Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Affinity-basierte Isolierung von Tagged Kerne aus doi: 10.3791/51418 Published: March 25, 2014

Summary

Drosophila-Gewebe enthalten häufig eine heterogene Mischung von Zelltypen. Um die Genexpression in spezifischen Zelltypen aus einem bestimmten Gewebe zu untersuchen, können Keime genetisch markiert und anschließend mit einer Affinität-basierten Ansatz isoliert. Isolierte Kerne für nachgelagerte Anwendungen wie Genexpressionsanalyse und Chromatinimmunpräzipitation verwendet werden.

Abstract

Drosophila melanogaster und embryonalen Geweben der Larven enthalten oft ein sehr heterogenes Gemisch von Zelltypen, die die Analyse der Genexpression in diesen Geweben erschweren kann. Somit zellspezifische Genexpressionsprofile von Drosophila Gewebe zu analysieren, kann es notwendig sein, bestimmte Zelltypen mit hoher Reinheit und in Ausbeuten ausreichend für nachfolgende Anwendungen wie Transkriptionsprofiling und Chromatin-Immunopräzipitation isoliert. Jedoch kann die unregelmäßige Zellmorphologie in Geweben wie dem zentralen Nervensystem, verbunden mit der seltenen Population von spezifischen Zelltypen in diesen Geweben, Herausforderungen für herkömmliche Methoden der Zellisolierung wie Laser Mikrodissektion und Fluoreszenz-aktivierte Zellsortierung darstellen (FACS) . Hier wird ein alternativer Ansatz zur Charakterisierung zellspezifische Genexpressionsprofilen unter Verwendung von Affinitäts-basierte Isolierung von markierten Kerne, anstatt ganzer Zellen, beschrieben. Kerne in der spezifischen cell Art von Interesse sind genetisch mit einer Kernhülle lokalisierte EGFP-Tag mit der GAL4/UAS binären Expressionssystem gekennzeichnet. Diese EGFP-markierte Kerne können mit Antikörpern gegen GFP, die an magnetische Kügelchen gekoppelt sind, isoliert werden. Die in diesem Protokoll beschriebenen Ansatz ermöglicht eine konstante Trennung der Kerne von spezifischen Zelltypen in Drosophila Larven des zentralen Nervensystems bei hoher Reinheit und in ausreichenden Mengen für die Expressionsanalyse, auch wenn diese Zelltypen enthalten weniger als 2% der Gesamtzellpopulation in der Gewebe. Dieser Ansatz kann verwendet werden, um Kerne aus einer Vielzahl von embryonalen und larvalen Drosophila Zelltypen mit spezifischen Gal4 Treiber zu isolieren, und kann zur Isolierung von Kernen von Zelltypen, die nicht geeignet für die FACS oder Laser Mikrodissektion werden können.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Drosophila-Gewebe, wie dem zentralen Nervensystem enthalten ein komplexes Gemisch von Zelltypen. Somit zellspezifische Genexpressionsprofile von Drosophila Gewebe zu analysieren, ist es zunächst notwendig, eine homogene Population von spezifischen Zellen in ausreichenden Mengen zu isolieren, um Downstream-Anwendungen zu ermöglichen. Verfahren, um Zellen von intakten Geweben zu isolieren, umfassen Laser Mikrodissektion und Fluoreszenz-aktivierte Zellsortierung (FACS) von ganzen Zellen. Während FACS wurde verwendet, um Zellen und Zellkerne von Drosophila-Embryonen und aus Caenorhabditis elegans zur Genexpression und Chromatin Profilierung 1-3 isolieren kann FACS und Laser Mikrodissektion schwierig sein, in Geweben, die stark vermischten Zelltypen oder enthalten, dass die Zellen mit enthalten, erfolgreich durchführen unregelmäßige Morphologie, wie Neuronen. Um diese Schwierigkeit zu überwinden, können Kerne anstatt Zellen aus spezifischen Zelltypen isoliert und für die nachfolgende Generation verwendet werden,e Expression Profiling. Wichtig ist, Microarray-basierte mRNA-Expressionsanalyse, die Kern RNA-Proben zeigt allgemein vergleichbare Ergebnisse bei der Verwendung von Gesamt-RNA, 4, 5 durchgeführt. Darüber hinaus hat die Genexpressionsanalyse mit Kern-RNA wurde erfolgreich eingesetzt, um die Genexpression in mehreren Organismen einschließlich C. studieren elegans, Arabidopsis thaliana, Drosophila und Menschen 4, 5 2, 3.

Mehrere Ansätze wurden kürzlich für die Isolierung von spezifischen Populationen von markierten Kerne aus Drosophila Gewebe, geeignet für Genexpressionsanalyse und / oder Chromatinimmunpräzipitation sind beschrieben worden. Die Batch-Isolierung von Gewebe-spezifische Chromatin für die Immunpräzipitation (BiTS-Chip-) Verfahren nutzt FACS festen Kerne auf der Basis von Zelltyp-spezifische Expression von Kern lokalisierte GFP 2 isolieren. Dieser Ansatz war successfully verwendet, um die Verteilung von Histon-Modifikationen und Transkriptionsfaktoren unter Verwendung von Chromatin-Immunpräzipitation von isolierten Kernen aus dem Mesoderm von Drosophila-Embryonen 2 analysieren. Jedoch kann FACS-basierte Ansätze zur Isolierung markierten Kerne, die nur einen geringen Anteil an einer gemischten Population aufgrund der erhöhten Zeitaufwand für die Art geeignet Nummern für Downstream-Anwendungen zu erhalten, machen weniger geeignet sein. Um diese Einschränkungen zu überwinden, wurden mehrere Gruppen Affinitäts-Isolationstechniken genutzt werden, um Kerne, die mit einem bestimmten Epitop in einem bestimmten Zelltyp gekennzeichnet sind, zu reinigen. Die Isolierung von Zellkernen in spezifischen Zelltypen (intakt) Verfahren zur Verwendung in Arabidopsis thaliana 6, 7 entwickelt markiert wurde kürzlich für die Verwendung in Drosophila 8 angepasst. Bei diesem Verfahren ist eine Kernhülle Fusionsprotein, das ein Substrat für die in vivo-Biotinylierung coexpressed mit dem Escherichia coli Biotinligase BirA in bestimmten Zelltypen. Biotin-markierte Kerne kann anschließend von Mischpopulationen unter Verwendung von Streptavidin-basierte Affinitätsisolierung gereinigt werden. Unter Verwendung dieses Ansatzes wurden Kerne erfolgreich markiert und aus dem Mesoderm von Drosophila-Embryonen, in dem eine Kernhülle-Fusionsprotein unter der Kontrolle eines Mesoderm-spezifischen Enhancer exprimiert 8 isoliert. Die Autoren erzeugten Kernhüllenfusionsproteine, die in jedem Zelltyp unter der Kontrolle des Gal4 regulatorische Sequenz, UAS 9 ausgedrückt werden kann. Dieser Ansatz ist in der Lage, schnell zu isolieren Teilmengen von markierten Kerne von Mischpopulationen, erfordert aber drei separate transgene Konstrukte und kann daher für bestimmte genetische Anwendungen ungeeignet sein. Vor kurzem wurde ein Ansatz beschrieben, bei dem so (S ad1 und UN-C-84)-Domäne enthalten Proteine, die an der inneren Membran der Kernhülle zu lokalisieren, wurden mit dem Stichwortfluoreszierende Proteine ​​und unter der Steuerung des Systems 10 GAL4/UAS ausgedrückt. Kerne wurden in Gegenwart von nichtionischen Detergens isoliert, um die äußere Membran von der Kernhülle zu entfernen, und affinitätsgereinigt unter Verwendung von magnetischen Kügelchen, um Anti-GFP-Antikörper gekoppelt. Dieser Ansatz wurde erfolgreich eingesetzt, um kleine Populationen von markierten Kerne von spezifischen neuronalen Subtypen im erwachsenen Gehirn von Drosophila 10 zu isolieren.

Hier wird ein Protokoll für die Isolierung der markierten Kerne aus einer gemischten Population von Zellen von Drosophila-Larven Gewebe beschrieben. Diese Methode wurde entwickelt, unabhängig, aber ist ähnlich dem von Henry et al. 10 zuerst beschriebenen Ansatz wurden Kerne mit einer fluoreszierenden Markierung, die nur in bestimmten Zelltypen in Drosophila exprimiert wird, um die anschließende Trennung von markierten Kerne aus gemischten Populationen erleichtern markierten mit einer Affinität-basierten Ansatz. Um Keime zu kennzeichnen,die KASH (K larsicht / A nc-1 / S yn h omology)-Domäne wurde eingesetzt. Die KASH Domäne eine Transmembrandomäne, die an die äußere Membran der Kernhülle, teilweise durch Wechselwirkung mit SUN-Domäne enthaltenden Proteinen innerhalb der perinukleären Raum 11 lokalisiert. Die C-terminale Domäne von KASH Proteine ​​wie Drosophila Msp-300 und Klarsicht verankert diese Proteine ​​an der äußeren Kernmembran, während die N-terminalen Domänen interagieren mit Cytoskelett-Proteine ​​wie Aktin oder Mikrotubuli im Zytoplasma 12-14. Konstrukte wurden erzeugt, in dem die KASH Domäne von Drosophila Msp-300 wurde unter der Kontrolle des Gal4 regulatorische Sequenz, UAS in der pUAST attB-Vektor 15, 16 an den C-Terminus von EGFP fusioniert. Mit phiC31 ortsspezifische Integration wurden transgene Fliegen erzeugt, in dem die UAS-EGFP :: Msp-300-KASH Transgen wurde in der attP2 Loci auf Chromosom eingefügt3L 17. Die FH-EGFP :: Msp-300-KASH fliegt mit Fliegen, die das Gal4-Treiber zum Ausdruck in einem bestimmten Zelltyp, was die gezielte Expression von EGFP auf der äußeren Kernmembran in den Zelltyp von Interesse überquert werden. Markierte Kerne können dann aus gemischten Zellpopulationen mit Antikörpern gegen GFP an magnetische Kügelchen gekoppelt gereinigt werden. In diesem Ansatz wird die Verwendung von nichtionischen Detergens nicht erforderlich, da das EGFP-Tag an der zytoplasmatischen Seite der äußeren Kernmembran lokalisiert, und ist daher für Antikörper zugänglich.

Die unten beschriebene Protokoll kann zur Isolierung / bereichern EGFP-markierten Kerne von bestimmten Zelltypen in Drosophila Larvengewebe, um die Reinheit und Ausbeute der isolierten Zellkernen zu quantifizieren und Kern-RNA zu extrahieren geeignet für quantitative Reverse-Transkriptase-Polymerase-Kettenreaktion (qRT werden -PCR) Genexpressionsanalyse. Die Isolierung und Reinigung von Affinität-Kerne (ohne tissuPräparation E) kann in weniger als einer Stunde durchgeführt werden. Ergebnisse dargestellt, die die Gliazellen Kerne erfolgreich vom Larvenoptischen Keule und Augen Imaginalscheibe isoliert werden und für nachfolgende Genexpressionsanalyse verwendet. Es ist zu erwarten, dass dieser Ansatz nützlich für die Isolierung / Anreicherung der markierten Kerne aus embryonalen und larvalen Geweben, in denen die Zielzellen weniger als 5% der Gesamtpopulation darstellen können. Alle Drosophila Aktien und Plasmide in dieser klinischen Studie sind von den Autoren auf Anfrage erhältlich.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Erzeugung und Charakterisierung von EGFP :: Drosophila KASH

  1. Kreuz Gal4-Treiber fliegt UAS-EGFP :: Msp-300-KASH fliegt. Alternativ können rekombinante Fliegen, die sowohl die Gal4-Treiber und den UAS-EGFP :: Msp-300-KASH Transgen tragen mit Standard-genetische Techniken erzeugt werden. Dieser zweite Ansatz ist vorteilhaft, wenn eine große Zahl von Nachkommen erforderlich sind.
  2. Charakterisierung der Expression des EGFP :: KASH Marker mit Standard-Mikroskopie-Techniken. Hinweis: EGFP-Expression kann durch Standardtechniken in der Mikroskopie präpariert, fixiert Drosophila Geweben beobachtet werden, ganz oder Larven, und die Verwendung eines Antikörpers nicht erforderlich.
    1. Bestimmen Sie die Expressionsmuster der EGFP :: KASH Marker im gesamten Organismus unter einem Fluoreszenzmikroskop seziert (siehe Materialien PDF). Hinweis: Viele Gal4 Treiber, darunter auch der in Abbildung 1 dargestellt Repo-GAL4-Treiber, Ausstellungs nonspecific Expressionsmuster in anderen Larvengewebe wie der Speicheldrüse (siehe Ergebnisse).
    2. Analysieren Sie den EGFP :: KASH Expressionsmuster in der sezierten Gewebe von Interesse mit Hilfe der konfokalen Mikroskopie.
      1. Fix das Gewebe von Interesse unter Verwendung von Formaldehyd in einer Endkonzentration von 4%, und DNA mit DAPI-Färbung in einer Endkonzentration von 0,1 ug / ml, um die Lokalisation des EGFP :: KASH Tag bezogen auf DNA sichtbar.
      2. Erwerben Sie Bilder entweder mit einem 40X / 1,30 Ölimmersionsobjektiv oder ein 20X / 0,75 Ölimmersionsobjektiv, abhängig von der Größe des Gewebes von Interesse. Die folgenden Anregung / Emissionsbedingungen können für die Bildaufnahme verwendet werden: 408 nm/425-475 nm (DAPI), 488 nm / 525 bis 550 nm (GFP).

2. Isolieren Kerne von Drosophila Larven Gewebe

  1. Bereiten Ausrüstung für die Larven Gewebedissektion Kerne und anschließende Isolation. Beachten Sie, dassganze dechorionated Embryonen können auch als Ausgangsmaterial verwendet werden, falls gewünscht. Es wird empfohlen, teilweise zerlegt Larven Gewebe statt ganzer Larven verwenden, wenn der Zelltyp von Interesse in einem spezifischen Gewebe, wie Imaginalscheibe vorliegt. Dies reduziert die unspezifische Bindung und beseitigt Probleme, die durch die Expression von Gal4 Treiber in einigen Nicht-Zielzellen verursacht werden können auch.
    1. Bereiten Sie zwei Paar scharfe Zange (siehe Materialien PDF), eine silikonisierte 9-Loch-Glasplatte (siehe Materialien PDF) und PBT (1x PBS, pH 7,4, 0,1% Tween-20).
    2. Vorausbindung der GFP-Antikörper an die magnetischen Kügelchen. Dieser Schritt vor Beginn der Präparation begonnen werden. Werden 10 ul der magnetischen Beads (Invitrogen, siehe Materialien PDF) und 2 ug des GFP-Antikörper (Roche, siehe Materialien PDF) zu 400 &mgr; l Waschpuffer (1 × PBS, pH 7,4, 2,5 mM MgCl 2) in einem 1,5-ml-Röhrchen . Die Menge an Perlen und Antikörper verwendet werden, können gegebenenfalls auf der Grundlage der Menge an Target in der sam optimiertPLE und die Bindungsaffinität des Antikörpers an die Beads.
    3. Inkubieren der Kügelchen und der Antikörper mit einer Drehung von mindestens 30 min bei Raumtemperatur.
    4. Legen Sie die 1,5-ml-Röhrchen mit den Perlen und Antikörper in der Magnetstange (siehe Materialien PDF) und lassen Sie die Perlen auf die Magnet für ca. 1-2 min zu binden. Entfernen Sie den Überstand, der nicht gebundenen Antikörper und Waschpuffer mit einer 1 ml Pipette. Die Perlen bleiben an der Wand des 1,5 ml-Röhrchen auf der Seite benachbart zu dem Magneten gebunden.
    5. Zweimal spülen Sie die Beads mit 1 ml Waschpuffer jedes Mal, wie in Abschnitt 2.1.4 beschrieben. Entfernen Sie den 1,5-ml-Röhrchen aus der Magnetstange und kurz umzukehren, um die Perlen zu mischen und Waschpuffer bei jedem Waschschritt.
    6. Bewahren Sie die Antikörper-gebundenen Perlen in Waschpuffer, bis bereit, mit Schritt 2.7 fort. Die Kügelchen sollten nicht in jeder Phase des Protokolls austrocknen.
  2. Dissect Larvengewebe in PBT und übertragen seziert Gewebeeine Vertiefung der 9-Loch-Schale. Typischerweise Dissektion der optischen Loben und Augen Imaginalscheibe 100 dritte Larvenstadium bietet genügend Material für Downstream-Genexpressionsanalyse folgende Kerne Isolation.
  3. Spülen des isolierten Gewebes in Kernextraktionspuffer (10 mM HEPES-KOH, pH 7,5, 2,5 mM MgCl 2, 10 mM KCl) in einem 1,5-ml-Röhrchen. Übertragen isoliert Larvengewebe zu einer 1 ml Dounce Homogenisator (siehe Materialien PDF) auf Eis, 1 ml frisches Kernextraktionspuffer enthält. Inkubieren auf Eis für 5 min. Es ist nicht notwendig, um die Proteaseinhibitoren zuzusetzen, wenn RNA wird zu folgenden Kerne Isolierung gewonnen werden.
  4. Stören das Gewebe durch 20 Schläge mit dem losen Stampfe und dann inkubieren Sie die Probe auf Eis für 10 Minuten, damit die Zellen zu schwellen. Extrahieren Sie die Kerne aus den Zellen mit 15 Schläge mit der engen Stößel. Die Anzahl der Schläge mit der locker und fest stampfen muss für die verschiedenen Geweben und Zelltypen optimiert werden, überschüssige Homogenisierung kann dazu führen,geschert Kerne, während unzureichende Homogenisierung werden alle Atomkerne aus dem Gewebe nicht extrahieren.
  5. Filtern Sie die Homogenat, die die Kerne und Zelltrümmer enthält, durch ein 40 um Porengröße Sieb (siehe Materialien PDF), die mit der Kern Homogenisationspuffer vorgespült wurde. Sammeln Sie die gefilterten Homogenat in ein frisches Röhrchen.
  6. Sammeln Sie vor Isolation Proben für die spätere Analyse, um Kerne Ertrag, Kerne Integrität zu bestimmen und Transkript Ebenen von Zielgenen vor der Isolierung Kerne zu bestimmen.
    1. Über 50 ul des gefilterten Homogenat in ein frisches 1,5-ml-Röhrchen mit einer Pipette. Dies ist die Pre-Isolation Probe. In 500 ul Trizol-Reagenz (siehe Materialien PDF, VORSICHT), Invertzucker zu mischen, und bei -20 ° C für spätere RNA-Isolierung (Schritt 3.1).
    2. Über 20 ul des gefilterten Homogenat in ein frisches 1,5-ml-Tube.
      1. Hinzufügen DAPI in einer Endkonzentration von 0,1 ug / ml, und incUbate Probe auf Eis für 10 min.
      2. Übertragen DAPI-gefärbten Zellkernen an eine Poly-Lysin beschichtete Deckglas, und legen auf einen Objektträger. Deckglas mit klarem Nagellack.
      3. Überprüfen Sie die Kerne Integrität und Gegenwart von GFP-markierten Kerne von Interesse unter Verwendung von Fluoreszenzmikroskop. Hinweis: Es ist nicht notwendig, um die Kerne zu beheben, oder für GFP Fleck, wenn diese Folien sind recht schnell nach der Herstellung (innerhalb 24 Stunden) analysiert.
    3. Über 10 ul des gefilterten Homogenat in ein frisches 1,5-ml-Röhrchen und fügen Sie 90 ul Waschpuffer (1x PBS, pH 7,4, 2,5 mM MgCl 2). Hinzufügen DAPI in einer Endkonzentration von 0,1 ug / ml und Inkubation auf Eis für 10 min. Bestimmen Sie die Kerne Ausbeute in der Pre-Isolation Probe mit einer Zählkammer die DAPI-positiven Kerne rechnen mit Epi-Fluoreszenz unter einem 10X Luft Ziel.
  7. Legen Sie die 1,5-ml-Röhrchen mit den Antikörper-gebundenen Kügelchen (in Abschnitt 2.1.6) hergestellt in einem magnetischen Träger,und lassen sich die magnetischen Beads an der Magnet für mindestens 2 min zu binden, wie in Abschnitt 2.1.4 beschrieben. Entfernen Sie den Waschpuffer aus den Antikörper-gebundenen Perlen mit einer 1 ml-Pipette, und fügen Sie die gefilterten Homogenat aus Schritt 2,5 bis 1,5-ml-Röhrchen mit einer 1 ml Pipette.
  8. Invertieren Sie das Röhrchen vorsichtig mehrmals zu mischen, und Inkubation bei 4 ° C für 30 min mit end-over-end Aufregung. Vermeiden Sie Luftblasen in die Röhre, wenn möglich, da diese in Verklumpung der Kerne führen.
  9. Legen Sie die 1,5-ml-Röhrchen mit den Antikörper-gebundenen Perlen und Homogenat in einem Magnetständer, und lassen sich die magnetischen Beads an der Magnet für mindestens 2 min zu binden, wie in Abschnitt 2.1.4 beschrieben. Entfernen Sie das Homogenat mit der ungebundenen Fraktion Kerne mit einer 1 ml Pipette.
  10. Waschen der Probe 3x mit 1 ml Waschpuffer jedes Mal. Entfernen Sie den 1,5-ml-Röhrchen mit den Perlen, gebunden Kernen und Waschpuffer aus dem Rack und invertieren mehrmals zu mischen, dann das Rohr in der magnetischen Rack wie beschriebenin Schritt 2.9 und den Überstand mit einer 1 ml Pipette.
  11. Mit 150 ul Waschpuffer zu den Kügelchen, die den Targetkerne gebunden sein sollte. Dies ist die post-Isolierung Probe. Bereiten Proben für die Mikroskopie-Analyse und anschließende RNA-Extraktion.
    1. Über 20 ul der Post-Isolierung Probe in ein frisches 1,5-ml-Röhrchen und Fleck mit DAPI und zu analysieren, wie in Abschnitt 2.6.2 beschrieben. Zählen Sie die GFP + / DAPI + und + GFP-/DAPI Kerne durch magnetische Kügelchen eingefangen, um die Reinheit der angereicherten GFP +-Kerne in der Post-Isolierung Probe zu bestimmen.
    2. 1 ml Trizol-Reagenz, um den Rest des Post-Isolierung Probe, kehren zu mischen, und bei -20 ° C für die anschließende RNA-Isolierung (Schritt 3.1). Anmerkung: Die Proben in Trizol kann mehrere Wochen falls bei -20 ° C gelagert werden Es ist nicht notwendig, um die Kerne von den magnetischen Kügelchen vor RNA-Extraktion mit Trizol-Reagenz zu eluieren, because die Perlen nicht mit der nachfolgenden RNA-Isolierung stören.

3. Bestimmen Transcript Levels in Nuclei Isoliert von Larven Gewebe

  1. Isolieren von RNA aus der Pre-und Post-Isolierung Isolierung Proben in den Abschnitten 2.6.1 und 2.11.2 unter Verwendung des für Trizol-basierte RNA-Extraktion beschriebenen Standardprotokoll (siehe Materialien PDF) mit den folgenden Modifikationen hergestellt:
    1. Nach Fällung der RNA-Pellet, fügen 19,2 ul RNase-freies Wasser und 0,8 ul RNASecure Reagenz (siehe Materialien PDF) zum Pellet und Inkubation bei 60 ° C für 20 min auf RNAsen zu inaktivieren.
  2. Bestimmen Sie die RNA-Konzentration mit einem fluoreszierenden Farbstoff-RNA-Bindung wie der Qubit-RNA-Assay-Kit (siehe Materialien PDF) mit dem QubitR 2.0 Fluorometer nach dem Protokoll des Herstellers.
  3. Synthese von cDNA unter Verwendung einer reversen Transkriptase Verstärkung wie der EpiScript Reverse Transkriptase-Kit und oligodT Primer nach Herstellerangaben. Anmerkung: In der Regel werden 50 bis 100 ng RNA erzeugt ausreichend cDNA durchzuführen multiplen Genexpression analysiert. Äquivalente Mengen von Pre-und Post-Isolation RNA-Isolation verwendet, um cDNA zu erzeugen.
  4. In 180 ul Nuklease-freies Wasser auf die 20 ul cDNA-Probe, um diese 10-fach vor der quantitativen Echtzeit-PCR (qPCR) Analyse zu verdünnen. Diese Verdünnung ist ein wichtiger Schritt, denn unverdünnten cDNA-Proben können die qPCR hemmen.
  5. Bereiten Sie eine qPCR Master Mix mit Polymerase und dNTPs, jeweils von Vorwärts-und Rückwärts-4 pmol Primer, gebildet mit sterilem Wasser auf die endgültige Reaktionsvolumen von 20 ul.
    1. Gestalten Sie qPCR-Primer, um Gene, die voraussichtlich in der Zelltyp von Interesse ausgedrückt werden gezielt und in der Entwicklungsphase, bei der das Gewebe gesammelt. Design-Primer eine Intron überspannen, wenn möglich, so daß genomische undcDNA-PCR-Produkten unterschieden werden. Hinweis: Wenn das Genexpressionsprofil der Zielzelltyp nicht bekannt ist, gegen eGFP Primern, die spezifisch in dem markierten Keimpopulation exprimiert werden soll, kann verwendet werden, um das Protokoll für einen bestimmten Zelltyp und Gewebe (Tabelle 1) zu optimieren.
  6. Bestimmen Sie die relativen Transkript-Gehalte von jedem Gen von Interesse in der Pre-und Post-Isolierung Isolierung Proben durch Vergleich mit einer Verdünnungsreihe von cDNA aus dem gesamten Gewebe hergestellt. Transcript Ebenen von Zielgenen sollte zu einem Referenzgens wie Rpl32 (oder besser mehrere Referenzgene) normalisiert werden.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Der Repo-GAL4-Treiber (Bloomington Bestandsnummer 7415) ist speziell in Gliazellen im Nervensystem Drosophila an mehreren Entwicklungsstufen 18 ausgedrückt. Die Fliegen wurden erzeugt, stabil exprimieren UAS-EGFP :: Msp-300-KASH unter der Kontrolle des Repo-GAL4-Treiber mit Standard-genetische Techniken. Um das Expressionsmuster des Transgens EGFP :: KASH in dieser entfernt zu charakterisieren, wurde das Muster der GFP-Expression in den eingeschnittenen Lappens und Augenoptik Imaginalscheibe vom dritten Larvenstadium mittels konfokaler Mikroskopie untersucht. Dissected Gewebe wurden mit DAPI gegengefärbt, um DNA und mit α-chaoptin 19 markieren, um Photorezeptor Axone (mAb24B10 beschriften, siehe Materialien PDF). 1A zeigt, dass der Repo-GAL4 angetrieben EGFP :: KASH Transgen in Glia in den optischen Loben und Augen Imaginalscheibe in der erwarteten Expressionsmuster ausgedrückt. Bei starker Vergrößerung,EGFP-Expression wird in einem kreisförmigen Muster rund um das DAPI-positiven DNA, die mit Atom-Umschlag Lokalisation des EGFP :: KASH-Tag (Abbildung 1B) beobachtet. EGFP-Expression kann sowohl im festen und im nicht fixierten Geweben detektiert werden, ohne die Notwendigkeit einer Signalverstärkung unter Verwendung eines Antikörpers gegen GFP, GFP-Antikörper gegen nicht verwendet wurden, um das EGFP :: KASH Expression in den in den Fig. 1 und 2 dargestellten Bilder zu visualisieren. Zu bestimmen, ob das EGFP :: KASH Transgen unspezifisch in allen anderen Geweben in Drosophila-Larven exprimiert wird, wurde die GFP-Expression in der gesamten dritten Larvenstadium mit einem Fluoreszenzmikroskop seziert. Insbesondere unspezifische Expression des EGFP :: KASH Transgen wurde in hohen Konzentrationen in den Speicheldrüsen der dritten Larvenstadium beobachtet. Dies zeigt, dass der Repo-GAL4 Fahrer hat Aktivität in einigen anderen als Gliazellen im Larvenstadium der Entwicklung Zelltypen. So gezielt isolieren glial-Kerne wurden die optischen Loben und Augen Imaginalscheibe aus Drittlarvenstadium mit Dissektion vor der Homogenisierung und Affinität-Isolierung isoliert.

Um zu bestätigen, dass dieses Protokoll ist geeignet für die Gewinnung der Kerne von Drosophila-Gewebe und den Prozentsatz der markierten Kerne in einem bestimmten Gewebe, der Pre-Isolierung Stichprobe (Abschnitt 2.6.2) aus Homogenaten von der Optik und Augenlappen erhalten vorliegende Schätzung Imaginalscheibe Repo-GAL4, UAS-EGFP :: Msp-300-KASH dritten Larvenstadium untersucht. 2A zeigt ein repräsentatives Bild der Pre-Isolierung Probe unter Verwendung der konfokalen Mikroskopie erhalten. In diesem Bild ist die Anwesenheit von Kernen durch DAPI-positive Ereignisse angezeigt. Eine kleine Anzahl von spärlich verstreut GFP-positive, DAPI-positiven Gliazellen Kerne werden auch beobachtet. Wir schätzen, dass die GFP-positiven Kerne machen weniger als 2% der Gesamtkeimpopulation in diesemProbe (2A). Die Gesamtausbeute aus Kernen optischen Loben und Augen Imaginalscheiben, die von 100 Larven wurden seziert wurde für die pre-Isolierung Probe wie in Abschnitt 2.6.3 (Tabelle 2) beschrieben, bestimmt. Ein typisches Pre-Isolation Probe von 100 seziert optischen Loben und Augen Imaginalscheiben zwischen 0,8 und 1,2 x 10 7 Kerne enthalten, von denen etwa 2% waren GFP-positiv. 2B zeigt ein repräsentatives Bild der DAPI-positiven Kerne in einem definierten Bereich der Zählkammer. Beachten Sie, dass die Kerne intakt sind, und unter den Extraktionsbedingungen in dem Protokoll verwendet wird (2A und 2B) für eine einheitliche kreisförmige Form.

Um festzustellen, ob dieses Protokoll zur Isolierung und / oder stark bereichern bestimmte Bevölkerungsgruppen von markierten Kerne von Gewebe, die Zellpopulationen enthalten, gemischt werden, waren Einsatz α-GFP-Antikörper-beschichteten magnetischen Kügelchend markierten Kerne aus Homogenaten von der Optik und Augenlappen Imaginalscheibe von 100 Repo-GAL4, UAS-EGFP :: Msp-300-KASH dritten Larvenstadium erhalten isolieren. In 2C und 2D, kann gesehen werden, dass die EGFP :: KASH getaggt Gliazellen Kerne binden an die α-GFP-beschichteten magnetischen Kügelchen und werden in der post-Isolierung Stichprobe (Abschnitt 2.11.1) nach Magnetseparation beobachtet. Obwohl die magnetischen Kügelchen zeigen einige Autofluoreszenz in der GFP-Kanal, können diese leicht von Kügelchen gebundenen Kernen durch ihre geringere Größe (2,8 um für die magnetischen Kügelchen gegenüber ca. 5 um für die Kerne) und das Fehlen von DAPI-Färbung unterschieden werden. Die GFP + / DAPI + Kerne entfallen mehr als 95% der DAPI positive Ereignisse in der Post-Isolierung Probe. Somit ist die Ziel getaggt Keimpopulation sind stark in der Post-Isolierung Probe relativ zu der Pre-Isolierung angereichertProbe. Die Mehrheit der Kerne in der Post-Isolierung Probe zeigen starke Kern-Umschlag lokalisierte GFP-Fluoreszenz und werden in der Regel von Perlen umgeben. Es ist jedoch möglich, dass eine kleine Anzahl von Kernen ohne Kennung auch in dieser Probe vorhanden sein. Obwohl die Ergebnisse in Fig. 2C und in der Genexpressionsanalyse in Fig. 3 (siehe unten) zeigen, dass das Ziel markiert Gliazellen Keimpopulation ist stark angereichert, die Möglichkeit, dass einige Kerne von einigen anderen nicht-spezifische Zelltypen sind ebenfalls in der Probe vorhanden kann nicht ausgeschlossen werden. Es wird empfohlen, dass die Nutzer zu optimieren dieses Protokoll für ihre besonderen Zelltyp und Gewebe von Interesse, um die Anreicherung der Zielkeimpopulation zu maximieren und unspezifische Kerne beseitigen verbindlich. Insbesondere ist das Verhältnis des Ausgangsmaterials relativ zu Antikörper-Kügelchen und wahrscheinlich wichtig für eine optimale Anreicherung von Zielkeimen zu sein. Aus diesem Grund sind die Bereiche der GesamtKerne in unseren typischen Vor-Isolation Proben vorhanden Nummern sind in Tabelle 2 dargestellt. Basierend auf den Gesamtkeimzahlen in der Pre-Isolation Probe vorhanden, und dem geschätzten Anteil von Gliazellen in der gemischten Bevölkerung von der Optik und Augenlappen Imaginalscheibe wurde die maximale Ausbeute Kerne in der Post-Isolierung Probe voraussichtlich zwischen 1,6 sein x 10 5 und 2,4 x 10 5 Kerne. , Mit dem Hämocytometer die Kerne Ausbeute zu bestimmen, wie in Schritt 2.6.3 beschrieben, die in der Probe nach der Trennung erhaltenen tatsächlichen Kerne Ausbeute war jedoch zwischen 1,3 x 10 4 und 2,7 x 10 4 Kerne. Diese Kerne Renditen stellen sehr grobe Schätzungen, da die in der Post-Isolierung Probe vorhanden Perlen erscheinen, um genaue Belastung des Hämozytometers beeinflussen. Einige GFP-positive Keime in der ungebundenen Homogenat beobachtet, was anzeigt, dass nicht alle GFP-positive Kerne in den sreichlich binden an die Perlen effizient unter den in diesem Protokoll verwendeten Bedingungen. Die Erhöhung der Zeit der Bindung oder Durchführung sequentieller Isolationsschritte können möglicherweise die diesen Ertrag, aber dies könnte auf Kosten der beiden RNA-Reinheit und Integrität zu kommen. Verwendung der in diesem Protokoll beschriebenen Bedingungen können ausreichende Mengen an RNA in der Probe nach der Trennung der nachgeschalteten Genexpressionsanalyse nach qRT-PCR (Tabelle 2) erhalten werden. Somit ist dieses Protokoll in der Lage, schnell und stringent Isolieren Targetkerne aus Geweben, die gemischte Zellpopulationen enthalten. Darüber hinaus ist es in der Lage, spezifisch zu isolieren Targetkerne, die nur einen geringen Anteil, weniger als 5% der Zellen in einer gegebenen Population zu bilden.

Um weiter zu bestätigen, dass die Post-Isolierung Probe wurde dringend für unsere Ziel Gliazellen Keimpopulation angereichert ist, die Ebenen von Transkripten für 4 verschiedene Gene, die in der Vor-Isolation Post-Isolierung Proben wurden mittels RT-qPCR verglichen. Die Transkriptspiegel elav, nrv2 und eGFP wurden in den zwei Proben bestimmt und normiert auf die Referenz-Gen, Rpl32, die auf gleichwertigen Stufen in Gliazellen und in der Umgebung des zentralen Nervensystems (Abbildung 3) ausgedrückt wird. Das fache Differenz in der Post-Isolierung Probe wird in Bezug auf die Vor-Isolation-Probe, die auf eins gesetzt wird angezeigt. In Abbildung 3 sind die Post-Isolation Beispiel zeigt deutlich niedriger Transkript Ebenen der neuronalen-spezifische Gen elav in Bezug auf die Vor-Isolation Probe. Dies zeigt, dass Zellkerne von neuronalen Zellen unterrepräsentiert sind in der Post-Isolierung Probe. Im Gegensatz dazu höher Transkript Ebenen sowohl der Glia-angereicherten nrv2 Gen 10 und eGFP in der Post-isola vorhanden sindtion Probe relativ zu der Pre-Isolation Probe. Dieses Ergebnis zeigt, dass die Post-Isolierung Probe ist sehr für die Ziel Gliazellen Kerne Bevölkerung bereichert. Es ist wichtig zu beachten, dass die Transkriptionsniveaus in diesem Protokoll gemessen repräsentieren Kern Abschriften, und sind daher wahrscheinlich Ebenen der aktiven Transkription statt Steady-State-mRNA anzuzeigen. Reproduzierbare Ausdruck Repo wurde weder in unserem Pre-oder Post-Isolierung Isolierung Proben nachgewiesen, was darauf hindeutet, dass die Gal4 Protein durch die Repo-GAL4-Treiber exprimiert wird, kann nach der aktiven Transkription des endogenen Repo-Gen bestehen aufgehört hat. Dies steht im Einklang mit den Ergebnissen anderer Studien, in denen Kerne mit der twi-Promotor beschriftet nicht angereicherten Ebenen der twi Transkripte zeigen, vielleicht aufgrund der Unterschiede in der Entwicklungs Zeitpunkt der Transkription gegenüber Proteinstabilität 8. Taken zusammen, zeigen diese Ergebnisse, dass das beschriebene Protokoll kann erfolgreich verwendet werden hoch bereichern Targetkerne aus Geweben, die gemischten Populationen von Zellen enthalten, und dass die isolierten Kerne sind für die Genexpressionsanalyse.

Figur 1
Fig. 1 ist. Expressionsmuster von Repo-GAL4, UAS-EGFP :: Msp-300-KASH Linie fliegen. (A) Im dritten Larvenstadium, Repo-GAL4 treibt die Expression des UAS-EGFP :: Msp-300-KASH Transgen in Gliazellen in der Optik Lappens, Augenstiel (os) und Augen Imaginalscheibe (ed). Die Kernhülle in Gliazellen mit EGFP :: KASH (grün) markiert. R1 - R8 Photorezeptorzelle Axone sind mit α-chaoptin (mAB24B10, rot) zum Vergleich gekennzeichnet sind, und DNA ist staINED mit DAPI (lila). GFP-markierten Gliazellen Kerne sind entlang der in der optischen Loben (durch Pfeile markiert) Lamina (la) sichtbar. Maßstabsbalken, 50 um. (B) Höhere Vergrößerung Bild der Lamina Ganglien des optischen Loben, die EGFP :: KASH enthält beschriftet Glia-Zellkerne. Maßstabsbalken, 50 um. Konfokale Bilder wurden entweder mit einem erworbenen   40X / 1,30 Öl oder ein   20X / 0,75 Ölimmersionsobjektiv und mit Anregung / Emissionswellenlängen von 408 nm nm/425-475 (DAPI), 488 nm nm/525-550 (GFP); nm/595-620 561 nm (Alexa 5,6,8 ). Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 2
2. Charakterisierung der Kernein "pre-Isolation" und "post-Isolation"-Proben. (A) Repräsentatives Bild von einem Repo-GAL4, UAS-EGFP :: Msp-300-KASH Pre-Isolierung analysierten Probe mit einem X 20 / 0,75 Ölimmersionsobjektiv und Standard Konfokalmikroskop. DNA wird mit DAPI (blau) gefärbt, und EGFP :: KASH getaggt Glia-Zellkerne sind grün markiert (durch Pfeile markiert). Maßstabsbalken, 50 um. (B) Repräsentative Bild der DAPI-gefärbten Zellkernen von einer Vor-Isolation Probe auf einer Zählkammer mit einem X 10 Luft Ziel und Standard Epifluoreszenzmikroskop. Hämozytometers Netze sind in hellen grau dargestellt. Nur DAPI-positiven Kerne werden in diesem Bild gezeigt, wie GFP-Fluoreszenz war nicht im Rahmen dieses Ziels auf der Epifluoreszenzmikroskop sichtbar. (C) Vertreter Bild aus einem Repo-GAL4, UAS-EGFP :: Msp-300-KASH post-Isolierung Probeanalysiert, wie es für Panel A beschrieben. Die isolierte EGFP :: KASH getaggt Gliazellen Kerne (durch Pfeile markiert) für DAPI-Färbung positiv, und werden von den Perlen, umgeben, die Autofluoreszenz in geringen Konzentrationen in der GFP-Kanal. Maßstabsbalken, 50 um. (D) Höhere Vergrößerung Bild eines typischen isolierten EGFP :: KASH getaggt Gliazellen Kerne (mit Pfeil markiert), die durch Perlen umgeben. Maßstabsbalken, 5 um. Bitte hier klicken um eine größere Version dieser Figur zu sehen.

Fig. 3
3. Repräsentative qRT-PCR-Daten von "pre-Isolation" und "post-Isolation"-Proben. Transcript Ebenen der Zielgene wurden durch qRT-PCR von Pre-isol bestimmtaus Repo-GAL4, UAS-EGFP :: Msp-300-KASH optischen Loben und Augen Imaginalscheiben erhalten ation und Post-Isolierung Proben. Alle Transkriptspiegel werden Rpl32 Transkriptspiegel normalisiert, und die Pre-Isolation Probe für jedes Gen ein Ziel gesetzt. Repräsentative Ergebnisse eines biologischen Experiments sind für die folgenden Gene gezeigt: elav, nrv2 und eGFP.

Gen Primer Sequenz (5 '-3') Größe PCR-Produkt (bp)
eGFP GAGGGATACGTGCAGGAGAG 102
GATCCTGTTGACGAGGGTGT
nrv2 GGCTGGTTGTAGTCGCAGTT 125
GGCACCCAACACGAGAACTA
elav GCACCATTCGGAGCAATAAT 153
TGTGCAGCTGGATGGTGTAG
Rpl32 GCTAAGCTGTCGCACAAATG 160
CGTTGTGCACCAGGAACTT

Tabelle 1. Primer für die qRT-PCR-Analyse verwendet.

Gesamtzahl der Kerne in der Vor-Isolation Probe Geschätzte Gesamtzahl der Kerne in post-Isolierung Probe RNA-Ausbeute aus der Post-Isolierung Probe (ng)
0,8 bis 1,2 x 10 7 1,3 bis 2,7 x 10 4 160-220 ng

Tabelle 2. Repräsentative Kerne und RNA-Ausbeuten erhalten.Typische Bereiche der Kerne und RNA-Ausbeuten von Pre-und Post-Isolierung Isolierung Proben von 100 seziert optischen Loben und Augen Imaginalscheiben aus dem Repo-GAL4, UAS-EGFP :: Msp-300-KASH-Genotyp, erhalten, in der Glia-Zellen mit der Bezeichnung EGFP :: KASH. Kerne wurden wie in 2.6.3 beschrieben, quantifiziert und die RNA wurde, wie in 3.1.2 beschrieben, quantifiziert.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu offenbaren.

Materials

Name Company Catalog Number Comments
Anti-chaoptin antibody (mouse, monoclonal) Developmental Studies Hybridoma Bank mAB24B10
Anti-GFP antibody (mouse, monoclonal) Roche 11814460001 This specific antibody is recommended for this protocol. However, alternative antibodies could also be used.
2x Bullseye EvaGreen qPCR Mastermix with ROX MidSci BEQPCR-R
DAPI (4',6-diamidino-2-phenylindole, dihydrochloride salt) Biotium 40011
Dounce Homogenizer (1 ml) VWR 62400-595
Dumont #5 Tweezers, 11 cm World Precision Instruments 14095
Dynabeads Protein G for Immunoprecipitation Invitrogen 10003D This specific brand of magnetic beads is recommended for this protocol.
EpiScript Reverse Transcriptase Epicentre ERT12910K http://www.epibio.com/docs/default-source/protocols/episcript-reverse-transcriptase.pdf
Falcon cell strainers, 40 μm pore size VWR 21008-949 Alternative pore sizes could be used, depending on the size of the target cell nuclei.
Magnetic stand (8 x 1.5 ml tubes) Millipore LSKMAGS08 
Mini tube rotator Genemate H-6700
Qubit starter kit Life Technologies Q32871 Similar fluorescence-based methods for quantifying RNA yield could be used. http://tools.invitrogen.com/content/sfs/manuals/mp32852.pdfZ
RNAsecure (Ambion) Life Technologies AM7010 The use of this reagent to inactivate RNAses is optional.
RT-PCR machine Thermal Cycler BioRad CFX Connect Thermal Cycler
Siliconized 9-well glass plate Hampton Research HR3-134
Stereomicroscope Fluorescence Adapter (Royal Blue (440-460 nm) excitation + yellow barrier Nightsea This adaptor enables GFP fluorescence to be examined using a typical dissecting microscope (eg Nikon)
StereoZoom Microscope 83604 Set with 10X Wide Field Eyepieces and Universal Boom Stand Nikon SMZ 745
Thermal Cycler BioRad T100
Trizol reagent Life Technologies 15596018 CAUTION; Alternative RNA extraction methods can be used. http://tools.invitrogen.com/content/sfs/manuals/trizol_reagent.pdf
Tween 20 Amresco 0777-1L

DOWNLOAD MATERIALS LIST

References

  1. Weake, V. M., et al. Post-transcription initiation function of the ubiquitous SAGA complex in tissue-specific gene activation. Genes Dev. 25, 1499-1509 (2011).
  2. Bonn, S., et al. Cell type-specific chromatin immunoprecipitation from multicellular complex samples using BiTS-ChIP. Nat. Protoc. 7, 978-994 (2012).
  3. Haenni, S., et al. Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq. Nucleic Acids Res. 40, 6304-6318 (2012).
  4. Barthelson, R. A., Lambert, G. M., Vanier, C., Lynch, R. M., Galbraith, D. W. Comparison of the contributions of the nuclear and cytoplasmic compartments to global gene expression in human cells. BMC Genom. 8, 340 (2007).
  5. Zhang, C., Barthelson, R. A., Lambert, G. M., Galbraith, D. W. Global characterization of cell-specific gene expression through fluorescence-activated sorting of nuclei. Plant Physiol. 147, 30-40 (2008).
  6. Deal, R. B., Henikoff, S. The INTACT method for cell type-specific gene expression and chromatin profiling in Arabidopsis thaliana. Nat. Protoc. 6, 56-68 (2011).
  7. Deal, R. B., Henikoff, S. A simple method for gene expression and chromatin profiling of individual cell types within a tissue. Dev Cell. 18, 1030-1040 (2010).
  8. Steiner, F. A., Talbert, P. B., Kasinathan, S., Deal, R. B., Henikoff, S. Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling. Genom. Res. 22, 766-777 (2012).
  9. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, 401-415 (1993).
  10. Henry, G. L., Davis, F. P., Picard, S., Eddy, S. R. Cell type-specific genomics of Drosophila neurons. Nucleic Acids res. 40, 9691-9704 (2012).
  11. Starr, D. A. KASH and SUN proteins. Curr Biol. 21, 414-415 (2011).
  12. Fischer, J. A., et al. Drosophila klarsicht has distinct subcellular localization domains for nuclear envelope and microtubule localization in the eye. Genetics. 168, 1385-1393 (2004).
  13. Patterson, K., et al. The functions of Klarsicht and nuclear lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye. Mol. Biol. Cell. 15, 600-610 (2004).
  14. Yu, J., et al. The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Dev. Biol. 289, 336-345 (2006).
  15. Bischof, J., Maeda, R. K., Hediger, M., Karch, F., Basler, K. An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc. Natl. Acad. Sci. U.S.A. 104, 3312-3317 (2007).
  16. Kracklauer, M. P., Banks, S. M., Xie, X., Wu, Y., Fischer, J. A. Drosophila klaroid encodes a SUN domain protein required for Klarsicht localization to the nuclear envelope and nuclear migration in the eye. Fly. 1, 75-85 (2007).
  17. Markstein, M., Pitsouli, C., Villalta, C., Celniker, S. E., Perrimon, N. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat. Genet. 40, 476-483 (2008).
  18. Sepp, K. J., Schulte, J., Auld, V. J. Peripheral glia direct axon guidance across the CNS/PNS transition zone. Dev. Biol. 238, 47-63 (2001).
  19. Fujita, S. C., Zipursky, S. L., Benzer, S., Ferrus, A., Shotwell, S. L. Monoclonal antibodies against the Drosophila nervous system. Proc. Natl. Acad. Sci. U.S.A. 79, 7929-7933 (1982).
Affinity-basierte Isolierung von Tagged Kerne aus<em&gt; Drosophila</em&gt; Tücher für Genexpressionsanalyse
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).More

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter