Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

VIGS-опосредованная Вперед скрининг Генетика для идентификации генов, участвующих в нехозяев сопротивления

doi: 10.3791/51033 Published: August 23, 2013

Summary

Вирус индуцированного глушителей гена является полезным инструментом для идентификации генов, участвующих в нехозяев устойчивости растений. Мы продемонстрировать использование бактериальных патогенов выразив GFPuv в определении генов замолчать растения восприимчивы к нехозяев патогенов. Такой подход легко, быстро и облегчает скрининг большого масштаба и аналогичный протокол может быть применен к изучению различных других растительно-микробных взаимодействий.

Abstract

Нехозяев устойчивость к болезням растений от бактериальных патогенов контролируется сложные пути защиты. Понимание этого механизма имеет важное значение для разработки прочных устойчивых к болезням растений от широкого спектра возбудителей. Вирус индуцированного глушителей гена (VIGS) на основе вперед генетика скрининга является полезным подходом для идентификации защиты растений гены придания нехозяев сопротивления. Вирусу табачной трещотка (ТЗМ) вектора на основе VIGS является наиболее эффективным VIGS вектор, дата и была эффективно использована чтобы заставить замолчать эндогенных генов-мишеней в Nicotiana benthamiana.

В этой рукописи мы демонстрируем вперед скрининга генетики подходом для замалчивания отдельных клонов из библиотеки кДНК в N. benthamiana и оценки реакции генов растений для замолчать под угрозой нехозяев сопротивление нехозяев патогенов, Pseudomonas syringae ру. томатным T1, П. syringae ру. GlycИНЕА, и X. сатрезЫз PV. vesicatoria. Эти бактериальные патогены спроектированы так, чтобы белок экспресс GFPuv и их зеленые флуоресцирующие колонии можно увидеть невооруженным глазом при УФ-света в нехозяев патоген инокулированных растений, если молчать целевой ген участвует в передаче нехозяев сопротивления. Это облегчает надежное и быстрое определение гена замолчать растения восприимчивы к нехозяев патогенов. Кроме того, перспективным информации ген-кандидат может быть известна последовательность вставки генов растений в ТРВ вектор. Здесь мы показываем, высокая пропускная способность VIGS-опосредованной вперед генетики идентифицировать гены, участвующие в нехозяев сопротивления. Примерно, 100 кДНК может быть индивидуально замолчать примерно в две-три недели и их актуальность в нехозяев сопротивления против нескольких нехозяев бактериальных патогенов могут быть изучены через неделю после этого. В этой рукописи мы перечисляем подробные этапы этого скрининга. VIGS-опосредованной вперед генетики Screeniнг подход можно распространить не только на выявление генов, участвующих в нехозяев сопротивления, но и к изучению генов придания нескольких биотических и абиотических допусков по ударным нагрузкам в различных видов растений.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Нехозяев сопротивление сопротивление всех видов растений против расы конкретного патогена 1,2. Это придает широкий спектр и прочный устойчивость к болезням в растениях 2,3. Тем не менее, его механизм, особенно в отношении патогенных бактерий, не очень хорошо понял 4. Скрининг на мутантов или молчать растений, которые компромисс нехозяев сопротивление и высокий профилирования транскрипт пропускную способность для идентификации дифференциально экспрессированных генов во время нехозяев сопротивление 5-9 два основных подхода ранее использовались для рассечения бактериальной устойчивости нехозяев. Потому нехозяев сопротивления контролируется сложный механизм (ы) 4 с участием многих генов, высокая пропускная способность функционального подхода для геномной идентификации генов имеет решающее значение для лучшего понимания механизма сопротивления нехозяев (ы).

Вирус-индуцированные генов (VIGS) успешно используется, чтобы заставить замолчать эндогенных заводагенов во многих видах растений 10,11. Nicotiana benthamiana является одним из наиболее подходящих растений для VIGS 10,12 и проект генома теперь доступен 13. рэтл вирус (ТЗМ) на основе VIGS широко используется в качестве обратной генетики инструмент Для характеристики генов, участвующих в нехозяев сопротивления 2,4,14. Это VIGS векторов и производные теперь доступны через Arabidopsis Биологические ресурсный центр (ABRC, http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html ). VIGS была также использована в качестве инструмента вперед генетики для идентификации генов, участвующих в иммунитете растений 15-17, особенно нехозяев сопротивление 6,18. Оценка реакции гиперчувствительности (HR)-опосредованная гибель клеток индуцированные растений от специфических патогенов нехозяев и оценки вызванный болезнью гибели клеток два основных анализов в основном используется для identifyinг восприимчивы замолчать ген растений. Тем не менее, HR гибель клеток индуцируется только против второго рода патогенов нехозяев а не против Тип-I нехозяев патогенов 2. Следовательно, HR анализов не универсален и может применяться для выявления нехозяев стратегии сопротивления используется растениями, особенно в отношении широкого спектра типов патогенов Я нехозяев. Кроме того, частичную потерю нехозяев сопротивление в гене молчать растение не всегда приводит к симптомов заболевания 6 и, следовательно, болезнь скоринг не может быть использована для идентификации растений нехозяев снижения сопротивления. Наоборот, оценки роста нехозяев патогенов в геном растения замолчать является лучшим методом изучения потери нехозяев сопротивления в геном растения замолчать.

По сравнению с обычным анализом роста 6,19, более быстрый метод оценки нехозяев бактериального роста на гене молчать растений можно сократить время, необходимое для скрининга вперед генетики. Мы ранее сообщалось метод наблюдения бактерийл рост патогена на листьях невооруженным глазом под действием ультрафиолетового (УФ) света с помощью бактерий, экспрессирующих зеленый флуоресцентный белок (GFP) 19. В этой рукописи мы продемонстрировать полезность GFPuv выразив нехозяев бактериальных патогенов для легкой идентификации гена замолчать растения, которые оказываются под угрозой для нехозяев сопротивления. Эта методика является точной идентификации восприимчивых растений и поддаются для высокопроизводительного скрининга.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Рост растений и молчанию гена-мишени

  1. Условий роста растений:
    1. Сейте Н. benthamiana семена на почвенно-менее заливки смеси Metro-Mix 350 и прорастают семена в камеру роста. Любые другие земли или менее носитель также может быть использован вместо Метро-Микс.
    2. Пересадка трехнедельного сеянцы в отдельные горшки и выращивают их в теплице поддерживают на уровне 21 ± 2 ° С наряду с другими условиями роста, как описано ранее в литературе 12. От двух до трех дней после пересадки растений могут быть использованы для ТРВ прививки.
  2. Рост TRV2 клоны:
    ТРВ является двудольный вируса и его генома состоит из RNA1 и РНК2. RNA1 кодирует РНК-зависимой РНК-полимеразой и перемещение белка 20,21. РНК2 кодирует белок оболочки (СР) и два неструктурных белков из субгеномных РНК 21. Оба RNA1 РНК2 и необходимы для формирования созрел Вирнам частиц и их распространение 20,21. Конструирование кДНК библиотеки в векторном TRV2 описан в предыдущей литературе 22,23. Вкратце, библиотеку VIGS используемые в данном исследовании была построена из РНК, выделенной из ткани листьев подвергаются различным биотическим и абиотическим элиситоров.
    1. Вынуть Agrobacterium (штамма GV2260), содержащий кДНК-клоны в вектор TRV2 (96-луночный планшет) из морозильной камеры. Постепенно оттаивать их и после культур до комнатной температуры, инокуляции индивидуальной культуры Agrobacterium на Лурия-Бертани (LB) агаром с рифампицином (10 мкг / мл) и канамицином (50 мкг / мл) с использованием 96-контактного репликатор.
    2. Инкубируют планшеты при 28 ° С в течение двух дней. Мы обычно растут четыре повторных колоний для каждого клона в местах с достаточной посевной Agrobacterium доступна для укола прививки двух заводов. Выполните все шаги в стерильных условиях.
  3. VIGS:
    1. РастиAgrobacterium (GV2260) проведение TRV1 при 28 ° С в жидкой среде LB с антибиотиками, упомянутых выше. Урожай клетки центрифугированием с выращивали в течение ночи культуры повторно суспендировать в прививкой буфером (10 мМ MES, рН 5,5, 200 мкМ ацетосирингона) и инкубируют в течение 3 ч при комнатной температуре на шейкере при 50 оборотах в минуту.
    2. Урожай клетки центрифугированием и повторно суспендировать в 5 мМ MES-буфер (рН 5,5) и инокулята (OD 600 = 0,3) в абаксиальный стороне 3-4 N. benthamiana оставляет помощью безыгольного шприца. Подробные процедуры прививки было показано в предыдущих литературе 24. Позже, на месте TRV1 прививки, прививки соответствующие TRV2 колонии покалывания листья с зубочисткой.
    3. Поддерживайте растений адекватное питание как энергичный рост важны для эффективной VIGS 12. Около двух недель после прививки стенограммы целевых генов начнут урезать и растения готовы к патоген INOCulation в три недели после прививки ТРВ.

2. Подготовка нехозяев Возбудитель культур и растений Прививка

  1. Подробности патогенов используемые в этом исследовании:
    Pseudomonas syringae ру. Tabaci, П. syringae ру. томатным T1, П. syringae ру. glycinea и Xanthomonas сатрезЫз PV. vesicatoria используются в данном исследовании. Расти P. syringae штаммов в B Кинга (KB) жидкой среде, содержащей рифампицин (10 мкг / мл), канамицин (50 мкг / мл) при 28 ° С в течение 12 часов. Расти X. сатрезЫз PV. vesicatoria в жидкой среде LB в течение 16 часов. Все патогенные питать плазмиды, которые могут выразить GFPuv, как описано ранее в литературе 19.
  2. Подготовка патогеном культур для прививки растений:
    1. Урожай бактериальных клеток путем центрифугирования и подтвердить наличие зеленой флуоресценции с использованием длинных ваvelength УФ-лампы в темноте. Промыть клетки в два раза стерильной водой и повторно суспендировать их до нужной концентрации с использованием стерильной воды.
    2. Привить соответствующего возбудителя (ы) на абаксиальной стороны гена-мишени замолчать листьев (5-го по 8-е место) в виде пятен (диаметром около 1,5 см). Несколько патогенов нехозяев одновременно могут быть проверены на их рост в гене-мишени молчать растений. Одновременно прививку хозяина патогеном, как это может быть использовано в качестве положительного контроля для просмотра в плантаций роста бактерий. Также прививки векторного управления (ТРВ :: 00) растений.

3. Наблюдение в Планта рост бактериальных патогенов

  1. Expose привиты листья длиной волны ультрафиолетового света в темноте. Бактериальные колонии можно рассматривать как зеленый флуоресцентный точек в абаксиальный стороне листа на фоне красной флуоресценции, испускаемой поверхности листа.
  2. Соблюдайте рост патогенныхот 2 дней после инокуляции (точек на дюйм) до 5 точек на дюйм. Каждый день наблюдений в течение этого интервала времени является необходимым.
  3. После того, как первый экран, краткий перечень которых клонов глушителей приводит к росту одного или более нехозяев патогена (ов).
  4. Повтор VIGS для отобранных клонов и снова проверить реакцию гена молчать растений нехозяев патогена (ов). Этот второй уровень скрининга делается для удаления ложных срабатываний, полученных в ходе первого экрана.

4. Подтверждение номинанта Растения для скомпрометированных нехозяев сопротивления

  1. Silence кДНК-клонов, выбранных на экране, как описано выше. Инокулируйте целое растение с нехозяев патогена (ы) путем погружения растений с соответствующим патогеном культур с 0,01% (объем / объем) Silwet L-77 и подвергание подводных растений в вакууме в течение 3 - 5 мин. Количественная роста бактерий на обычном анализе роста 6,18,19 как описано ниже.
  2. В 0 часов после прививки (HPI),3 точек на дюйм и 5 точек на дюйм, собрать два образца лист из пяти биологических повторяет для каждого патогена нехозяев (ы) привиты листья использованием листьев удар (0,5 см 2). Измельчить листья образцы, серийные разбавленные и пластины SAP на KB агар среде с добавлением соответствующих антибиотиков и инкубировать при 28 ° С в течение 2 дней. Подсчет колоний бактерий использованием счетчика колоний и рассчитать рост бактерий в листьях, как описано ранее в литературе 6.
  3. Растения чувствительны к нехозяев патогена (ы) должны показать большее количество возбудителя рост по сравнению с векторным управлением.

5. Секвенирование вставки и идентификация гена-мишени

  1. Выполнение ПЦР колоний для выбранного клона использованием attB1 и attB2 праймеров или с использованием праймеров, фланкирующих сайт клонирования в TRV2 вектор. Запуск продукта ПЦР на гель и проверка для амплификации одной полосы.
  2. Завод вставки гена в вектор TRV2 можно секвенировать с использованием ATTBпраймера или праймеров фланговые сайт клонирования.
  3. Выполнение BLAST с использованием последовательности, и идентифицировать ген деталей.
  4. Получить полную последовательность гена длиной вместе с ООН-транслированные области (НТО).
  5. Выбор 300-400 п.о. фрагментов из трех различных областей последовательность и клонировать их в TRV2 вектор. VIGS самостоятельно выполнять с использованием всех трех VIGS конструкций и подтвердите компромисс нехозяев сопротивления во всех трех генов замолчать растений.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Основной целью данного исследования является демонстрация метода для легкой и точной идентификации гена замолчать Н. benthamiana растения, которые оказываются под угрозой для нехозяев сопротивления. Существуют четыре основных этапа в этой методологии. Первый шаг заключается в индивидуальном замолчать большое количество генов использованием TRV-VIGS. Мы молчать около 5000 генов 6,18 в течение периода около 1,5 лет с использованием протокола, изображенные на фиг.1. Некоторые из генов замолчать растений показали различные фенотипические изменения в том числе задержки роста, пожелтение и фото-отбеливание фенотипа (рис. 2).

Вторым шагом является идентификация гена замолчать растений с восприимчивостью к нехозяев патогена (ы). Мы использовали GFPuv выражения бактерий и отслеживается их роста в Планта (рис. 3А-3С). Для того, чтобы продемонстрировать процесс идентификации гена молчать растения восприимчивы к нехозяев рathogen (ы), мы использовали три нехозяев патогенов, П. syringae ру. томатным T1, П. syringae ру. glycinea и X. сатрезЫз PV. vesicatoria. Как и ожидалось, не замолчать (векторное управление) N. benthamiana растения засевают эти патогены не растут, поскольку они не смогли преодолеть иммунитет растений. Тем не менее, П. syringae ру. томатным T1 формируется зеленый флуоресцентный колонии на NbSGT1 гена (генов вовлечены в нехозяев сопротивлением 25) замолчать растений (рис. 3D). Эти данные показывают, процесс идентификации генов растений замолчать под угрозой для нехозяев сопротивления. Этот протокол может быть непосредственно применены направить генетика скрининга. Например, представитель результаты взяты из одной из наших предыдущих вперед генетики экрана (рис. 4) показаны два независимых гена замолчать растений с различной степенью P. syringae ру. томатным T1 роста (рис. 5

Третий шаг является подтверждением роста бактерий в гене молчать растения, обнаруженные на экране путем количественной оценки роста бактерий. Например для оценки в плантаций бактериального роста в NbSGT1 ген молчать растений показано на рисунке 3E. Результаты показали, что в плантаций рост Р. syringae ру. томатным T1 был намного выше в NbSGT1 замолчать растений по сравнению с не замолчать (ТРВ :: 00) контрольных растений (рис. 3Е). Потеря нехозяев сопротивление из-за конкретного глушителей гена может быть частичным или полным. В зависимости от этого, степень нехозяев рост болезнетворных микробов на гене замолчать растений может меняться.

Четвертый этап представляет собой последовательность вставки в TRV2 вектор. BLAST осуществляется с использованием этой последовательности для идентификации гена и его детали.

Рисунок 1 Рисунок 1. Мультфильма показывающая этапы глушителей большое количество генов использованием ТРВ на основе VIGS. Три недельных N. benthamiana растения пересаживают в отдельные горшки и выращивают в течение нескольких дней. Agrobacterium, несущий TRV1 конструкция проник в 3:57 листьев использование ненужных шприца. Позже, 96 клонов кДНК, выращенных на LB пластины агара отдельно взятого с помощью зубочистки и кололи на месте TRV1 привитых соответствующих растений. Около 3 недель после инокуляции целевой генов происходит в верхней неинокулированные новообразованных листьев. Эти листья (5-го по 8-е место), используемые для тестирования ростом нехозяев патогена (ы).

Рисунок 2
Рисунок 2. VIGS-опосредованной вперед скрининг в генетикеН. benthamiana показывает различные изменения в растение фенотип. Три-недельных N. benthamiana растений независимо инокулировали соответствующими ТРВ конструкций с таблицей на рисунке 1 в качестве части экрана вперед генетика показаны. Были сделаны фотографии на 21 день после прививки ТРВ.

Рисунок 3
Рисунок 3. Зеленой флуоресценции от GFPuv выразив бактериальных патогенов и его использование для идентификации генов, участвующих в нехозяев сопротивления. Pseudomonas syringae ру. Tabaci, хозяин возбудителя, проведение GFPuv построить штрихом на KB-средних пластины имеет зеленую флуоресценцию под ультрафиолетовым светом длиной волны в темноте ( А). Эти бактерии выращивали на среде KB и повторно суспендируют в воде (B) и инокулировали на N. benthamiana 4 КОЕ / мл). Через 3 дня после прививки (ДОИ) бактериальных колоний рассматриваются как зеленый флуоресцентный пятен невооруженным глазом с абаксиальной стороне листа клетки эпидермиса (С, слева). И тот же лист на фото при нормальном освещении (видимый диапазон) также показал (C, справа). GFPuv выразив P. syringae ру. tabaci (Pstab, 1 х 10 4 КОЕ / мл) и три патогенов нехозяев, П. syringae ру. томатным T1 (PstT1, 1 х 10 4 КОЕ / мл), П. . syringae ру glycinea (Psg, 3 х 10 5 КОЕ / мл) и Xanthomonas vesicatoria сатрезЫз ру (XCV, 3 × 10 4 КОЕ / мл) инокулируют на абаксиальный стороне листьев от векторного управления (ТЗМ :: 00.; D, слева) и NbSGT1 ген молчать растений (D, справа). Бактериальные колонии Pstab видны на обоих листья и тех из PstT1 видны только на NbSGT1 ген замолчать листьев. PstT1 рост NbSGT1 ген замолчать листья количественно на 24, 24 и 72 ч после прививки (HPI, E) показана на графике. Нажмите здесь, чтобы увеличить рисунок .

Рисунок 4
Рисунок 4. Обзор протоколов для последующей VIGS-опосредованного вперед скрининг генетики для идентификации генов, участвующих в нехозяев сопротивления. КДНК-библиотеки в TRV2 вектор конструировали с использованием РНК, из нехозяев патогена (ы) инокулировали N. benthamiana листья могут быть использованы для скрининга. Индивидуальные клоны из библиотеки кДНК замалчиваются в N. benthamiana по TRV-VIGS. Соответствующие GFPuv выражения нехозяев бактериальным патогеном (ы) инокулируют на ген молчать листья растения. Между 2 и4 DPI инокулированным пятна, наблюдаемые с помощью УФ-лампы в темноте и растений с нехозяев рост патогенных определены. После такого предварительного отбора, отобранных клонов замолчать снова и нехозяев роста патогенов является подтвердили. Это второй экран уровне делается для удаления ложных срабатываний. Позже, подтвердил клоны замолчать в третий раз и соответствующих росту бактерий оценивается. Вставки соответствующих клонов в TRV2 вектора генной последовательности и информации было выявлено. Одновременно HR анализа также может быть выполнена на гене замолчать растения для идентификации генов, способствующих HR индуцированных против типа-II нехозяев патогенов.

Рисунок 5
Рисунок 5. Нехозяев бактериальным патогеном рост замолчать ген растения, которые были идентифицированы как части передней экрана генетики. Иллюстрации ForwarD генетики скрининга, которые определили гены, участвующие в нехозяев сопротивление Н. benthamiana растений от PstT1, ПСЖ и XCV. Фотографии, сделанные в течение двух представителей замолчать ген растения на 3 DPI после прививки показаны здесь. Бактериальные концентрации используют дл инокул ции описаны на рисунке 3. 43D4 или 94C1 указывает на 96-луночный планшет номер и номер скважины.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Иммунитет растений ограничивает рост нехозяев патогенов и, следовательно, мало или вообще не зеленая флуоресценция не выпустили из векторного управления установкой оставляет засевают нехозяев патогена под ультрафиолетовым светом длиной волны (рис. 3D). Однако, когда ген, участвующий в нехозяев сопротивление будет выключен, ген молчать растений способствуют росту нехозяев возбудителя и зеленой флуоресценции видно (рис. 3Е). Это основной принцип, участвующих в метод, описанный в этой рукописи. Эта методика имеет два основных преимущества перед HR-анализа на основе. Один из них, идентификация замолчать растения восприимчивы к нехозяев патогена GFPuv основе анализа повышает точность, как в росте Планта можно просмотреть. Во-вторых, этот метод дает возможность идентифицировать гены, участвующие в оба типа-I нехозяев сопротивления 2,26 (не приводит к видимым гибель клеток) и тип-II нехозяев сопротивления 2,26 (в результате гибели клеток сверхчувствительных ответ).Например, мы ранее идентифицировали клон называется 6C8 и замолчать растения были подвержены оба типа 1 и 2-го типа патогенов 18.

Кроме того, вполне возможно, что два или более независимых клонов использовать для VIGS привело замолчать ген растения с похожими фенотипами, как они происходят, чтобы заставить замолчать определенного гена. Эта избыточность является полезным, поскольку оно подтверждает глушителей фенотип. Появление таких повторов зависит от библиотеки использовали для скрининга и тип гена (как некоторые гены экспрессируются на высоком уровне и, следовательно, происходит многократно в библиотеке). Кроме того, почти все клонирования генов, закодированных Н. benthamiana генома в библиотеке кДНК VIGS и заставить их замолчать независимо возможно.

Для того, чтобы эффективно осуществлять скрининг вперед генетики для идентификации генов, участвующих в нехозяев сопротивления использованием VIGS с последующим анализом методом GFPuv флуоресценции, следующие советы полезны.

В порядкедля успешного VIGS, (1) использовать 3 - 4 листа этапе установки для ТРВ прививки, (2) и оптимальное TRV1 TRV2 титра важно. С TRV2 титр может быть ограничивающим фактором для начала VIGS, прививки по крайней мере, 4 полностью выросли бактериальные колонии Agrobacterium укрывательстве TRV2, и (3) поддержания оптимальных условий окружающей среды 12. Температура окружающей среды играет важную роль в стимулировании оптимальной VIGS.

Критические шаги для эффективного обнаружения зеленой флуоресценции от патогенов включают в себя: (1) Всегда используйте свежие патогеном культур собирают в экспоненциальной фазе роста и не храните их перед прививкой, и (2) HR гибель клеток следует избегать, поскольку они могут автоматического флуоресцирует в ультрафиолетовом свет и негативно повлиять на наблюдениях. Это особенно важно, когда тип-II нехозяев возбудителя (например, P. syringae ру. Томатным T1) используется для исследования. Используйте низкую концентрацию возбудителя нехозяев если микроскопические HR подозревается или EVidenced.

Поиск и устранение неисправностей:

(1) Несоответствие глушителей гена и появлению переменной фенотипа глушителей среди повторяет:

Меняйте перчатки для каждого клона во время прививки ТРВ. Кроме того, убедитесь, что TRV2 Agrobacterium колонии не содержать несколько клонов ПЦР колоний. Если ПЦР колоний показывает более чем одной группой, вполне возможно, что более чем один клон присутствует в колонии. Для того чтобы отделить клонов, полоса их на тарелку LB агаром и экран клонов ПЦР колоний. После идентификации индивидуальных клонов, выполнять VIGS независимо для каждого из них и идентификации генов молчать растение нехозяев снижения сопротивления.

(2) тяжелые дефекты роста в замолчать растений:

Если молчать ген-мишень (и) участвует в основной обмен растений, рост дефектов, как ожидается. Тем не менее, некоторые из генов молчать плантс может показывать более высокие умножения ТРВ по сравнению с растениями векторного управления и это может вызвать дополнительный эффект от тяжести фенотипа. Местное анализа поражения на 12 Chenopodium растений amaranticolor могут быть выполнены, чтобы выяснить, является ли замолчать растения имеют более высокий титр ТРВ по сравнению с растениями векторного управления. В этих условиях растения около 4 недель может быть использован для VIGS снизить тяжесть фенотипа.

(2) и от ворот генов:

Неспецифические генов, часто упоминается как мимо ворот глушителей может произойти во время VIGS. Это происходит, когда частичная гомология последовательности позволяет миРНК создается для предполагаемого гена-мишени деградировать мРНК генов, которые не являются намеченных целей глушителей 27. Использование UTR последовательностей, как вставка в TRV2 вектор. Исследование эндогенного подавления гена всех ожидаемых от ворот генов и убедитесь, что конструкция молчание одного гена. TO облегчить идентификацию фрагментов гена с минимальным или вообще не проходит мимо, биоинформатики инструменты могут быть использованы (например, http://plantgrn.noble.org/pssRNAit/ ).

(3) Нет зеленой флуоресценции от бактериальных колоний в Планта:

Это происходит, скорее всего, за счет использования более выращивали культуру. Другой причиной может быть меньшей бактериальных посевной. Хотя бактериальный концентрации могут быть измеряемые косвенным путем измерения оптической плотности OD 600, мертвые бактериальные клетки могут составлять более высокой оптической плотности. Желательно, чтобы рассчитать оптимальную концентрации бактерий на основе колониеобразующих единиц (КОЕ) путем подсчета живых клеток на среде агара пластины КБ. Значения оптической плотности может быть скорректирована на основе КОЕ. Кроме того, возбудитель подряд как можно чаще от глицерине, вырастить его на тарелку и агар KB прививку одной свежей колонии для подготовки культур для посева.

Один из часто возникающих причиной трудностей с секвенирования вставки в TRV2 вектор (ПЦР колоний) является наличие нескольких колоний. Для того чтобы преодолеть этот клоны, несущие конструкции отдельных TRV2 должны быть изолированы, как указано выше (1).

Ограничения метода GFPuv и пути их преодоления:

Патогенные может потерять GFPuv проведения плазмиды при размножении и, следовательно, отрицательно влияет на наблюдениях. Кроме того, некоторые из генов молчать растений показывает, пожелтение и фотообесцвечивания листьев и эти листья испускают различные флуоресценции (чем красный). Это делает зеленую флуоресценцию трудно увидеть. Один из способов, чтобы уменьшить эффект авто флуоресценции от желтого или белого цвета листьев делать фотоснимки для зеленых флуоресцентных бактериями с помощью камеры оснащены фильтрами, которые можно удалить или уменьшить фона ЭффеКТ. Фотографии могут быть использованы, чтобы вывести ли бактерии выросли или нет. Некоторые программы (например, Adobe Photoshop) может быть использован для уменьшения фона эффект при анализе таких изображений.

Биобезопасности меры предосторожности, как соответствующее распоряжение трансгенных бактериальных патогенов должны быть выполнены во время экспериментов. Кроме того, соответствующие кожи и щиты для защиты глаз следует использовать при работе с УФ-лампой.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Нам нечего раскрывать.

Acknowledgments

Этот проект финансировался Сэмюэл Робертс Благородный Foundation. Авторы благодарят MS. Джени Gallaway и Коллин Elles за отличную Уход за растениями и г-жа Кэти Браун за произведения искусства. Мы также хотели бы поблагодарить MS. Trina Коттреллом, Пуджа Uppalapati, Moumita Саха, Swetha Vinukonda и г-н Исаак Greenhut за техническую помощь при создании этого протокола.

Materials

Name Company Catalog Number Comments
96-well U-bottom plates Becton Dickinson Labware (Franklin Lakes, NJ, USA) 35-3077
96-pin replicator stainless steel Nalge Nunc International (Naperville, IL, USA) 250520
High Intensity UV Inspection Lamps, Model B-100ap Thomas scientific (Swedesboro, NJ, USA) 6283K50 Manufacturer ID 95-0127-01
Stuart SC6 colony counter Bibby Scientific Limited, Staffordshire, UK SC6PLUS
Soil-less potting mixture, Metro-Mix 350 SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)
Primers:
attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT)
attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)
Integrated DNA Technologies, Inc (Coralville, IA, USA) Custom synthesized
MES, Monohydrate VWR international (Radnor, PA, USA) CAS No. 145224-94-8
Acetosyringone (Dimethoxy-4’-hydroxyacetophenone) Sigma Aldrich (St. Louis, MO, USA) D134406
Vac-In-Stuff (Silwet L-77) Lehle Seeds (Round Rock, TX, USA) VIS-30

DOWNLOAD MATERIALS LIST

References

  1. Heath, M. C. Nonhost resistance and nonspecific plant defenses. Currrent Opinion in Plant Biology. 3, 315-319 (2000).
  2. Mysore, K. S., Ryu, C. -M. Nonhost resistance: how much do we know. Trends in Plant Science. 9, 97-104 (2004).
  3. Ellis, J. Insights into nonhost disease resistance: can they assist disease control in agriculture. The Plant Cell. 18, 523-528 (2006).
  4. Senthil-Kumar, M., Mysore, K. S. Nonhost resistance against bacterial pathogens: retrospects and prospects. Annual Review of Phytopathology. 51, (2013).
  5. Lu, M., Tang, X., Zhou, J. -M. Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria. The Plant Cell. 13, 437-447 (2001).
  6. Rojas, C. M., et al. Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways. The Plant Cell. 24, 336-352 (2012).
  7. Daurelio, L. D., et al. Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco. Journal of Plant Physiology. 168, 382-391 (2011).
  8. Moreau, M., et al. EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora. Molecular Plant-Microbe Interactions. 25, 421-430 (2012).
  9. Senthil-Kumar, M., Mysore, K. S. Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response. Plant, Cell & Environment. 35, 1329-1343 (2012).
  10. Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. Applications and advantages of virus-induced gene silencing for gene function studies in plants. The Plant Journal. 39, 734-746 (2004).
  11. Senthil-Kumar, M., Mysore, K. S. New dimensions for VIGS in plant functional genomics. Trends in Plant Science. 16, 656-665 (2011).
  12. Senthil-Kumar, M., Mysore, K. S. Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato. Plant Biotechnology Journal. 9, 797-806 (2011).
  13. Bombarely, A., et al. A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research. Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).
  14. Sharma, P. C., et al. Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana. Mol Gen Genomics. 269, 583-591 (2003).
  15. Baulcombe, D. C. Fast forward genetics based on virus-induced gene silencing. Current Opinion in Plant Biology. 2, 109-113 (1999).
  16. Lu, R., et al. High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO Journal. 22, 5690-5699 (2003).
  17. Pozo, O., Pedley, K. F., Martin, G. B. MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease. EMBO Journal. 23, 3072-3082 (2004).
  18. Wang, K., Senthil-Kumar, M., Ryu, C. -M., Kang, L., Mysore, K. S. Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast. Plant Physiology. 158, 1789-1802 (2012).
  19. Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv. New Phytologist. 174, 212-223 (2007).
  20. Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing. The Plant Journal. 25, 237-245 (2001).
  21. MacFarlane, S. A. Molecular biology of the tobraviruses. Journal of General Virology. 80, 2799-2807 (1999).
  22. Anand, A., et al. Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing. Molecular Plant-Microbe Interactions. 20, 41-52 (2007).
  23. Liu, E., Page, J. Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus. Plant Methods. 4, 5 (2008).
  24. Velásquez, A. C., Chakravarthy, S., Martin, G. B. Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato. J. Vis. Exp. (28), e1292 (2009).
  25. Peart, J. R., et al. Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants. Proceedings of the National Academy of Sciences. 99. 99-10869 (2002).
  26. Oh, S. -K., et al. Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco. Planta. 223, 1101-1107 (2006).
  27. Senthil-Kumar, M., Mysore, K. RNAi and Plant Gene Function Analysis. Methods in Molecular Biology. Kodama, H., Komamine, A. 744, Humana Press. 13-25 (2011).
VIGS-опосредованная Вперед скрининг Генетика для идентификации генов, участвующих в нехозяев сопротивления
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).More

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter