Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

L'isolamento a base di affinità di Tagged Nuclei di doi: 10.3791/51418 Published: March 25, 2014

Summary

Tessuti Drosophila spesso contengono una miscela eterogenea di tipi cellulari. Per esaminare l'espressione genica in specifici tipi cellulari da un particolare tessuto, i nuclei possono essere geneticamente marcato e successivamente isolate utilizzando un approccio basato affinità. Isolato nuclei possono essere utilizzate per applicazioni a valle come l'analisi dell'espressione genica e della cromatina.

Abstract

Tessuti embrionali e larvali Drosophila melanogaster spesso contengono una miscela altamente eterogeneo di tipi di cellule, che può complicare l'analisi di espressione genica in questi tessuti. Così, per analizzare profili di espressione genica specifica-cellulari da tessuti di Drosophila, potrebbe essere necessario isolare specifici tipi cellulari con elevata purezza e con rese sufficienti per applicazioni a valle come profiling trascrizionale e cromatina immunoprecipitazione. Tuttavia, la morfologia cellulare irregolare in tessuti come il sistema nervoso centrale, insieme con la rara popolazione di specifici tipi cellulari in questi tessuti, può porre problemi per i metodi tradizionali di isolamento cellulare come microdissezione laser e cella fluorescenza-attivato (FACS) . Qui, un approccio alternativo alla caratterizzazione dei profili di espressione genica specifica delle cellule utilizzando a base di affinità isolamento dei nuclei con tag, piuttosto che cellule intere, è descritto. Nuclei in c specificatipo ell di interesse sono geneticamente etichettati con un tag EGFP busta localizzato nucleare utilizzando il sistema di espressione binario Gal4/UAS. Questi nuclei EGFP-tag possono essere isolate utilizzando anticorpi contro GFP che sono accoppiati a biglie magnetiche. L'approccio descritto in questo protocollo consente un isolamento uniforme di nuclei di specifici tipi cellulari nel sistema nervoso centrale larvale Drosophila ad elevata purezza ed a livelli sufficienti per l'analisi di espressione, anche quando questi tipi cellulari rappresentano meno del 2% della popolazione totale di cellule nella tessuto. Questo approccio può essere utilizzato per isolare i nuclei da un'ampia varietà di Drosophila embrionale e tipi cellulari larvali utilizzando specifici driver di GAL4, e può essere utile per isolare i nuclei da tipi di cellule che non sono adatti per FACS o microdissezione laser.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tessuti Drosophila come il sistema nervoso centrale contengono una miscela complessa di tipi cellulari. Così, per analizzare profili di espressione genica specifica-cellulari da tessuti di Drosophila, è prima necessario isolare una popolazione omogenea di cellule specifiche in quantità sufficienti per consentire applicazioni a valle. Metodi per isolare cellule da tessuti intatti includono microdissezione laser e cella fluorescenza-attivato (FACS) di cellule intere. Mentre FACS è stato usato per isolare cellule e nuclei da embrioni di Drosophila e da Caenorhabditis elegans per l'espressione genica e cromatina profiling 1-3, FACS e microdissezione laser possono essere difficili da eseguire con successo nei tessuti che contengono tipi cellulari altamente mescolati tra loro o che le cellule contengono con morfologia irregolare, come i neuroni. Per superare questa difficoltà, nuclei piuttosto che cellule possono essere isolate da specifici tipi cellulari e utilizzati per la successiva generazionee profili di espressione. È importante sottolineare che, in base microarray-mRNA analisi di espressione utilizzando campioni di RNA nucleari mostra i risultati generalmente comparabili con quelli eseguiti utilizzando RNA totale 4, 5. Inoltre, l'analisi di espressione genica utilizzando RNA nucleare è stato usato con successo per studiare l'espressione genica in organismi multipli compresi C. elegans, Arabidopsis thaliana, Drosophila, e gli esseri umani 4, 5 2, 3.

Diversi approcci sono stati recentemente descritto per l'isolamento di specifiche popolazioni di nuclei etichettati da tessuti di Drosophila che sono adatti per l'analisi di espressione genica e / o immunoprecipitazione della cromatina. L'isolamento lotto di cromatina tessuto-specifico per il metodo di immunoprecipitazione (bit-Chip) utilizza FACS per isolare nuclei fissati sulla base di cellula-tipo particolare espressione di GFP nucleare localizzata 2. Questo approccio è stato successfully utilizzato per analizzare la distribuzione delle modificazioni degli istoni e fattori di trascrizione con cromatina immunoprecipitazione di nuclei isolati dal mesoderma di Drosophila embrioni 2. Tuttavia, gli approcci basati FACS possono essere meno adatti per isolare nuclei etichettati che costituiscono solo una piccola parte di una popolazione mista a causa della maggiore tempo liste necessario avere numeri adatti per applicazioni a valle. Per superare queste limitazioni, diversi gruppi hanno utilizzato tecniche di isolamento a base di affinità per purificare nuclei che sono etichettati con un epitopo specifico in un particolare tipo di cellula. L'isolamento dei nuclei contrassegnati in tipi cellulari specifici metodi (intatto) sviluppati per l'utilizzo in Arabidopsis thaliana 6, 7 è stato recentemente adattato per l'uso in Drosophila 8. In questo metodo, una proteina dell'involucro fusione nucleare che è un substrato per in vivo biotinylation è coexpressed con l'Escherichia coli biotina ligasi Bira in tipi cellulari specifici. Nuclei marcati con biotina possono essere successivamente purificati da popolazioni miste che utilizzano basato streptavidina-isolamento affinità. Usando questo approccio, i nuclei sono stati etichettati con successo e isolato dal mesoderma di embrioni di Drosophila in cui una proteina dell'involucro fusione nucleare è stato espresso sotto il controllo di un potenziatore specifico mesoderma 8. Gli autori hanno anche generate proteine ​​dell'involucro di fusione nucleare che possono essere espressi in qualsiasi tipo di cellula sotto il controllo della sequenza regolatrice GAL4, UAS 9. Questo approccio è in grado di isolare rapidamente sottoinsiemi di nuclei etichettati da popolazioni miste, ma richiede tre costrutti transgenici separati e può quindi essere inadatto per applicazioni particolari genetici. Recentemente, un approccio è stato descritto in cui SUN (S AD1 e C-84 ONU)-dominio contenente proteine ​​che localizzano alla membrana interna dell'involucro nucleare sono stati contrassegnati conproteine ​​fluorescenti ed espresso sotto il controllo del sistema Gal4/UAS 10. I nuclei sono stati isolati in presenza di detergente non ionico per rimuovere la membrana esterna della membrana nucleare, e purificati per affinità utilizzando biglie magnetiche accoppiate ad anticorpi anti-GFP. Questo approccio è stato utilizzato con successo per isolare piccole popolazioni di nuclei etichettati da specifici sottotipi neuronali all'interno del cervello adulto di Drosophila 10.

Qui, un protocollo per l'isolamento di nuclei etichettati da una popolazione mista di cellule di Drosophila tessuto larvale è descritto. Questo metodo è stato sviluppato in modo indipendente, ma è simile a quello descritto da Henry et al. 10 In primo luogo, i nuclei sono stati etichettati con un tag fluorescente che viene espresso solo in specifici tipi cellulari in Drosophila melanogaster per facilitare il successivo isolamento di nuclei contrassegnate da popolazioni miste utilizzando un approccio basato affinità. Per etichettare nuclei,il dominio KASH (K larsicht / A nc-1 / S ino h omologia) è stato utilizzato. Il dominio KASH è un dominio transmembrana che localizza alla membrana esterna della busta nucleare, in parte attraverso le interazioni con SUN-dominio contenenti proteine ​​all'interno dello spazio perinucleare 11. Il dominio KASH C-terminale delle proteine ​​come Drosophila Msp-300 e Klarsicht ancore queste proteine ​​alla membrana nucleare esterno, mentre i loro domini N-terminale interagiscono con proteine ​​del citoscheletro actina o come microtubuli nel citoplasma 12-14. Costrutti sono stati generati in cui il dominio KASH di Drosophila Msp-300 è stata fusa al C-terminale della EGFP, sotto il controllo della sequenza regolatrice GAL4, UAS nel vettore pUAST-attB 15, 16. Utilizzando integrazione sito-specifica phiC31, sono stati generati moscerini transgenici in cui le UAS-EGFP :: Msp-300 KASH transgene è stato inserito nel attP2 loci sul cromosoma3L 17. Il UAS-EGFP :: Msp-300 KASH aria può essere attraversato con le mosche che esprimono il conducente GAL4 in un particolare tipo di cellula, con conseguente espressione mirata di EGFP sulla membrana nucleare esterno nel tipo cellulare di interesse. Nuclei etichetta possono essere purificati da popolazioni di cellule miste che utilizzano anticorpi contro GFP accoppiati a sfere magnetiche. In questo approccio, l'uso di detergente non ionico non è necessaria perché il tag EGFP è localizzato sul lato citoplasmatico della membrana nucleare esterno, ed è quindi accessibile agli anticorpi.

Il protocollo descritto di seguito può essere utilizzata per isolare / arricchire nuclei EGFP-etichettata specifici tipi cellulari in Drosophila tessuti larvali, per quantificare la purezza e resa di nuclei isolati, e per estrarre RNA nucleare adatto per trascrizione inversa reazione polimerasica a catena quantitativa (qRT -PCR) analisi di espressione genica. L'isolamento e l'affinità purificazione dei nuclei (esclusi Tissue dissezione) può essere eseguito in meno di un'ora. I risultati sono presentati mostrando che i nuclei gliali possono essere isolati con successo dal lobo ottica larvale e occhio disco immaginale, e utilizzati per la successiva analisi di espressione genica. Si prevede che questo approccio possa essere utile per l'isolamento / arricchimento di nuclei etichettati da tessuti embrionali e larvali in cui le cellule bersaglio costituiscono meno del 5% della popolazione totale. Tutte le scorte Drosophila e plasmidi ottenuti da questo studio sono disponibili su richiesta degli autori.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Generazione e caratterizzazione di EGFP :: KASH Drosophila

  1. Autista Croce Gal4 vola UAS-EGFP :: Msp-300 KASH vola. In alternativa, mosche ricombinanti che portano sia il driver GAL4 e il transgene UAS-EGFP :: Msp-300 KASH possono essere generati utilizzando tecniche genetiche standard. Questo secondo approccio è vantaggioso se sono necessarie grandi quantità di progenie.
  2. Caratterizzare l'espressione del marcatore EGFP :: KASH utilizzando tecniche di microscopia standard. Nota: espressione EGFP può essere osservato mediante tecniche di microscopia normali in sezionati, fissi tessuti di Drosophila, o in tutta larve, e non richiede l'uso di un anticorpo.
    1. Determinare il modello di espressione della EGFP :: marcatore KASH in tutto l'organismo sotto un microscopio a fluorescenza dissezione (vedi Materiali PDF). Nota: Molti piloti GAL4, compreso il conducente repo-GAL4 illustrato nella figura 1, mostra nmodelli onspecific di espressione in altri tessuti larvali come la ghiandola salivare (vedi risultati).
    2. Analizzare il pattern di espressione EGFP :: KASH nel tessuto sezionato di interesse utilizzando la microscopia confocale.
      1. Fissare il tessuto di interesse utilizzando formaldeide ad una concentrazione finale del 4%, e macchia DNA utilizzando DAPI ad una concentrazione finale di 0,1 mg / ml di visualizzare la localizzazione della EGFP :: KASH tag rispetto al DNA.
      2. Acquisire immagini utilizzando un obiettivo 40X / 1,30 olio per immersione o un obiettivo 20X / 0,75 olio di immersione, a seconda delle dimensioni del tessuto di interesse. Le seguenti condizioni di eccitazione / emissione possono essere usate per l'acquisizione delle immagini: 408 nm/425-475 nm (DAPI); 488 nm / 525-550 nm (GFP).

2. Isolare Nuclei di Drosophila larvali tessuti

  1. Preparare attrezzature per la dissezione dei tessuti larvale e successivo isolamento nuclei. Si noti cheinteri embrioni dechorionated potrebbero anche essere utilizzati come materiale di partenza se desiderato. Si raccomanda di usare tessuti larvali parzialmente sezionato anziché intero larve se il tipo cellulare di interesse è presente in un tessuto specifico quale il disco immaginale. Questo riduce il legame non specifico, ed elimina anche i problemi che possono essere causati da espressione di alcuni driver GAL4 nelle cellule non bersaglio.
    1. Preparare due paia di pinze taglienti (vedi Materiali PDF), una lastra di vetro siliconato 9-bene (vedi Materiali PDF) e PBT (1x PBS, pH 7.4, 0.1% Tween-20).
    2. Prebind l'anticorpo GFP alle biglie magnetiche. Questo passaggio deve essere avviato prima di iniziare la dissezione. Aggiungere 10 ml di biglie magnetiche (Invitrogen, vedere Materiali PDF) e 2 mg di anticorpo GFP (Roche, vedi Materiali PDF) a 400 ml di tampone di lavaggio (1x PBS, pH 7,4; 2,5 mM MgCl 2) in una provetta da 1,5 ml . La quantità di perline e anticorpo utilizzato può essere ottimizzato se necessario, in base alla quantità di destinazione nel samPLE e l'affinità di legame dell'anticorpo ai talloni.
    3. Incubare le perline e anticorpo con rotazione per almeno 30 minuti a temperatura ambiente.
    4. Posizionare il tubo da 1,5 ml contenente le perline e anticorpi nel rack magnetico (vedi Materiali PDF) e permettere le perle di legarsi magnetico per circa 1-2 min. Rimuovere il surnatante contenente l'anticorpo non legato e tampone di lavaggio usando una pipetta 1 ml. Le perle resteranno vincolati alla parete della provetta da 1,5 ml sul lato adiacente al magnete.
    5. Sciacquare le perle due volte con 1 ml di soluzione di lavaggio ogni volta come descritto nella sezione 2.1.4. Rimuovere la provetta da 1,5 ml dal rack magnetico e invertire brevemente per mescolare le perline e tampone di lavaggio durante ogni fase di lavaggio.
    6. Conservare le perle anticorpo legato a tampone di lavaggio fino al momento di continuare con la fase 2.7. Le perle non dovrebbe essere permesso di asciugare in qualsiasi fase del protocollo.
  2. Sezionare tessuti larvali in PBT e trasferire i tessuti dissezionati diun pozzetto del piatto 9-bene. Tipicamente, la dissezione del lobo ottico e l'occhio disco immaginale da 100 larve terzo instar fornisce materiale sufficiente per downstream analisi di espressione genica in seguito isolamento nuclei.
  3. Risciacquare il tessuto isolato in tampone di estrazione nucleare (10 mM HEPES-KOH, pH 7,5; 2,5 mM MgCl 2; KCl 10 mM) in una provetta da 1,5 ml. Trasferire isolati tessuti larvali a un 1 ml Dounce Omogenizzatore (vedi Materiali PDF) sul ghiaccio che contiene 1 ml di tampone di estrazione nucleare fresco. Incubare in ghiaccio per 5 min. Non è necessario aggiungere inibitori della proteasi se RNA deve essere estratto dopo isolamento nuclei.
  4. Distruggere il tessuto da 20 colpi con il pestello sciolto e poi incubare il campione in ghiaccio per 10 minuti per consentire alle cellule a gonfiarsi. Estrarre i nuclei delle cellule utilizzando 15 colpi con il pestello stretto. Il numero di colpi con i pestelli allentato e stretto deve essere ottimizzato per diversi tessuti e tipi di cellule; eccesso omogeneizzazione può provocarenuclei tosata, mentre omogeneizzazione insufficiente non estrarrà tutti i nuclei dal tessuto.
  5. Filtrare l'omogeneizzato, che contiene i nuclei e detriti cellulari, attraverso una dimensione dei pori del filtro 40 micron (vedi Materiali PDF) che è stato prerinsed con tampone di omogeneizzazione nucleare. Raccogliere il omogenato filtrato in una nuova provetta.
  6. Raccogliere campioni di pre-isolamento per successive analisi per determinare la resa nuclei, l'integrità nuclei, e di determinare livelli di trascrizione dei geni bersaglio prima di nuclei isolamento.
    1. Trasferire 50 ml di omogenato filtrata in una fiala da 1,5 ml con una pipetta. Questo è il campione pre-isolamento. Aggiungere 500 ml di Trizol reagente (vedi Materiali PDF, ATTENZIONE), miscelare e conservare a -20 ° C per il successivo isolamento di RNA (punto 3.1).
    2. Trasferire 20 ml di omogenato filtrata in una fiala da 1,5 ml.
      1. Aggiungere DAPI ad una concentrazione finale di 0,1 mg / ml, e inccampione Ubate in ghiaccio per 10 min.
      2. Trasferimento nuclei DAPI colorati con un coprioggetto rivestito poli-lisina, e mettere su un vetrino da microscopio. Sigillare il coprioggetto con smalto trasparente.
      3. Verificare l'integrità nuclei, e la presenza di nuclei GFP-tagged di interesse utilizzando microscopio a fluorescenza. Nota: Non è necessario fissare i nuclei, o colorare per GFP se queste diapositive sono analizzate in tempi ragionevolmente rapidi dopo la preparazione (entro 24 ore).
    3. Trasferimento 10 ml di omogenato filtrata in una fiala da 1,5 ml e aggiungere 90 ml di tampone di lavaggio (PBS 1x, pH 7,4; 2,5 mM MgCl 2). Aggiungere DAPI ad una concentrazione finale di 0,1 mg / ml, e incubare in ghiaccio per 10 min. Determinare la resa nuclei nel campione pre-isolamento con un emocitometro per contare i nuclei DAPI-positivi con epifluorescenza sotto un obiettivo 10X aria.
  7. Posizionare il tubo da 1,5 ml contenente le perline anticorpo-bound (preparati nella sezione 2.1.6) in un rack magnetico,e consentire alle sfere magnetiche di legarsi magnete per almeno 2 minuti come descritto nella sezione 2.1.4. Rimuovere il tampone di lavaggio dai branelli legata all'anticorpo usando una pipetta 1 ml, e aggiungere l'omogenato filtrato dal punto 2.5 al provetta da 1,5 ml con una pipetta 1 ml.
  8. Capovolgere delicatamente la provetta diverse volte per mescolare e incubare a 4 ° C per 30 minuti con end-over-end agitazione. Evitare bolle nel tubo se possibile, in quanto questi possono causare aggregazione dei nuclei.
  9. Posizionare il tubo da 1,5 ml contenente le perline anticorpo-bound e omogenato in un rack magnetica, e permettono le sfere magnetiche di legarsi al magnete per almeno 2 minuti come descritto nella sezione 2.1.4. Rimuovere l'omogeneizzato contenente la frazione non legata nuclei con una pipetta 1 ml.
  10. Lavare il campione 3x con 1 ml di soluzione di lavaggio ogni volta. Rimuovere il tubo da 1,5 ml contenente le perline, nuclei legati e lavare tampone dal rack e miscelare diverse volte, quindi inserire il tubo nel rack magnetico come descrittonel passo 2.9 e rimuovere il surnatante con una pipetta 1 ml.
  11. Aggiungere 150 ml di tampone di lavaggio per le perline, che dovrebbero essere legati ai nuclei bersaglio. Questo è il campione post-isolamento. Preparare i campioni per le analisi di microscopia e di estrazione di RNA successiva.
    1. Trasferire 20 ml di campione post-isolamento per una nuova provetta da 1,5 ml e macchia con DAPI e analizzare come descritto nella sezione 2.6.2. Contare il GFP + / DAPI + e + GFP-/DAPI nuclei catturate da perline magnetiche per determinare la purezza della GFP + arricchito nuclei nel campione post-isolamento.
    2. Aggiungere 1 ml di Trizol reagente al resto del campione post-isolamento, miscelare, e conservare a -20 ° C per il successivo isolamento dell'RNA (passo 3.1). Nota: I campioni in Trizol possono essere conservati per diverse settimane, se necessario, a -20 ° C. Non è necessario per eluire i nuclei dalle perline magnetiche prima estrazione di RNA utilizzando Trizol reagente, because le perline non interferiscano con il successivo isolamento dell'RNA.

3. Determinare livelli di trascrizione nei nuclei isolati da tessuti larvali

  1. Isolare l'RNA dai campioni pre-e post-isolamento isolamento preparati in sezioni 2.6.1 e 2.11.2 utilizzando il protocollo standard descritto per l'estrazione di RNA-based Trizol (vedi Materiali PDF) con le seguenti modifiche:
    1. Dopo precipitazione del pellet di RNA, aggiungere 19,2 ml di acqua priva di RNasi e 0,8 ml di reagente RNASecure (vedi Materiali PDF) al pellet e incubare a 60 ° C per 20 minuti per inattivare RNasi.
  2. Determinare la concentrazione di RNA con un colorante fluorescente vincolante-RNA, come il kit Qubit saggio RNA (vedi Materiali PDF) usando l'2.0 Fluorometro QubitR seguendo il protocollo del produttore.
  3. Sintetizzare cDNA utilizzando una trascrittasi inversa amplificando come il EpiScript Reverse kit trascrittasi e primer oligodT seguendo le istruzioni del produttore. Nota: in genere, 50 a 100 ng di RNA genera cDNA sufficiente per eseguire le analisi di espressione genica aerei. Quantità equivalenti di pre-isolamento e post-isolamento dell'RNA dovrebbero essere usati per generare cDNA.
  4. Aggiungere 180 ml di acqua priva di nucleasi al campione di cDNA 20 microlitri per diluire questo 10 volte prima di real-time PCR quantitativa (qPCR) analisi. Questa diluizione è un passo importante, perché campioni di cDNA non diluiti possono inibire la qPCR.
  5. Preparare una master mix qPCR con polimerasi e dNTP, 4 pmoli ciascuno di avanti e indietro innesco, fatta con acqua sterile al volume finale di reazione di 20 microlitri.
    1. Disegnare primer qPCR per indirizzare geni suscettibili di essere espresso nel tipo cellulare di interesse, e allo stadio di sviluppo in cui il tessuto viene raccolto. Primer design per attraversare un introne, se possibile, in modo che genomica eprodotti cDNA PCR possono essere distinti. Nota: Se il profilo di espressione genica del tipo di cellula bersaglio non è noto, primers contro eGFP, che deve essere espressa specificamente nella popolazione nuclei targhetta, possono essere usati per ottimizzare il protocollo per un tipo particolare e tessuti (Tabella 1) cellule.
  6. Determinare i livelli di trascrizione relative di ciascun gene di interesse nei campioni pre-e post-isolamento isolamento rispetto ad una serie di diluizioni di cDNA preparato da tutto il tessuto. Livelli di trascrizione dei geni bersaglio dovrebbero essere normalizzati a un gene di riferimento, come Rpl32 (o, preferibilmente, più geni di riferimento).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Il driver repo-GAL4 (Bloomington archivio numero 7415) è specificamente espresso in cellule gliali del sistema nervoso Drosophila, a diversi stadi di sviluppo 18. Le mosche sono stati generati che esprimono stabilmente UAS-EGFP :: Msp-300 KASH sotto il controllo del guidatore repo-GAL4 utilizzando tecniche genetiche standard. Per caratterizzare il profilo di espressione del transgene EGFP :: KASH in queste mosche, il pattern di espressione GFP nel lobo ottica sezionato e occhio disco immaginale da larve al terzo stadio è stata esaminata mediante microscopia confocale. I tessuti sono stati sezionati di contrasto con DAPI per marcare il DNA e con α-chaoptin 19 per etichettare gli assoni dei fotorecettori (mAb24B10, vedi Materiali PDF). figura 1A mostra che la EGFP guidato repo-GAL4 :: KASH transgene è espresso in glia nei lobi ottici e occhiali disco immaginale del pattern di espressione previsto. Sotto ingrandimento maggiore,Espressione EGFP è osservato in un modello circolare che circonda il DNA DAPI-positivo, coerente con localizzazione nucleare-busta della EGFP :: tag KASH (Figura 1B). Espressione EGFP può essere rilevato sia fisso e nei tessuti non fissati senza la necessità di amplificazione del segnale utilizzando un anticorpo contro GFP; anticorpi contro GFP non sono stati usati per visualizzare il EGFP :: espressione KASH Nella immagini mostrate nelle figure 1 e 2. Per determinare se il transgene EGFP :: KASH è espresso in modo aspecifico in altri tessuti in Drosophila larve, espressione GFP è stata esaminata in tutta larve al terzo stadio fluorescenza utilizzando un microscopio da dissezione. In particolare, l'espressione non specifica del EGFP :: KASH transgene è stata osservata ad alti livelli nelle ghiandole salivari delle larve terzo instar. Ciò indica che il driver repo-GAL4 ha attività in alcuni tipi cellulari diversi glia nello stadio larvale dello sviluppo. Così, per isolare specificamente GliAL nuclei, il lobo ottico e l'occhio disco immaginale da larve terzo instar sono stati isolati con dissezione prima di omogeneizzazione e l'affinità isolamento.

Per confermare che questo protocollo è adatto per l'estrazione dei nuclei da tessuti di Drosophila, e di stimare la percentuale di nuclei contrassegnati presente in un dato tessuto, il campione pre-isolamento (sezione 2.6.2) da omogenati ottenuti dal lobo ottico e occhio disco immaginale di repo-GAL4, UAS-EGFP :: Msp-300 KASH terzo instar larve è stata esaminata. Figura 2A mostra un'immagine rappresentativa del campione pre-isolamento ottenuto usando la microscopia confocale. In questa immagine, la presenza di nuclei è indicata da eventi DAPI-positivo. Sono inoltre osservato un piccolo numero di scarsamente sparsi GFP-positive, nuclei gliali DAPI-positivo. Si stima che i nuclei GFP-positive rappresentano meno del 2% della popolazione totale nuclei in questacampione (Figura 2A). La resa totale di nuclei lobo ottico e occhio dischi immaginali che sono stati sezionati da 100 larve è stata determinata per il campione pre-isolamento come descritto nella sezione 2.6.3 (Tabella 2). Un tipico esempio di pre-isolamento da 100 sezionati lobo ottico dell'occhio e dischi immaginali contenute tra 0,8 e 1,2 x 10 7 nuclei, di cui circa il 2% erano GFP-positive. Figura 2B mostra un'immagine rappresentativa di nuclei DAPI positivi in una regione definita del emocitometro. Si noti che i nuclei sono intatte, e mantengono una forma circolare uniforme nelle condizioni estrazione impiegati nel protocollo (Figure 2A e 2B).

Per determinare se questo protocollo può essere utilizzata per isolare e / o altamente arricchire specifiche popolazioni di nuclei etichettati da tessuti contenenti popolazioni cellulari miste, α-GFP biglie magnetiche rivestite con anticorpi erano utilizzod isolare nuclei con targhetta da omogenati ottenuti dal lobo ottico e l'occhio disco immaginale di 100 repo-GAL4, UAS-EGFP :: Msp-300 KASH terzo instar larve. Nelle Figure 2C e 2D, si può vedere che la EGFP :: KASH etichettato gliale nuclei legano alle biglie magnetiche rivestite α-GFP e sono osservate nel campione post-isolamento (sezione 2.11.1) dopo separazione magnetica. Sebbene le biglie magnetiche presentano alcuni autofluorescenza nel canale GFP, questi possono essere facilmente differenziate da nuclei branello-bound per la loro dimensione più piccola (2,8 micron per le biglie magnetiche contro circa 5 micron per i nuclei) e la mancanza di colorazione DAPI. Le GFP + / DAPI + nuclei rappresentano oltre il 95% dei DAPI eventi positivi nel campione post-isolamento. Così, la porta etichettato popolazione nuclei sono altamente arricchito nel campione relativo post-isolamento per il pre-isolamentocampione. La maggior parte dei nuclei del campione spettacolo post-isolamento nucleare forte-busta localizzata fluorescenza GFP, e di solito sono circondato da perline. Tuttavia, è possibile che un piccolo numero di nuclei senza tag potrebbe anche essere presente in questo esempio. Così, anche se i risultati della Figura 2C e nell'analisi dell'espressione genica in Figura 3 (vedi sotto) indicano che la porta etichettato popolazione nuclei gliali è altamente arricchito, la possibilità che alcuni nuclei di alcuni altri tipi cellulari non specifici sono anche presenti nel campione non può essere esclusa. Si raccomanda agli utenti di ottimizzare questo protocollo per la loro particolare tipo di cellula e tessuto di interesse a massimizzare l'arricchimento della popolazione target nuclei, e per eliminare nuclei aspecifici vincolante. In particolare, il rapporto tra materiale di partenza rispetto all'anticorpo e perline è probabile che sia importante per l'arricchimento ottimale dei nuclei bersaglio. Per questo motivo, gli intervalli di totalenumeri presenti nei nostri esempi tipici pre-isolamento nuclei sono mostrati nella Tabella 2. Sulla base dei numeri totali nuclei presenti nel campione pre-isolamento, e la percentuale stimata di cellule gliali nella popolazione mista dal lobo ottico e occhio disco immaginale, la resa massima nuclei nel campione post-isolamento è stato dovrebbe essere compreso tra 1,6 x 10 5 e 2,4 x 10 5 nuclei. Tuttavia, utilizzando il emocitometro per determinare la resa nuclei come descritto al punto 2.6.3, il rendimento effettivo nuclei ottenuti nel campione post-isolamento era tra 1,3 x 10 4 e 2,7 x 10 4 nuclei. Questi rendimenti nuclei rappresentano stime approssimative, perché le perle presenti nel campione post-isolamento sembrano influenzare il caricamento accurata del emocitometro. Alcuni nuclei GFP-positive si osservano nel omogeneizzato non legato, indica che non tutti i nuclei GFP-positive nei sampio legano ai talloni in modo efficiente alle condizioni utilizzati in questo protocollo. Aumentando il tempo di legatura o eseguito le fasi sequenziali di isolamento potrebbe potenzialmente aumentare tale rendimento, ma questo potrebbe venire a costo di entrambi purezza e integrità dell'RNA. Utilizzando le condizioni descritte in questo protocollo, una quantità sufficiente di RNA possono essere ottenuti nel campione post-isolamento per downstream analisi di espressione genica mediante PCR (Tabella 2). Così, questo protocollo è in grado di rapidamente e rigorosamente isolare nuclei bersaglio da tessuti che contengono popolazioni miste di cellule. Inoltre, è in grado di isolare specificamente nuclei bersaglio che costituiscono solo una piccola parte, meno del 5%, le cellule in una data popolazione.

Ad ulteriore conferma che il campione post-isolamento è stato altamente arricchito per il nostro target di popolazione nuclei gliali, i livelli di trascritti per 4 diversi geni nel pre-isolamento post-isolamento campioni sono stati confrontati mediante RT-qPCR. I livelli di trascritto di elavata, nrv2 e eGFP stati determinati nei due campioni, e normalizzato al gene di riferimento, Rpl32, che è espressa a livelli equivalenti nelle cellule gliali e nel sistema nervoso centrale circostante (Figura 3). La differenza piega nel campione post-isolamento è mostrato relativa al campione pre-isolamento, che è impostato a uno. In Figura 3, il campione post-isolamento mostra livelli di trascrizione significativamente inferiori della specifica-neuronale gene elavata relativa al campione pre-isolamento. Ciò indica che i nuclei di cellule neuronali sono sotto-rappresentate nel campione post-isolamento. In contrasto, livelli di trascritto superiori sia del gliale arricchito nrv2 gene eGFP 10 e sono presenti nel post-isolazione del campione rispetto al campione pre-isolamento. Questo risultato indica che il campione post-isolamento è altamente arricchito per la popolazione bersaglio nuclei gliali. È importante notare che i livelli di trascrizione misurati in questo protocollo rappresentano trascritti nucleari, e quindi sono suscettibili di indicare i livelli di trascrizione attivo anziché mRNA di stato stazionario. Espressione riproducibile di pronti contro termine non è stato rilevato in entrambi i nostri campioni pre-isolamento o post-isolamento, suggerendo che la proteina Gal4 espressa dal driver repo-GAL4 può persistere dopo la trascrizione attiva del gene endogeno repo è cessata. Ciò è coerente con i risultati di altri studi in cui i nuclei etichettati con il promotore twi non mostrano livelli arricchiti di trascrizioni twi, forse a causa delle differenze nei tempi di sviluppo della trascrizione rispetto stabilità proteica 8. Taken insieme, questi risultati dimostrano che il protocollo descritto può essere utilizzato con successo per arricchire altamente nuclei bersaglio da tessuti che contengono popolazioni miste di cellule, e che i nuclei isolati sono adatti per l'analisi di espressione genica.

Figura 1
Figura 1. Espressione modello di repo-GAL4, UAS-EGFP :: Msp-300 KASH linea di volo. (A) In terzo instar larve, repo-GAL4 pilota l'espressione del transgene UAS-EGFP :: Msp-300 KASH in cellule gliali in ottica lobo, gambo ottica (os) e l'occhio del disco immaginale (ndr). La busta nucleare in cellule gliali è etichettato con EGFP :: KASH (verde). R1 - R8 assoni delle cellule fotorecettori sono etichettati con α-chaoptin (mAB24B10, rosso) per il confronto, e il DNA è stained con DAPI (viola). Nuclei gliali GFP-etichettata sono visibili lungo la lamina (la) all'interno del lobo ottica (contrassegnata da frecce). Barra della scala, 50 pm. (B) ingrandimenti Superiore di gangli lamina del lobo ottico che contiene EGFP :: KASH etichettato nuclei delle cellule gliali. Barra della scala, 50 pm. Immagini confocali sono state acquisite utilizzando un   40X / 1,30 olio o un   20X / 0,75 oggettiva olio di immersione, e l'utilizzo di lunghezze d'onda di eccitazione / emissione di 408 nm nm/425-475 (DAPI); nm/525-550 488 nm (GFP); nm/595-620 561 nm (Alexa 5,6,8 ). cliccate qui per vedere una versione più grande di questa figura.

Figura 2
Figura 2. Caratterizzazione dei nucleiin "pre-isolamento" e "post-isolamento" campioni. (A) immagine rappresentativa da un repo-GAL4, UAS-EGFP :: Msp-300 KASH campione di pre-isolamento analizzato utilizzando un X 20 / 0,75 oggettiva immersione in olio e lo standard microscopio confocale. DNA è macchiato con DAPI (blu), e EGFP :: KASH tagged nuclei gliali sono visualizzati in verde (contrassegnata dalle frecce). Barra della scala, 50 pm. (B) immagine rappresentativa dei nuclei DAPI-macchiati da un campione pre-isolamento su un emocitometro utilizzando un obiettivo X 10 aerei e microscopio a epifluorescenza standard. Griglie emocitometro sono mostrati in grigio chiaro. Nuclei Solo DAPI-positivi sono mostrati in questa immagine, come GFP fluorescenza non era visibile nell'ambito di questo obiettivo sul microscopio a epifluorescenza. (C) l'immagine rappresentativa di un repo-GAL4, UAS-EGFP :: Msp-300 KASH campione post-isolamentoanalizzata come descritto per il pannello A. L'EGFP isolata :: KASH tagged nuclei gliali (contrassegnati da frecce) macchia positivamente per DAPI, e sono circondati da perline, che autofluorescenza a bassi livelli nel canale GFP. Barra della scala, 50 pm. (D) ingrandimenti superiore di un EGFP tipico isolato :: KASH tagged nuclei gliali (indicata dalla freccia) circondato da perline. Barra della scala, 5 micron. Cliccare qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3. Rappresentante dei dati qRT-PCR di "pre-isolamento" e di campioni "post-isolamento". Livelli di trascrizione dei geni bersaglio sono stati determinati da qRT-PCR di pre-isolcampioni ation e post-isolamento ottenuti da repo-GAL4, UAS-EGFP :: Msp-300 KASH lobi ottici e oculari dischi immaginali. Tutti i livelli di trascrizione sono normalizzati a livelli di trascrizione Rpl32, e il campione di pre-isolamento per ogni gene bersaglio è impostato a uno. I risultati rappresentativi da un esperimento biologico sono indicati per i seguenti geni: ELAV, nrv2 e eGFP.

Gene Sequenza Primer (5 '-3') Dimensioni PCR prodotto (bp)
eGFP GAGGGATACGTGCAGGAGAG 102
GATCCTGTTGACGAGGGTGT
nrv2 GGCTGGTTGTAGTCGCAGTT 125
GGCACCCAACACGAGAACTA
elavata GCACCATTCGGAGCAATAAT 153
TGTGCAGCTGGATGGTGTAG
Rpl32 GCTAAGCTGTCGCACAAATG 160
CGTTGTGCACCAGGAACTT

Tabella 1. Primer utilizzati per l'analisi qRT-PCR.

Numero totale di nuclei nel campione di pre-isolamento Numero totale stimato di nuclei in campioni post-isolamento RNA rendimento da campione post-isolamento (ng)
0,8-1,2 x 10 7 1,3-2,7 x 10 4 160-220 ng

Tabella 2. Nuclei rappresentativi e le rese di RNA ottenuti.Tipici gamme di nuclei e delle rese di RNA ottenuti da campioni di pre-isolamento e post-isolamento da 100 lobo ottico sezionato e occhio dischi immaginali dalla repo-GAL4, UAS-EGFP :: Msp-300 KASH genotipo, in cui le cellule gliali sono etichettati con EGFP :: KASH. I nuclei sono stati quantificati come descritto in 2.6.3 e RNA è stato quantificato come descritto in 3.1.2.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Questo protocollo può essere utilizzato per isolare o altamente arricchire specificamente nuclei contrassegnati da popolazioni di cellule miste in Drosophila embrionale o tessuti larvali. Usando questo protocollo, i nuclei possono essere isolate dai tessuti sezionati in circa 1 ora. La purezza e resa dei nuclei isolati devono essere determinati sperimentalmente per ogni tipo di cellula. Può essere difficile quantificare i nuclei del tallone con associazione nella fase post-isolamento del protocollo utilizzando un emocitometro causa delle perline presenti nel campione. Pertanto, se sono necessarie numero esatto di nuclei per un'applicazione a valle, sarà necessario stimare rendimento nuclei basato su un metodo alternativo come contenuto di DNA. Calcoli esatti di rendimento nuclei non sono necessari per l'analisi di espressione genica se RNA può essere isolato e quantificato correttamente. Si consiglia di utilizzare un metodo basato sulla fluorescenza per quantificare la resa di RNA, abbiamo trovato che la determinazione spettrofotometrica della concentrazione di RNAin questi campioni a bassa concentrazione è molto variabile.

Ci sono due aspetti importanti del protocollo che influenzeranno il suo successo: la scelta di sfere magnetiche e anticorpi. Sfere magnetiche che sono accoppiati a proteina G GFP o sono disponibili in commercio da diverse fonti. Tuttavia, si raccomanda vivamente di utilizzare le proteine ​​G sfere magnetiche disponibili da Invitrogen per la procedura descritta in questo protocollo per due ragioni principali. In primo luogo, le dimensioni delle perline Invitrogen a 2,8 micron è leggermente inferiore alla dimensione media dei nuclei nei tipi cellulari esaminati, che è di circa 5 micron (Figura 2D). Sfere magnetiche che sono più piccoli (per esempio 50 nm, μMACS α-GFP, Miltenyi Biotech) non legano rapidamente a magneti stile lotto-wash, e le colonne di cui queste perle può inceppare con estratti di tessuti larvali. Sfere magnetiche più grandi (ad esempio 10 micron, proteine ​​PureProteome G magnetico BEADS, Millipore) non lega bene ai nuclei nei nostri test preliminari, e questi anche esporre una forte autofluorescenza negli stessi canali sia DAPI e GFP, che rende difficile individuare i nuclei nel campione tallone-vincolato da tecniche di microscopia standard. Oltre alla scelta di perline magnetiche, è importante usare un anticorpo GFP che funziona bene per immunoprecipitazione ma che non hanno un alto fondo non specifica. Per facilitare la riproducibilità di questo protocollo, abbiamo usato un anticorpo monoclonale di topo contro GFP. Anticorpi policlonali di coniglio contro GFP sono stati sperimentati con successo nei nostri studi preliminari, ma questi tendono ad avere sfondo superiore aspecifica. Altri anticorpi monoclonali sono stati testati (ad es Developmental Studies Ibridoma Bank), con vari livelli di successo. Così, la scelta anticorpo è un fattore importante nell'isolamento successo di nuclei etichettati.

Anche se in questo protocollo si descrivono i metodi per determellino livelli di gene trascritto in nuclei isolati, si prevede che l'approccio descritto nei passaggi 2,1-2,11 sarà anche adatto per isolare i nuclei che possono essere utilizzati per la successiva analisi immunoprecipitazione della cromatina. Se il tessuto è fissato in 1% di formaldeide prima di omogeneizzazione (punto 2.3), quindi i tessuti dissezionati possono essere raccolti nell'arco di diversi giorni e materiale sufficiente isolato per eseguire l'analisi della cromatina immunoprecipitazione. Sulla base di conteggi ottenuti usando l'emocitometro, che forniscono solo stime approssimative come discusso sopra, tipicamente ottenuto 1,3 x 10 4 e 2,7 x 10 4 nuclei gliali dall'occhio disco immaginale e lobo ottica di 100 larve (Tabella 2). Così, utilizzando il nostro approccio, dovrebbe essere possibile avere materiale sufficiente per eseguire analisi di immunoprecipitazione della cromatina, a seconda della abbondanza del tipo di cellula bersaglio, e l'epitopo di interesse.

Un'applicazione genetica utile di questa tecque è che può essere utilizzato per etichettare positivamente nuclei in specifici tipi cellulari in embrioni o larve che sono omozigoti per un allele mutante recessivo letale. Per fare questo, due stock fly distinte devono essere generati in cui l'allele mutante di interesse viene ricombinato con un driver specifico GAL4, o con il transgene UAS-EGFP :: Msp-300 KASH il terzo cromosoma. Se le mosche che trasportano l'allele mutante e il driver Gal4 sono incrociate per le mosche trasportano alleli mutanti e il transgene UAS-EGFP :: Msp-300 KASH, solo la progenie che hanno entrambe le copie dell'allele mutante saranno etichettati con GFP nel tessuto in cui il driver GAL4 è espresso. Così, effetti specifici di cellule del recessivi alleli letali possono essere esaminate nelle fasi embrionali o larvali, prima della fase di letalità. Questa tecnica genetico è stato precedentemente utilizzato per etichettare positivamente cellule muscolari embrionali che erano omozigoti per mutazioni in subunità SAGA, sgf11 1 </ Sup>.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da rivelare.

Acknowledgments

Ringraziamo Janice Fischer per la fornitura del plasmide UAS-EGFP :: Msp-300 KASH. L'anticorpo mAB24B10 è stato ottenuto dal Developmental Studies Ibridoma Banca sviluppato sotto gli auspici del NICHD e mantenuto dalla University of Iowa, Dipartimento di Biologia. Lo stock repo-GAL4 (BL7415) è stato ottenuto dal Bloomington Stock Center presso l'Indiana University. Supporto dalla American Cancer Society Institutional Research Grant (IRG # 58-006-53) alla Purdue University Center for Cancer Research è riconosciuto con gratitudine. Jingqun Ma è supportato da una ricerca agricola presso la Purdue assistentato in alimentazione e l'agricoltura presso la Purdue University.

Materials

Name Company Catalog Number Comments
Anti-chaoptin antibody (mouse, monoclonal) Developmental Studies Hybridoma Bank mAB24B10
Anti-GFP antibody (mouse, monoclonal) Roche 11814460001 This specific antibody is recommended for this protocol. However, alternative antibodies could also be used.
2x Bullseye EvaGreen qPCR Mastermix with ROX MidSci BEQPCR-R
DAPI (4',6-diamidino-2-phenylindole, dihydrochloride salt) Biotium 40011
Dounce Homogenizer (1 ml) VWR 62400-595
Dumont #5 Tweezers, 11 cm World Precision Instruments 14095
Dynabeads Protein G for Immunoprecipitation Invitrogen 10003D This specific brand of magnetic beads is recommended for this protocol.
EpiScript Reverse Transcriptase Epicentre ERT12910K http://www.epibio.com/docs/default-source/protocols/episcript-reverse-transcriptase.pdf
Falcon cell strainers, 40 μm pore size VWR 21008-949 Alternative pore sizes could be used, depending on the size of the target cell nuclei.
Magnetic stand (8 x 1.5 ml tubes) Millipore LSKMAGS08 
Mini tube rotator Genemate H-6700
Qubit starter kit Life Technologies Q32871 Similar fluorescence-based methods for quantifying RNA yield could be used. http://tools.invitrogen.com/content/sfs/manuals/mp32852.pdfZ
RNAsecure (Ambion) Life Technologies AM7010 The use of this reagent to inactivate RNAses is optional.
RT-PCR machine Thermal Cycler BioRad CFX Connect Thermal Cycler
Siliconized 9-well glass plate Hampton Research HR3-134
Stereomicroscope Fluorescence Adapter (Royal Blue (440-460 nm) excitation + yellow barrier Nightsea This adaptor enables GFP fluorescence to be examined using a typical dissecting microscope (eg Nikon)
StereoZoom Microscope 83604 Set with 10X Wide Field Eyepieces and Universal Boom Stand Nikon SMZ 745
Thermal Cycler BioRad T100
Trizol reagent Life Technologies 15596018 CAUTION; Alternative RNA extraction methods can be used. http://tools.invitrogen.com/content/sfs/manuals/trizol_reagent.pdf
Tween 20 Amresco 0777-1L

DOWNLOAD MATERIALS LIST

References

  1. Weake, V. M., et al. Post-transcription initiation function of the ubiquitous SAGA complex in tissue-specific gene activation. Genes Dev. 25, 1499-1509 (2011).
  2. Bonn, S., et al. Cell type-specific chromatin immunoprecipitation from multicellular complex samples using BiTS-ChIP. Nat. Protoc. 7, 978-994 (2012).
  3. Haenni, S., et al. Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq. Nucleic Acids Res. 40, 6304-6318 (2012).
  4. Barthelson, R. A., Lambert, G. M., Vanier, C., Lynch, R. M., Galbraith, D. W. Comparison of the contributions of the nuclear and cytoplasmic compartments to global gene expression in human cells. BMC Genom. 8, 340 (2007).
  5. Zhang, C., Barthelson, R. A., Lambert, G. M., Galbraith, D. W. Global characterization of cell-specific gene expression through fluorescence-activated sorting of nuclei. Plant Physiol. 147, 30-40 (2008).
  6. Deal, R. B., Henikoff, S. The INTACT method for cell type-specific gene expression and chromatin profiling in Arabidopsis thaliana. Nat. Protoc. 6, 56-68 (2011).
  7. Deal, R. B., Henikoff, S. A simple method for gene expression and chromatin profiling of individual cell types within a tissue. Dev Cell. 18, 1030-1040 (2010).
  8. Steiner, F. A., Talbert, P. B., Kasinathan, S., Deal, R. B., Henikoff, S. Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling. Genom. Res. 22, 766-777 (2012).
  9. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, 401-415 (1993).
  10. Henry, G. L., Davis, F. P., Picard, S., Eddy, S. R. Cell type-specific genomics of Drosophila neurons. Nucleic Acids res. 40, 9691-9704 (2012).
  11. Starr, D. A. KASH and SUN proteins. Curr Biol. 21, 414-415 (2011).
  12. Fischer, J. A., et al. Drosophila klarsicht has distinct subcellular localization domains for nuclear envelope and microtubule localization in the eye. Genetics. 168, 1385-1393 (2004).
  13. Patterson, K., et al. The functions of Klarsicht and nuclear lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye. Mol. Biol. Cell. 15, 600-610 (2004).
  14. Yu, J., et al. The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Dev. Biol. 289, 336-345 (2006).
  15. Bischof, J., Maeda, R. K., Hediger, M., Karch, F., Basler, K. An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc. Natl. Acad. Sci. U.S.A. 104, 3312-3317 (2007).
  16. Kracklauer, M. P., Banks, S. M., Xie, X., Wu, Y., Fischer, J. A. Drosophila klaroid encodes a SUN domain protein required for Klarsicht localization to the nuclear envelope and nuclear migration in the eye. Fly. 1, 75-85 (2007).
  17. Markstein, M., Pitsouli, C., Villalta, C., Celniker, S. E., Perrimon, N. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat. Genet. 40, 476-483 (2008).
  18. Sepp, K. J., Schulte, J., Auld, V. J. Peripheral glia direct axon guidance across the CNS/PNS transition zone. Dev. Biol. 238, 47-63 (2001).
  19. Fujita, S. C., Zipursky, S. L., Benzer, S., Ferrus, A., Shotwell, S. L. Monoclonal antibodies against the Drosophila nervous system. Proc. Natl. Acad. Sci. U.S.A. 79, 7929-7933 (1982).
L&#39;isolamento a base di affinità di Tagged Nuclei di<em&gt; Drosophila</em&gt; tessuti per Gene Expression Analysis
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).More

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter