 유전자의 다수를 침묵하는 것입니다. 우리는 그림 1에 묘사 된 프로토콜을 사용하여 약 1.5 년의 기간 동안 약 5,000 유전자에게 6,18 침묵을 지켰습니다. 유전자 침묵 식물의 일부는 표현형 (그림 2) 황변 및 사진 표백, 성장 저하 등 다양한 표현형의 변화를 보여 주었다.

두 번째 단계는 nonhost 병원체 (들)에 감수성을 보여주는 유전자 침묵 식물의 식별이다. 우리는 GFPuv 표현하는 박테리아를 사용 란타 (그림 3A-3C) 자신의 성장을 추적. 유전자의 식별의 과정을 설명하기 위해 nonhost P에 민감한 식물은 침묵을 지켰athogen (들), 우리는 3 nonhost 병원균, P.를 사용 syringae pv를. 토마토 T1, P. syringae pv를. glycineaX. campestris pv를. vesicatoria. 예상대로, (벡터 제어) N.에게 비 침묵 그들은 식물의 내성을 극복 할 수있는 이러한 병원균 접종 benthamiana의 식물은 성장하지 않았다. 그러나 P. syringae pv를. 토마토 T1은 NbSGT1 유전자 (nonhost 저항 25에 연루 유전자) 침묵 식물 (그림 3D)에 녹색 형광 식민지를 형성했다. 이러한 데이터는 nonhost 저항을 손상 유전자 침묵 식물을 식별하는 과정을 보여줍니다. 이 프로토콜은 직접 유전학 검사를 전달하기 위해 적용 할 수 있습니다. 예를 들어, 우리가 이전에 앞으로 유전학 화면 (그림 4) 중 하나에서 찍은 대표적인 결과는 P.의 다양한 학위를 두 개의 독립적 인 유전자 침묵 식물을 보여줍니다 syringae pv를. 토마토 T1의 성장 (그림 5

세 번째 단계는 박테리아의 성장을 정량화하여 화면에서 식별 된 유전자 침묵 식물에서 박테리아의 성장의 확인이다. NbSGT1 유전자 침묵 식물 란타 세균 성장의 추정에 대한 예는 그림 3E에 표시됩니다. 결과를 보여 주었다 P.의 란타의 성장 syringae pv를. 토마토 T1은 (TRV :: 00) 비 침묵 제어 설비 (그림 3E)에 비해 NbSGT1 침묵 공장에서 훨씬 높았다. 특정 유전자 침묵에 의한 nonhost 저항의 손실 부분 또는 전체가 될 수 있습니다. 이에 따라, 유전자 침묵 식물에 nonhost 병원균의 성장의 정도는 다를 수 있습니다.

네 번째 단계는 TRV2 벡터의 삽입 순서입니다. BLAST는 유전자의 세부 사항을 식별하기 위해이 시퀀스를 사용하여 수행됩니다.

그림 1 그림 1. TRV 기반 VIGS를 사용하여 유전자의 큰 숫자를 침묵에 관련된 단계를 보여주는 만화. 3 주 오래 N. benthamiana 공장은 개별 냄비에 이식하고 몇 일 동안 성장할 수있었습니다. TRV1 구조를 운반하는 아그로 박테 리움은 불필요한 주사기를 사용하여 3-4 잎에 침투하고 있습니다. 나중에, LB 한천 플레이트에 성장 96의 cDNA 클론은 개별적으로 이쑤시개를 사용하여 촬영하고 각각의 식물의 TRV1 접종 자리에 찔 있습니다. 약 3 주 접종 후 대상 유전자 침묵은 최고 비 접종 새로 자란 잎에 발생합니다. 이 잎은 (5 ~ 8 일) nonhost 병원체 (들)의 성장을 테스트하는 데 사용됩니다.

그림 2
그림 2. VIGS 매개 앞으로 유전학 검사에서N. benthamiana는 식물의 표현형의 다양한 변화를 보여줍니다. 3 주 이전 N. 독립적으로 각각의 TRV 접종 benthamiana의 식물로 표시됩니다 앞으로 유전학 화면의 일부로서 그림 1에 descried 구축합니다. 사진은 TRV 접종 후 이십일일에서 촬영했다.

그림 3
그림 3. GFPuv에서 녹색 형광 박테리아 병원균과 nonhost 저항성에 관련된 유전자의 식별을 위해 사용을 표현. GFPuv 구문을 수행 모나스 syringae pv를. tabaci, 호스트 병원체, KB - 중간 접시에 줄무늬는 어둠 속에서 긴 웨이브 자외선 아래에서 녹색 형광을 보여줍니다 ( A). 이 박테리아는 KB 배지에서 성장 물 (B)에 다시 현탁 N.에 접종 benthamiana 4 CFU / ㎖). 삼일에 게시 접종 (dpi)로 세균성 식민지 잎 표피 세포의 배축면 (C, 왼쪽)에서 육안으로 녹색 형광 점으로 볼 수 있습니다. 일반 빛 (가시 범위)에서 그림 같은 잎도 (C, 오른쪽) 표시됩니다. GFPuv는 P.을 표현 syringae pv를. tabaci (Pstab, 1 × 10 4 CFU / ㎖)과 세 nonhost 병원균, P. syringae pv를. 토마토 T1 (PstT1, 1 × 10 4 CFU / ㎖), P. . syringae pv를 glycinea (PSG, 3 × 10 5 CFU / ㎖)과 크 산토 모나스 (Xanthomonas) campestris pv를 vesicatoria (XCV, 3 × 10 4 CFU / ㎖)는 벡터 제어에서 잎의 배축면 (TRV :: 00에 접종. D, 왼쪽)와 NbSGT1 유전자 침묵 식물 (D, 오른쪽). Pstab의 세균성 식민지는 잎과 PstT1들에만 N에 볼 수 있습니다 모두 볼 수 있습니다bSGT1 유전자는 잎 침묵. NbSGT1 유전자 PstT1 성장은 24, 24, 72이 시간 후 접종 (HPI, E)이 그래프에 표시됩니다.에서 정량 잎 침묵하는 큰 그림을 보려면 여기를 클릭하십시오 .

그림 4
그림 4. 프로토콜의 개요 nonhost 저항성에 관련된 유전자의 식별을위한 VIGS 매개 앞으로 유전학 검사를 위해 따랐다. TRV2 벡터의 cDNA 라이브러리 N. 접종 nonhost 병원체 (들)에서 RNA를 사용하여 구성 benthamiana 잎은 검사에 사용할 수 있습니다. cDNA를 라이브러리에서 개별 클론 N.에 침묵하는 TRV-VIGS으로 benthamiana. nonhost 세균성 병원체 (들)을 표현하는 각각의 GFPuv은 유전자 침묵 식물의 잎에 접종합니다. 2 사이4 dpi로 접종 장소는 어두운 곳에서 자외선 램프를 사용하여 관찰하고 nonhost 병원균의 성장을 보여주는 식물 식별됩니다. 이 심사 후, 선택한 클론이 다시 침묵과 nonhost 병원균의 성장을 재확인합니다 있습니다. 이 두 번째 수준의 화면이 잘못된 반응을 제거하기 위해 수행됩니다. 나중에 확인 클론 세번째 침묵하고 각각의 박테리아의 성장이 예상된다. TRV2 벡터에서 각각의 클론의 삽입은 순서가되어 유전자 정보가 식별됩니다. 동시에 HR 분석은 타입 II의 nonhost 병원균에 대한 유도 인사에 기여 유전자를 식별하는 유전자 침묵 공장에서 수행 할 수 있습니다.

그림 5
그림 5. 앞으로 유전학 화면의 한 부분으로 확인 된 유전자 침묵 식물 Nonhost 세균성 병원체의 성장. forwar의 사진D 유전학 검사하는 N.의 nonhost 저항에 참여 확인 된 유전자 PstT1, PSG와 XCV에 대한 benthamiana 공장. 접종 후 3 dpi의 두 가지 대표적인 유전자 침묵 식물 촬영 한 사진은 여기에 표시됩니다. 예방 접종에 사용되는 세균의 농도는 그림 3에 설명되어 있습니다. 43D4 또는 94C1은 잘 수에 따라 96 - 웰 플레이트의 수를 나타냅니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

식물 면역 거의 또는 전혀 녹색 형광 벡터 제어 공장에서 방출되지 않는, 따라서 nonhost 병원균의 성장을 제한하고 장파장 자외선 (그림 3D)에 따라 nonhost 병원균 접종 둡니다. 그러나 nonhost 저항에 관련된 유전자가 침묵 할 때, 유전자 침묵 식물 nonhost 병원균과 녹색 형광의 성장 (그림 3E) 볼을 선호. 이것은이 논문에 설명 된 방법에 관련된 기본 원칙이다. 이 방법은 HR-기반의 분석을 통해 두 가지 주요 장점이 있습니다. GFPuv 기반의 분석에 의해 nonhost 병원균에 감염 침묵 식물 중 하나, 식별 볼 수 있습니다 란타의 성장과 정확성을 향상시킵니다. 둘째,이 방법은 수 두 유형 I nonhost 저항 2,26 (가시 세포의 죽음이 발생하지 않음)과 타입 II nonhost 저항 2,26 (과민 반응 세포의 죽음의 결과)에 관련된 유전자의 식별.예를 들어, 우리는 이전에 6C8와 침묵 식물이 두 유형 1과 유형 2 병원체 18에 민감했다라고하는 클론을 확인했다.

또한, VIGS에 사용되는 두 개 이상의 독립적 인 클론들이 특정 유전자를 침묵하는 일이와 유사한 표현형과 유전자 침묵 공장에서 발생 가능성이 있습니다. 그것은 침묵 표현형을 확인으로이 중복 유용합니다. 이러한 반복의 발생은 검사와 유전자의 유형 (일부 유전자가 높은 표현되고 따라서 라이브러리에 반복적으로 발생하는 것처럼)에 사용되는 라이브러리에 따라 다릅니다. 또한, 복제 거의 모든 유전자 N.로 인코딩 benthamiana의 cDNA를 VIGS 라이브러리로 게놈을 침묵 독립적으로 할 수 있습니다.

효과적으로 GFPuv 형광 분석에 의해 다음 VIGS를 사용 nonhost 저항성에 관련된 유전자의 식별을 위해 앞으로 유전학 검사를 구현하려면 다음 팁을 유용합니다.

순서대로성공 VIGS를 들어, (1) 3를 사용 - TRV 접종 4 잎 무대 식물 (2) 최적의 TRV1 및 TRV2 역가가 중요합니다. TRV2 역가가 VIGS의 시작에 대한 제한 요인이 될 수 있기 때문에, 아그로 박테 리움이 TRV2을 숨겨 적어도 4 완전히 자란 박테리아 콜로니를 접종하고, (3) 12 최적의 환경 조건을 유지한다. 환경 온도는 최적의 VIGS를 유도에 중요한 역할을한다.

병원균에서 녹색 형광을 효율적으로 탐지를위한 중요한 단계는 다음과 같습니다 : (1)은 항상 기하 급수적 인 성장 단계에서 수확 한 신선한 병원체 문화를 사용하고 접종 전에 그들을 저장하지 않습니다, 그리고 그들은 자동으로 할 수있는 것처럼 (2) HR 세포의 죽음은 피해야한다 UV 하에서 형광 빛과 부정적 관찰에 영향을 미친다. 유형 II nonhost 병원체 (예를 들어, P. syringae pv를. 토마토 T1) 연구에 사용될 때 특히 중요합니다. 낮은 현미경 HR이 의심되는 경우 nonhost 병원균의 농도 나 EV를 사용하여idenced.

문제 해결 :

(1) 사이에 변수를 입을 표현형의 유전자 침묵과 발생에 일관성이 복제 :

TRV 접종시 모든 복제 장갑을 변경합니다. 또한, TRV2 아그로 박테 리움의 식민지가 식민지 PCR하여 여러 클론을 포함하지 않습니다 있는지 확인하십시오. 식민지 PCR 하나 이상의 밴드를 보여 경우, 하나 이상의 복제가 식민지의 존재 가능성이 있습니다. 클론을 분리하기 위해, LB 한천 플레이트와 식민지 PCR에 의한 화면 클론의 행진을. 각각의 클론의 식별 한 후, 각각에 대해 독립적으로 VIGS를 수행하고 유전자 침묵 공장 저하 nonhost 저항을 확인합니다.

(2) 침묵 공장에서 심한 성장 결함 :

침묵 표적 유전자 (들)은 식물의 기초 대사에 관여하는 경우, 성장 결함이 예상된다. 그러나 유전자 중 일부는 계획을 침묵TS 벡터 제어 설비에 비해 TRV 높은 곱셈을 표시 할 수 있으며이 표현형의 정도에 첨가제 효과가 발생할 수 있습니다. Chenopodium amaranticolor 식물의 로컬 병변의 분석 (12)는 침묵 식물 벡터 제어 설비에 비해 높은 TRV 역가를 가지고 있는지 여부를 확인하기 위해 수행 할 수 있습니다. 이러한 상황에서, 옛 사주에 대한 식물의 표현형의 심각도를 줄일 수 VIGS를 사용할 수 있습니다.

(2) 오프 대상 유전자 침묵 (gene silencing) :

자주 오프 대상 침묵​​으로 불리는 비 특정 유전자 침묵, VIGS 동안 발생할 수 있습니다. 부분 서열 상동은 siRNA를 27 의도 된 침묵의 대상이되지 않습니다 유전자 발현을 저하하기위한 표적 유전자에 대해 생성 할 수 있습니다 때 발생합니다. TRV2 벡터의 삽입으로 UTR 서열을 사용합니다. 모든 예상 떨어져 표적 유전자의 내생 유전자 하향 조절을 연구하고 구조가 침묵 관심의 단일 유전자를 확인하십시오. 티최소 또는 아니오 오프 대상과 유전자 조각의 식별을 용이 O를, 생물 정보학 도구 (예를 들어, 사용할 수 있습니다 http://plantgrn.noble.org/pssRNAit/ ).

란타에있는 세균 식민지 (3) 없음 녹색 형광 없습니다 :

이 성장 문화에의 사용에 의해 대부분 발생합니다. 또 다른 원인은 낮은 세균 접종 될 수 있습니다. 세균 농도가 간접적으로 광학 밀도 OD 600을 측정하여 측정 할 수 있지만, 죽은 박테리아 세포 높은 OD를 만들 수 있습니다. 그것은 KB 한천 배지 접시에 살아있는 세포를 계산하여 콜로니 형성 단위 (CFU)를 기반으로 최적의 세균 농도를 계산하는 것이 좋습니다. OD 값은 CFU에 따라 조정할 수 있습니다. 또한, 행진 글리세롤 주식에서 가능한 한 자주 병원체는 KB 한천 플레이트에 성장하고 접종 문화를 준비하는 하나의 신선한 식민지를 접종.

TRV2 벡터 (콜로니 PCR에 의한)의 삽입 순서의 어려움에 대해 하나 일반적으로 발생하는 원인은 여러 식민지의 존재입니다. (# 1) 위에서 언급 한 바와 같이이 문제를 해결하기 위해 개별 TRV2 구문을 품고 클론 격리되어야한다.

GFPuv 방법과 극복하는 방법의 제한 :

병원균이 증식하는 동안 따라서 플라스미드를 들고 GFPuv를 잃을 수 있습니다, 부정적인 관측에 영향을 미친다. 또한, 유전자 침묵 식물 중 일부는 잎이 잎을 황변 및 사진 표백 다른 형광 (적색 이상) 방출 보여줍니다. 이 볼 수있는 녹색 형광 어려워집니다. 노란색 또는 흰색 잎에서 자동 형광의 영향을 줄일 수있는 방법 중 하나는 배경 EFFE를 제거하거나 줄일 수있는 필터가 장착 된 카메라를 사용하여 녹색 형광 박테리아의 사진을 캡처하는 것입니다CT. 사진은 박테리아가 성장하거나하지 여부를 추론 할 수 있습니다. 특정 소프트웨어 (예를 들어, 어도비 포토샵은) 그림과 같은 분석하는 동안 배경 효과를 줄일 수 있습니다.

유전자 변형 세균 병원균의 적절한 처리와 같은 바이오 안전성주의 사항 실험시 준수해야합니다. UV 램프를 취급 할 경우에도 적절한 피부와 눈 보호 방패를 사용해야합니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

우리는 공개 아무것도 없어.

Acknowledgments

이 프로젝트는 사무엘 로버츠 노블 재단에 의해 후원되었다. 저자는 회원국 감사합니다. 제니 갤로 웨이와 콜린이 우수한 식물 관리를위한 Elles, 그리고 작품에 대한 양 케이티 브라운. 우리는 또한 회원국에게 감사의 말씀을 전합니다. 트리 나 코트렐, 푸자 Uppalapati, Moumita 사하구, Swetha Vinukonda이 프로토콜을 설정하는 동안 기술 지원을위한 씨 이삭 Greenhut.

Materials

Name Company Catalog Number Comments
96-well U-bottom plates Becton Dickinson Labware (Franklin Lakes, NJ, USA) 35-3077
96-pin replicator stainless steel Nalge Nunc International (Naperville, IL, USA) 250520
High Intensity UV Inspection Lamps, Model B-100ap Thomas scientific (Swedesboro, NJ, USA) 6283K50 Manufacturer ID 95-0127-01
Stuart SC6 colony counter Bibby Scientific Limited, Staffordshire, UK SC6PLUS
Soil-less potting mixture, Metro-Mix 350 SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)
Primers:
attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT)
attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)
Integrated DNA Technologies, Inc (Coralville, IA, USA) Custom synthesized
MES, Monohydrate VWR international (Radnor, PA, USA) CAS No. 145224-94-8
Acetosyringone (Dimethoxy-4’-hydroxyacetophenone) Sigma Aldrich (St. Louis, MO, USA) D134406
Vac-In-Stuff (Silwet L-77) Lehle Seeds (Round Rock, TX, USA) VIS-30

DOWNLOAD MATERIALS LIST

References

  1. Heath, M. C. Nonhost resistance and nonspecific plant defenses. Currrent Opinion in Plant Biology. 3, 315-319 (2000).
  2. Mysore, K. S., Ryu, C. -M. Nonhost resistance: how much do we know. Trends in Plant Science. 9, 97-104 (2004).
  3. Ellis, J. Insights into nonhost disease resistance: can they assist disease control in agriculture. The Plant Cell. 18, 523-528 (2006).
  4. Senthil-Kumar, M., Mysore, K. S. Nonhost resistance against bacterial pathogens: retrospects and prospects. Annual Review of Phytopathology. 51, (2013).
  5. Lu, M., Tang, X., Zhou, J. -M. Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria. The Plant Cell. 13, 437-447 (2001).
  6. Rojas, C. M., et al. Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways. The Plant Cell. 24, 336-352 (2012).
  7. Daurelio, L. D., et al. Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco. Journal of Plant Physiology. 168, 382-391 (2011).
  8. Moreau, M., et al. EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora. Molecular Plant-Microbe Interactions. 25, 421-430 (2012).
  9. Senthil-Kumar, M., Mysore, K. S. Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response. Plant, Cell & Environment. 35, 1329-1343 (2012).
  10. Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. Applications and advantages of virus-induced gene silencing for gene function studies in plants. The Plant Journal. 39, 734-746 (2004).
  11. Senthil-Kumar, M., Mysore, K. S. New dimensions for VIGS in plant functional genomics. Trends in Plant Science. 16, 656-665 (2011).
  12. Senthil-Kumar, M., Mysore, K. S. Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato. Plant Biotechnology Journal. 9, 797-806 (2011).
  13. Bombarely, A., et al. A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research. Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).
  14. Sharma, P. C., et al. Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana. Mol Gen Genomics. 269, 583-591 (2003).
  15. Baulcombe, D. C. Fast forward genetics based on virus-induced gene silencing. Current Opinion in Plant Biology. 2, 109-113 (1999).
  16. Lu, R., et al. High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO Journal. 22, 5690-5699 (2003).
  17. Pozo, O., Pedley, K. F., Martin, G. B. MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease. EMBO Journal. 23, 3072-3082 (2004).
  18. Wang, K., Senthil-Kumar, M., Ryu, C. -M., Kang, L., Mysore, K. S. Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast. Plant Physiology. 158, 1789-1802 (2012).
  19. Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv. New Phytologist. 174, 212-223 (2007).
  20. Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing. The Plant Journal. 25, 237-245 (2001).
  21. MacFarlane, S. A. Molecular biology of the tobraviruses. Journal of General Virology. 80, 2799-2807 (1999).
  22. Anand, A., et al. Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing. Molecular Plant-Microbe Interactions. 20, 41-52 (2007).
  23. Liu, E., Page, J. Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus. Plant Methods. 4, 5 (2008).
  24. Velásquez, A. C., Chakravarthy, S., Martin, G. B. Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato. J. Vis. Exp. (28), e1292 (2009).
  25. Peart, J. R., et al. Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants. Proceedings of the National Academy of Sciences. 99. 99-10869 (2002).
  26. Oh, S. -K., et al. Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco. Planta. 223, 1101-1107 (2006).
  27. Senthil-Kumar, M., Mysore, K. RNAi and Plant Gene Function Analysis. Methods in Molecular Biology. Kodama, H., Komamine, A. 744, Humana Press. 13-25 (2011).
유전자의 식별을위한 VIGS - 중재 앞으로 유전학 검사는 Nonhost 저항에 참여
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).More

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter