Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

-Affiniteit gebaseerde Isolatie van Tagged Kernen uit doi: 10.3791/51418 Published: March 25, 2014

Summary

Drosophila weefsels bevatten vaak een heterogeen mengsel van celtypen. Om genexpressie in bepaalde celtypes van een bepaald weefsel te onderzoeken, kan kernen genetisch gemerkt en vervolgens geïsoleerd met behulp van een op affiniteit gebaseerde benadering. Geïsoleerde kernen kan worden gebruikt voor verdere toepassingen zoals genexpressie analyse en chromatine immunoprecipitatie.

Abstract

Drosophila melanogaster embryonale en larvale weefsels bevatten vaak een zeer heterogeen mengsel van celtypen, welke de analyse van genexpressie kan bemoeilijken in deze weefsels. Dus, om cel-specifieke genexpressie van Drosophila weefsels te analyseren, kan het nodig zijn om specifieke celtypen met hoge zuiverheid en in voldoende hoge opbrengsten van verdere toepassingen zoals transcriptionele profilering en chromatine immunoprecipitatie isoleren. Echter, de onregelmatige cellulaire morfologie in weefsels zoals het centrale zenuwstelsel, in combinatie met de zeldzame populatie van specifieke celtypen in deze weefsels, uitdaging vormen voor traditionele methoden celisolatie zoals laser-microdissectie en fluorescentie geactiveerde celsortering (FACS) . Hier, een alternatieve benadering karakteriseren cel-specifieke genexpressie middels affiniteit isoleert gelabeld kernen, in plaats van hele cellen, wordt beschreven. Kernen in de specifieke cell type belang zijn genetisch gelabeld met een nucleair-envelop gelokaliseerde EGFP tag met behulp van de Gal4/UAS binaire expressie systeem. Deze-EGFP gelabeld kernen kunnen worden geïsoleerd met antilichamen tegen GFP die zijn gekoppeld aan magnetische korrels. De in dit protocol beschreven benadering maakt consistente isolatie van kernen van bepaalde celtypes in het Drosophila larven centrale zenuwstelsel bij hoge zuiverheid en op voldoende niveau voor expressie analyse, zelfs wanneer deze celtypen omvatten minder dan 2% van de totale celpopulatie in de weefsel. Deze benadering kan gebruikt worden om kernen te isoleren uit een grote verscheidenheid van Drosophila embryo's en larven celtypes in specifieke Gal4 drivers, en kunnen bruikbaar zijn voor het isoleren kernen van celtypen die niet geschikt is voor FACS of laser microdissectie bent.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Drosophila weefsels zoals het centrale zenuwstelsel bevatten een complex mengsel van celtypen. Dus, om cel-specifieke genexpressie profielen van Drosophila weefsels te analyseren, is het eerst nodig om een homogene populatie van specifieke cellen isoleren in voldoende hoeveelheden aan downstream-toepassingen mogelijk te maken. Werkwijzen om cellen te isoleren uit intacte weefsels omvatten laser-microdissectie en fluorescentie-geactiveerde celsortering (FACS) van gehele cellen. Hoewel FACS werd gebruikt om cellen en kernen isoleren van Drosophila embryo's en van Caenorhabditis elegans voor genexpressie en chromatine profilering 1-3, kan FACS en laser microdissectie moeilijk succesvol presteren in weefsels die sterk vermengd celtypes bevatten of die cellen bevatten met onregelmatige morfologie, zoals neuronen. Om deze moeilijkheid te overwinnen, kan kernen plaats cellen geïsoleerd uit specifieke celtypen en gebruikt voor daaropvolgende gene expressie profilering. Belangrijk microarray gebaseerde mRNA analyse met behulp van RNA monsters nucleaire toont algemeen vergelijkbare resultaten met die uitgevoerd met totaal RNA 4, 5. Bovendien genexpressie analyse met behulp van nucleaire RNA is met succes gebruikt om genexpressie in diverse organismen, waaronder C. elegans, Arabidopsis thaliana, Drosophila en mensen 4, 5 2, 3.

Verschillende benaderingen zijn onlangs beschreven voor het isoleren van specifieke populaties van gemerkte kernen van Drosophila weefsels die geschikt zijn voor genexpressie-analyse en / of chromatine immunoprecipitatie zijn. De partij isolatie van weefsel-specifieke chromatine voor methode immunoprecipitation (bits-chip) maakt gebruik van FACS om vaste kernen isoleren op basis van celtype specifieke expressie van de nucleaire-gelokaliseerde GFP 2. Deze aanpak is successfully gebruikt om de verdeling van histon modificaties en transcriptiefactoren met chromatine immunoprecipitatie van geïsoleerde kernen uit het mesoderm van Drosophila embryo 2 analyseren. Kunnen echter FACS-gebaseerde benaderingen minder geschikt voor het isoleren gemerkte kernen die slechts een klein deel van een gemengde populatie vanwege de toegenomen sorteren tijd nodig om geschikte nummers voor verdere toepassingen vinden vormen. Om deze beperkingen te overwinnen, hebben verschillende groepen affiniteit gebaseerde isolatietechnieken gebruikt voor kernen die gelabeld zijn met een specifiek epitoop in een bepaald celtype zuiveren. De isolatie van kernen gelabeld in specifieke celtypen (ONBESCHADIGDE) methode ontwikkeld voor Arabidopsis thaliana 6, 7 is onlangs aangepast voor gebruik in Drosophila 8. In deze methode wordt een envelop fusie-nucleair eiwit dat een substraat voor in vivo biotinylering is coexpressed de Escherichia coli biotine ligase BirA in bepaalde celtypes. Biotine gelabelde kernen kan vervolgens worden gezuiverd uit gemengde populaties met streptavidine gebaseerde affiniteit isolatie. Met deze benadering werden kernen succes gelabeld en geïsoleerd van het mesoderm van Drosophila embryo, waarin een envelop fusie-nucleaire eiwit werd tot expressie gebracht onder controle van een mesoderm-specifieke enhancer 8. De auteurs ook gegenereerd nucleaire envelop fusie-eiwitten die kunnen worden uitgedrukt in elk celtype onder controle van de regulerende sequentie Gal4, UAS 9. Deze benadering kan snel isoleren van deelverzamelingen van gemerkte kernen van gemengde populaties, maar vereist drie afzonderlijke transgene constructen en derhalve ongeschikt voor bepaalde genetische toepassingen. Onlangs is een aanpak beschreven waarbij SUN (S AD1 en UN C-84)-domein bevattende eiwitten die lokaliseren naar de binnenmembraan van de nucleaire envelop werden gelabeld metfluorescente eiwitten en expressie onder controle van de Gal4/UAS systeem 10. Kernen werden geïsoleerd in aanwezigheid van ionische detergens aan de buitenste membraan van de kern envelop te verwijderen en affiniteit-gezuiverd via magnetische partikels gekoppeld met anti-GFP antilichamen. Deze aanpak is succesvol gebruikt om kleine populaties van gemerkte kernen van specifieke neuronale subtypes in volwassen hersenen van Drosophila 10 isoleren.

Hier is een protocol voor isolatie van gemerkte kernen uit een gemengde populatie van cellen van Drosophila larven weefsel beschreven. Deze methode is onafhankelijk ontwikkeld, maar vergelijkbaar met de werkwijze beschreven door Henry et al.. 10 eerste benadering werden kernen gelabeld met een fluorescerend label dat tot expressie alleen in specifieke celtypen in Drosophila melanogaster de daaropvolgende isolatie van gemerkte kernen van gemengde populaties vergemakkelijken met een affiniteit gebaseerde benadering. Om kernen te etiketteren,de KASH (K larsicht / A nc-1 / S yn h omology) domein werd gebruikt. De KASH domein is een transmembraan domein dat lokaliseert naar de buitenste membraan van de nucleaire envelop, mede door interacties met SUN-domein-bevattende eiwitten in de perinucleaire ruimte 11. De C-terminale domein van KASH eiwitten zoals Drosophila Msp-300 en Klarsicht verankert deze eiwitten aan de buitenste kernmembraan, terwijl hun N-terminale domeinen wisselwerking met cytoskelet eiwitten zoals actine en microtubuli in het cytoplasma 12-14. Constructen werden gegenereerd waarin de KASH domein van Drosophila Msp-300 werd gefuseerd met het C-uiteinde van EGFP, onder controle van de regulerende sequentie Gal4, UAS in de pUAST-attB vector 15, 16. Met phiC31 plaatsspecifieke integratie, werden transgene vliegen gegenereerd waarin de UAS-EGFP :: Msp-300 KASH transgen is in het attP2 loci op chromosoom ingevoegd3L 17. De UAS-EGFP :: Msp-300 KASH vliegt kan worden gekruist met vliegen die de Gal4 driver drukken in een bepaald celtype, waardoor de gerichte expressie van EGFP op de buitenste kernmembraan in het celtype van interesse. Gemerkte kernen kan vervolgens worden gezuiverd uit gemengde celpopulaties met antilichamen tegen GFP gekoppeld aan magnetische korrels. In deze benadering is het gebruik van ionische detergens niet vereist omdat de EGFP tag gelokaliseerd aan de cytoplasmatische zijde van het buitenste kernmembraan en derhalve toegankelijk voor antilichamen.

Het hieronder beschreven protocol kan worden gebruikt voor het isoleren / verrijken-EGFP gemerkte kernen van specifieke celtypen in Drosophila larvale weefsels, de zuiverheid en opbrengst van geïsoleerde kernen kwantificeren, en nucleaire RNA extract voor kwantitatieve reverse transcriptie polymerase kettingreactie (qRT -PCR) analyse van genexpressie. De isolatie en zuivering van affiniteit-kernen (exclusief tissue dissectie) kan worden uitgevoerd in minder dan een uur. De resultaten worden weergegeven die gliale kernen succes kan worden geïsoleerd uit het larvale optische kwab en oog verbeelding schijf, en gebruikt voor daaropvolgende analyse van genexpressie. Verwacht wordt dat deze benadering bruikbaar voor de isolatie / verrijking van gemerkte kernen van embryonale en larvale weefsels waarin de doelcellen deze minder dan 5% van de totale bevolking is. Alle Drosophila voorraden en plasmiden die uit dit onderzoek zijn verkrijgbaar bij de auteurs op aanvraag.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Generatie en karakterisering van EGFP :: KASH Drosophila

  1. Cross Gal4 bestuurder vliegt naar UAS-EGFP :: Msp-300 KASH vliegt. Als alternatief kunnen recombinante vliegen die zowel de Gal4 bestuurder en de UAS-EGFP :: Msp-300 KASH transgen worden gegenereerd met behulp van standaard genetische technieken. Deze tweede benadering is voordelig wanneer grote aantallen nakomelingen vereist.
  2. Karakteriseren uitdrukking van de EGFP :: KASH marker met behulp van standaard microscopische technieken. Opmerking: EGFP expressie kan met standaard microscopische technieken worden waargenomen ontleed, vaste Drosophila weefsels, of geheel larven en maakt gebruik van een antilichaam vereisen.
    1. Bepaal het expressie patroon van de EGFP :: KASH marker in het gehele organisme onder een fluorescentie microscoop ontleden (zie Materials PDF). Opmerking: Veel Gal4 chauffeurs, met inbegrip van de repo-GAL4 driver weergegeven in figuur 1, vertonen nonspecific patronen van meningsuiting in andere larvale weefsels zoals de speekselklier (zie resultaten).
    2. Analyseer de EGFP :: KASH expressie patroon in de ontleed weefsel van belang met behulp van confocale microscopie.
      1. Bevestig het weefsel van belang formaldehyde in een eindconcentratie van 4%, en vlek DNA met DAPI bij een uiteindelijke concentratie van 0,1 ug / ml voor de lokalisatie van de EGFP :: KASH tag opzichte DNA te visualiseren.
      2. Acquire beelden met behulp van een 40x / 1,30 olie-immersie objectief of 20X / 0,75 olie-immersie objectief, afhankelijk van de grootte van het weefsel van belang. De volgende excitatie / emissie omstandigheden kunnen worden gebruikt voor het verwerven: 408 nm/425-475 nm (DAPI), 488 nm / 525-550 nm (GFP).

2. Isoleer Kernen van Drosophila larven Tissues

  1. Bereid uitrusting voor de larvale weefsel dissectie en daaropvolgende kernen isolement. Letgeheel dechorionated embryo kan ook worden gebruikt als uitgangsmateriaal indien gewenst. Aanbevolen gedeeltelijk ontleed larvale weefsels gebruiken in plaats van gehele larven als het celtype aanwezig in een bepaald weefsel zoals de imaginale schijf. Dit vermindert niet-specifieke binding en elimineert problemen die kunnen worden veroorzaakt door expressie van sommige Gal4 chauffeurs nontarget cellen ook.
    1. Bereid twee paar scherpe pincet (zie Materialen PDF), een gesiliconiseerde 9-goed glasplaat (zie Materialen PDF), en PBT (1x PBS, pH 7,4, 0,1% Tween-20).
    2. Prebind de GFP antilichaam aan de magnetische korrels. Deze stap moet worden gestart voor het begin van de dissectie. Voeg 10 ul van de magnetische korrels (Invitrogen, zie Materialen PDF) en 2 ug GFP antilichaam (Roche, zie Materialen PDF) tot 400 ui wasbuffer (1 x PBS, pH 7,4, 2,5 mM MgCl2) in een 1,5 ml buis . De hoeveelheid kralen en antilichaam gebruikt kunnen worden geoptimaliseerd indien nodig op basis van de hoeveelheid doel in de samPLE en de bindingsaffiniteit van het antilichaam aan de beads.
    3. Incubeer de kralen en antilichamen met rotatie ten minste 30 minuten bij kamertemperatuur geroerd.
    4. Plaats de 1,5 ml buis met de kralen en antilichaam in de magnetische rek (zie Materialen PDF) en laat de korrels te binden aan de magnetische ongeveer 1-2 minuten. Verwijder het supernatant dat het ongebonden antilichaam en wasbuffer met een pipet 1 ml. De beads gebonden aan de wand van de buis van 1,5 ml aan de zijkant naast de magneet blijven.
    5. Tweemaal Spoel de kralen met 1 ml wasbuffer telkens zoals beschreven in paragraaf 2.1.4. Verwijder de 1,5 ml tube uit de magnetische rek en keer kort aan de korrels te mengen en wassen buffer tijdens elke wasstap.
    6. Bewaar de-antilichaam gebonden kralen in wasbuffer tot klaar om verder te gaan met stap 2.7. De kralen mag niet uitdrogen in elke fase van het protocol.
  2. Ontleden larvale weefsels in PBT en transfer ontleed weefseleen goed van de 9-goed gerecht. Typisch, dissectie van de optische kwab en oog verbeelding disc uit larven 100 derde instar voldoende informatie bevat om downstream genexpressieanalyse volgende kernen isolement.
  3. Spoel de geïsoleerde weefsel in nucleaire extractiebuffer (10 mM HEPES-KOH, pH 7,5, 2,5 mM MgCl2, 10 mM KCl) in een 1,5 ml buis. Transfer geïsoleerde larvale weefsels in een 1 ml Dounce Homogenizer (zie ook Materiaal PDF) op ijs dat 1 ml vers nucleaire extractie buffer bevat. Incubeer op ijs gedurende 5 minuten. Het is niet noodzakelijk proteaseremmers voegen als RNA wordt geëxtraheerd na kernen isolatie.
  4. Verstoren het weefsel met 20 slagen met de losse stamper en vervolgens incubeer het monster op ijs gedurende 10 minuten om de cellen te zwellen. Pak de kernen van de cellen met behulp van 15 slagen met de strakke stamper. Het aantal slagen met de losse en strakke stampers moet worden geoptimaliseerd voor verschillende weefsels en celtypen overmaat homogenisering kan leidengeschoren kernen, terwijl onvoldoende homogenisatie niet alle kernen zullen halen uit het weefsel.
  5. Filter de homogenaat, die de kernen en cellulaire puin bevat, door een 40 um poriegrootte zeef (zie Materialen PDF) die is prerinsed met nucleaire homogenisatiebuffer. Verzamel de gefilterde homogenaat in een nieuwe buis.
  6. Collect pre-isolatie monsters voor verdere analyse kernen opbrengst kernen integriteit bepalen en transcript niveau van doelgenen voor isolatie kernen te bepalen.
    1. Breng 50 pl van de gefilterde homogenaat een nieuwe 1,5 ml buisje met een pipet. Dit is de pre-isolatie monster. Voeg 500 ul van Trizol reagens (zie Materialen PDF, LET), keer om te mengen, en bewaar bij -20 ° C voor daaropvolgende RNA isolatie (stap 3.1).
    2. Breng 20 pl van de gefilterde homogenaat een nieuwe 1,5 ml buis.
      1. Voeg DAPI tot een eindconcentratie van 0,1 ug / ml, en meerderUbate monster op ijs gedurende 10 minuten.
      2. Transfer DAPI gekleurde kernen een polylysine gecoate dekglaasje en plaats op een microscoopglaasje. Dicht de dekglaasje met behulp van duidelijke nagellak.
      3. Controleer de kernen integriteit, en de aanwezigheid van GFP-gelabelde kernen van belang aan de hand fluorescentiemicroscoop. Opmerking: Het is niet nodig om de kernen vast of kleur wordt GFP indien deze dia redelijk snel geanalyseerd na bereiding (binnen 24 uur).
    3. Breng 10 pl van de gefilterde homogenaat een nieuwe 1,5 ml buis en voeg 90 ul wasbuffer (1 x PBS, pH 7,4, 2,5 mM MgCl2). Voeg DAPI tot een eindconcentratie van 0,1 ug / ml en incubeer op ijs gedurende 10 minuten. Bepaal de kernen opbrengst in de pre-isolatie monster met behulp van een hemocytometer om de DAPI-positieve kernen rekenen met epifluorescentie onder een 10X objectief lucht.
  7. Plaats de 1,5 ml buis met het antilichaam gebonden korrels (bereid in paragraaf 2.1.6) in een magnetisch rek,en laat de magnetische korrels te binden aan de magneet ten minste 2 minuten zoals beschreven in paragraaf 2.1.4. Verwijder de wasbuffer uit het antilichaam gebonden kralen met behulp van een pipet 1 ml en voeg het gefilterde homogenaat van stap 2.5 de 1.5 ml buisje met een pipet 1 ml.
  8. Keer de buis een paar keer om te mengen en incuberen bij 4 ° C gedurende 30 min met end-over-end agitatie. Vermijd luchtbellen in de buis, indien mogelijk, omdat deze kunnen leiden tot klonteren van de kernen.
  9. Plaats de 1,5 ml buis met het antilichaam gebonden kralen en homogenaat in een magnetisch rek en laat de magnetische korrels te binden aan de magneet ten minste 2 minuten zoals beschreven in paragraaf 2.1.4. Verwijder het homogene mengsel met de ongebonden kernen fractie met een pipet 1 ml.
  10. Was het monster 3x met 1 ml wasbuffer per keer. Verwijder de 1,5 ml buis met de kralen, gebonden kernen en wassen buffer uit het rek en omkeren om meerdere keren te mengen, plaats de buis vervolgens in de magnetische rek zoals beschrevenin stap 2.9 en verwijder het supernatant met een pipet 1 ml.
  11. Voeg 150 ul wasbuffer aan de korrels, die aan het doel kernen worden gebonden. Dit is het post-isolatie monster. Bereid monsters voor microscopie analyse en daaropvolgende RNA-extractie.
    1. Overdracht 20 ul van de post-isolatie monster een nieuwe 1,5 ml buis en vlek met DAPI en analyseren zoals beschreven in paragraaf 2.6.2. Tel de GFP + / DAPI + en + GFP-/DAPI kernen gefotografeerd door magnetische kralen om de zuiverheid van de verrijkte GFP + kernen in de na-isolatie monster.
    2. Voeg 1 ml van Trizol reagens aan de rest van de na-isolatie monster omkeren te mengen en bewaar bij -20 ° C voor daaropvolgende RNA-isolatie (stap 3.1). Opmerking: Monsters Trizol kan worden opgeslagen gedurende enkele weken eventueel bij -20 ° C. Het is niet noodzakelijk de kernen elueren uit de magnetische korrels voor RNA-extractie met behulp van Trizol reagens because de kralen niet interfereren met de daaropvolgende RNA-isolatie.

3. Bepaal transcriptniveaus in Kernen geïsoleerd van larvale Tissues

  1. Isoleer RNA uit de pre-isolatie-en post-isolatie monsters bereid in paragrafen 2.6.1 en 2.11.2 met behulp van de standaard protocol beschreven voor Trizol-gebaseerde RNA-extractie (zie Materialen PDF) met de volgende wijzigingen:
    1. Na precipitatie van de RNA-pellet, voeg 19,2 ul RNase-vrij water en 0,8 pl RNASecure reagens (zie Materialen PDF) de pellet en incubeer bij 60 ° C gedurende 20 minuten om RNAses inactiveren.
  2. Bepaal de RNA-concentratie met een fluorescente RNA-bindende kleurstof zoals qubit RNA assay kit (zie Materialen PDF) met de QubitR 2,0 Fluorometer volgens het protocol van de fabrikant.
  3. Samenstel cDNA met een amplificeren reverse transcriptase zoals EpiScript Reverse Transcriptase kit en oligodT primers volgens de instructies van de fabrikant. Opmerking: doorgaans 50 tot 100 ng RNA genereert voldoende cDNA uitvoeren meerdere genexpressie analyses. Equivalente hoeveelheden pre-isolatie en na isolatie RNA worden gebruikt om cDNA te genereren.
  4. Voeg 180 ul nuclease-vrij water tot 20 ul cDNA monster om deze 10-voudig voor real-time kwantitatieve PCR (qPCR) analyse verdunnen. Deze verdunning is een belangrijke stap, omdat onverdunde cDNA monsters de qPCR kan remmen.
  5. Bereid een qPCR master mix met polymerase en dNTPs, 4 pmol elk van voorwaartse en achterwaartse primer, opgemaakt met steriel water om het uiteindelijke reactie volume van 20 pl.
    1. Ontwerp qPCR primers voor genen die verwacht worden uitgedrukt in het celtype van belang richten, en in het ontwikkelingsstadium waarin het weefsel wordt verzameld. Ontwerp van primers een intron omvatten, indien mogelijk, zodat genomische encDNA PCR producten kunnen worden onderscheiden. Opmerking: Als het genexpressieprofiel van het type doelcel niet bekend, primers tegen eGFP, die specifiek in het gelabelde kernen populatie moet worden uitgedrukt, kan worden gebruikt om het protocol optimaliseren voor een bepaald celtype en weefsels (Tabel 1).
  6. Bepaal de relatieve transcriptniveaus van elk gen van belang in de pre-en post-isolatie isolatie monsters door vergelijking met een verdunningsreeks van cDNA bereid uit de gehele weefsel. Transcriptniveaus van target genen moet worden genormaliseerd naar een referentie-gen zoals Rpl32 (of bij voorkeur meerdere referentie-genen).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De repo-GAL4 driver (Bloomington voorraad nummer 7415) is specifiek uitgedrukt in gliacellen in het Drosophila zenuwstelsel op meerdere stadia van ontwikkeling 18. Vliegen werden gegenereerd die stabiel tot expressie UAS-EGFP :: Msp-300 KASH onder controle van de repo-GAL4 via standaard genetische technieken. Om de expressie patroon van de EGFP :: KASH transgen in deze vliegen karakteriseren, het patroon van GFP-expressie in de ontleed optische kwab en oog verbeelding disc uit derde instar larven werd onderzocht met behulp van confocale microscopie. Ontlede weefsels werden tegengekleurd met DAPI DNA en α-chaoptin 19 markeren fotoreceptor axonen (mAb24B10 label, zie ook Materiaal PDF). Figuur 1A laat zien dat de repo-GAL4 gedreven EGFP :: wordt KASH transgene uitgedrukt in glia in de optische kwabben en oog imaginaire schijf in het verwachte patroon expressie. Onder grotere vergrotingEGFP expressie waargenomen in een cirkelvormig patroon rondom de DAPI-positieve DNA, consistent met kern-omhulsel lokalisatie van de EGFP :: KASH tag (Figuur 1B). EGFP expressie kan worden gedetecteerd zowel in vaste als in gefixeerde weefsels zonder dat signaalversterking gebruikmaking van een antilichaam tegen GFP; antilichamen tegen GFP werd niet gebruikt om de EGFP :: KASH expressie visualiseren in de figuren 1 en 2 afbeeldingen. Om te bepalen of het EGFP :: KASH transgen-specifiek uitgedrukt in andere weefsels in Drosophila larven werd GFP expressie in derde instar larven geheel onderzocht met een fluorescentie microscoop ontleden. Met name niet-specifieke expressie van het EGFP :: KASH transgen werd waargenomen bij hoge niveaus in de speekselklieren van derde instar larven. Dit geeft aan dat de archief-GAL4 bestuurder activiteit in een andere dan glia in het larvale ontwikkelingsstadium celtypen. Aldus specifiek isoleren glial kernen, de optische kwab en oog verbeelding disc uit derde instar larven werden geïsoleerd met behulp van dissectie voorafgaand aan homogenisering en affiniteit-isolatie.

Om te bevestigen dat dit protocol is geschikt voor het verwijderen van kernen uit Drosophila weefsels, en schatten van het percentage van gemerkte kernen aanwezig in een bepaald weefsel, de pre-isolatie monster (punt 2.6.2) van homogenaten verkregen van de optische kwab en ogen imaginale schijf van repo-GAL4, UAS-EGFP :: derde instar larven Msp-300 KASH onderzocht. een representatief beeld van de pre-isolatie monster Figuur 2A verkregen via confocale microscopie. In dit beeld, is de aanwezigheid van kernen aangegeven door DAPI-positieve gebeurtenissen. Een klein aantal dun verspreid GFP-positieve, DAPI-positieve gliale kernen zijn ook waargenomen. We schatten dat het GFP-positieve kernen goed voor minder dan 2% van de totale bevolking in deze kernenmonster (Figuur 2A). De totale opbrengst van kernen optische kwab en oog verbeelding schijven die werden uitgesneden uit 100 larven werd voor de pre-isolatie monster zoals in hoofdstuk 2.6.3 (tabel 2). Een typische pre-isolatie monster van 100 ontleed optische kwab en oog verbeelding schijven bevatten 0,8 tot 1,2 x 10 7 kernen, waarvan ongeveer 2% werden GFP-positieve een representatief beeld van DAPI-positieve kernen in een bepaald gebied. Figuur 2B toont van de hemocytometer. Merk op dat de kernen intact, en handhaven van een consistente cirkelvorm onder extractie omstandigheden die in het protocol (Figuren 2A en 2B).

Om te bepalen of dit protocol kan worden gebruikt voor het isoleren en / of verrijken zeer specifieke populaties van gemerkte kernen uit weefsels dat gemengde celpopulaties bevatten, α-GFP-antilichaam beklede magnetische korrels werden gebruiktd om getagde kernen te isoleren van homogenaten verkregen van de optische kwab en oog verbeelding schijf van 100 repo-GAL4, UAS-EGFP larven :: Msp-300 KASH derde larvestadium. In de figuren 2C en 2D, kan worden gezien dat de EGFP :: KASH tag gliale kernen binden aan de α-GFP beklede magnetische korrels en na magnetische scheiding waargenomen in de na-isolatie monster (punt 2.11.1). Hoewel de magnetische korrels vertonen sommige autofluorescentie in de GFP kanaal, kunnen deze gemakkelijk worden onderscheiden van bead-gebonden kernen door hun kleinere afmeting (2,8 urn voor de magnetische korrels versus ongeveer 5 urn voor de kernen) en gebrek aan DAPI kleuring. De GFP + / DAPI + kernen goed voor meer dan 95% van DAPI positieve gebeurtenissen in het post-isolatie monster. Aldus is de doelstelling gelabeld kernen bevolking sterk verrijkt in de post-isolatie monster ten opzichte van de pre-isolatiemonster. De meerderheid van de kernen in de post-isolatie sample tonen sterke nucleaire-envelop gelokaliseerde GFP-fluorescentie, en zijn meestal omringd door kralen. Het is echter mogelijk dat een klein aantal gecodeerde kernen aanwezig in dit monster zijn. Ofschoon de resultaten in Figuur 2C en de genexpressieanalyse in figuur 3 (zie onder) geven aan dat het doel gelabeld gliale kernen populatie sterk verrijkt, de mogelijkheid dat sommige kernen van andere niet-specifieke celtypen zijn ook aanwezig in het monster kan niet worden uitgesloten. Het wordt aanbevolen dat de gebruikers optimaal dit protocol voor het specifieke celtype en weefsel van belang voor de verrijking van de doelgroep kernen bevolking maximaliseren en niet-specifieke binding te elimineren kernen. Met name de verhouding van uitgangsmateriaal ten antilichaam en kralen waarschijnlijk om optimaal verrijking van target kernen zijn. Daarom varieert de totalekernen aantallen aanwezig in onze typische pre-isolatie monsters worden getoond in Tabel 2. Op basis van het totale aantal kernen aanwezig in het pre-isolatie monster en de geschatte hoeveelheid gliale cellen in de gemengde populatie van de optische kwab en oog verbeelding disc, werd de maximale opbrengst kernen in de na-isolatie monster wordt naar tussen 1,6 5 x 10 en 2,4 x 10 5 kernen. Bij gebruikmaking van de hemocytometer om de kernen rendement te bepalen, zoals beschreven in stap 2.6.3, de werkelijke kernen verkregen opbrengst in de na-isolatie monster werd tussen 1,3 x 10 4 en 2,7 x 10 4 kernen. Deze kernen opbrengst vertegenwoordigen zeer ruwe schatting omdat de in de na-isolatie monster korrels lijken nauwkeurig laden van de hemocytometer beïnvloeden. Sommige GFP-positieve kernen waargenomen in de ongebonden homogenaat, wat aangeeft dat niet alle GFP-positieve kernen in de svoldoende binden aan de kralen efficiënt onder de in dit protocol gebruikte omstandigheden. Vergroting tijde van binden of uitvoeren opeenvolgende isolatiestappen kan mogelijkerwijze de deze opbrengst, maar dit kan ten koste van zowel zuiverheid en RNA integriteit. De in dit protocol beschreven omstandigheden kunnen voldoende hoeveelheden RNA verkregen worden in de post-isolatie monster voor stroomafwaartse genexpressie analyse met qRT-PCR (Tabel 2). Zo, dit protocol is in staat om snel en streng isoleren doel kernen van weefsels die gemengde populaties van cellen bevatten. Bovendien is het in staat om specifiek te isoleren doel kernen die slechts een klein deel, minder dan 5% van de cellen in een gegeven populatie vormen.

Om verder te bevestigen dat de post-isolatie monster was sterk verrijkt zijn voor het gewenste gliale kernen bevolking, de niveaus van transcripten voor 4 verschillende genen in de pre-isolatie post-isolatie monsters werden vergeleken met RT-qPCR. Het transcript niveaus van elav, nrv2 en eGFP bepaald in de twee monsters en van de referentieantenne gen Rpl32, die wordt uitgedrukt op equivalente niveaus in gliacellen en in de omliggende centrale zenuwstelsel (figuur 3). De voudig verschil in de na-isolatie monster wordt getoond ten opzichte van de pre-isolatie monster wordt ingesteld op een. In figuur 3, de na-isolatie voorbeeld toont aanzienlijk lagere transcript niveaus van neuronale-specifiek gen elav opzichte van de pre-isolatie monster. Dit geeft aan dat de kernen van neuronale cellen zijn ondervertegenwoordigd in de post-isolatie monster. Daarentegen hogere transcriptie niveaus van zowel gliale verrijkte nrv2 gen 10 en eGFP in de post-isola zijntie monster ten opzichte van de pre-isolatie monster. Dit resultaat geeft aan dat de na-isolatie monster sterk verrijkt voor de doelgroep gliale kernen bevolking. Het is belangrijk op te merken dat het transcript niveaus gemeten in dit protocol vertegenwoordigen nucleaire transcripten, en kunnen daarom niveaus van actieve transcriptie plaats van steady-state mRNA geven. Vermeerderende repo werd niet opgemerkt bij onze pre-isolatie of na-isolatie monsters, wat suggereert dat de Gal4 eiwit door de repo-GAL4 automobilist kan blijven bestaan ​​na actieve transcriptie van het endogene repo gen heeft opgehouden. Dit is consistent met resultaten van andere studies waarin kernen geëtiketteerd met de TWI promoter blijkt niet verrijkte niveaus van TWI transcripten, wellicht als gevolg van verschillen in de ontwikkelingstiming van transcriptie versus eiwitstabiliteit 8. Taknl elkaar tonen deze resultaten aan dat de beschreven protocol succes kan worden gebruikt om zeer verrijken doel kernen van weefsels die gemengde populaties van cellen bevatten, en dat de geïsoleerde kernen zijn geschikt voor genexpressie analyse.

Figuur 1
Figuur 1. Expressiepatroon van repo-GAL4, UAS-EGFP :: Msp-300 KASH vliegen lijn. (A) In de derde instar larven, repo-GAL4 drijft expressie van de UAS-EGFP :: Msp-300 KASH transgen in gliacellen in de optiek kwab, optische steel (os) en oog verbeelding disc (ed.). De nucleaire enveloppe gliacellen wordt gelabeld met EGFP :: KASH (groen). R1 - R8 fotoreceptorcel axonen zijn gelabeld met α-chaoptin (mAB24B10, rood) voor de vergelijking, en DNA is stained met DAPI (paars). GFP-gelabelde gliale kernen zichtbaar langs de lamina (la) in de optische kwab (aangegeven door pijlen). Schaal bar, 50 um. (B) beeld Hogere vergroting van de lamina ganglia van de optische kwab die EGFP :: KASH bevat gelabelde gliale celkernen. Schaal bar, 50 um. Confocale beelden werden verkregen met behulp van een   40X / 1,30 olie of een   20X / 0,75 olie-immersie objectief, en het gebruik van excitatie / emissie golflengte van 408 nm nm/425-475 (DAPI); 488 nm/525-550 nm (GFP); 561 nm/595-620 nm (Alexa 5,6,8 ). Klik hier om een grotere versie van deze afbeelding te bekijken.

Figuur 2
Figuur 2. Karakterisering van kernenin "pre-isolatie" en "post-isolatie" samples. (A) representatief beeld van een repo-GAL4, UAS-EGFP :: Msp-300 KASH pre-isolatie monster geanalyseerd met behulp van een X 20 / 0.75 olie-immersie objectief en standaard confocale microscoop. DNA wordt gekleurd met DAPI (blauw), en EGFP :: KASH tag gliale kernen worden in het groen (gemarkeerd met pijlen). Schaal bar, 50 um. (B) representatief beeld van DAPI gekleurde kernen van een pre-isolatie monster op een hemocytometer met behulp van een X 10 lucht objectieve en standaard epifluorescentiemicroscoop. Hemocytometer roosters zijn weergegeven in lichtgrijs. Alleen DAPI-positieve kernen worden getoond in deze foto, zoals GFP-fluorescentie zichtbaar onder deze doelstelling op de epifluorescentiemicroscoop was niet. (C) representatief beeld van een repo-GAL4, UAS-EGFP :: Msp-300 KASH post-isolatie monstergeanalyseerd zoals beschreven voor paneel A. Geïsoleerd EGFP :: KASH getagd gliale kernen (aangegeven door pijlen) kleuring positief voor DAPI, en worden omringd door de korrels die autofluoresce op lage niveaus in de GFP kanaal. Schaal bar, 50 um. (D) beeld Hogere vergroting van een typisch geïsoleerde EGFP :: KASH getagd gliale kernen (gemarkeerd met pijl) omgeven door kralen. Schaal bar, 5 micrometer. Klik hier om een grotere versie van deze afbeelding te bekijken.

Figuur 3
Figuur 3. Vertegenwoordiger qRT-PCR data van "pre-isolatie" en "post-isolatie" samples. Transcriptniveaus van target genen werden bepaald door qRT-PCR van pre-isolverkregen uit repo-GAL4, UAS-EGFP :: Msp-300 KASH optische kwabben en oog verbeelding schijven atie en post-isolatie monsters. Alle transcriptniveaus zijn genormaliseerd om Rpl32 transcript niveaus, en de pre-isolatie monster per gendoel is ingesteld op een. Representatieve resultaten van het ene biologische experiment worden getoond voor de volgende genen: elav, nrv2 en eGFP.

Gen Primer sequentie (5 '-3') Afmeting PCR product (bp)
eGFP GAGGGATACGTGCAGGAGAG 102
GATCCTGTTGACGAGGGTGT
nrv2 GGCTGGTTGTAGTCGCAGTT 125
GGCACCCAACACGAGAACTA
elav GCACCATTCGGAGCAATAAT 153
TGTGCAGCTGGATGGTGTAG
Rpl32 GCTAAGCTGTCGCACAAATG 160
CGTTGTGCACCAGGAACTT

Tabel 1. Primers voor qRT-PCR analyse.

Totaal aantal kernen in de pre-isolatie monster Geraamde totale aantal kernen in post-isolatie monster RNA opbrengst uit post-isolatie monster (ng)
0,8-1,2 x 10 7 1,3-2,7 x 10 4 160-220 ng

Tabel 2. Representatieve kernen en RNA opbrengst verkregen.Typische reeksen kernen en RNA opbrengsten verkregen uit pre-isolatie-en post-isolatie monsters van 100 ontleed optische kwab en oog imaginaire schijven uit de repo-GAL4, UAS-EGFP :: Msp-300 KASH genotype, waarin gliacellen zijn gelabeld met EGFP :: KASH. Kernen werden gekwantificeerd zoals beschreven in 2.6.3 en RNA werd gekwantificeerd zoals beschreven in 3.1.2.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dit protocol kan worden gebruikt voor het isoleren of verrijken zeer specifiek gelabeld kernen van gemengde celpopulaties in Drosophila embryonale en larvale weefsels. Met dit protocol kunnen worden geïsoleerd uit kernen ontleed weefsel in ongeveer 1 uur. De zuiverheid en de opbrengst van de geïsoleerde kernen moet proefondervindelijk worden bepaald voor elk type cel. Het kan moeilijk zijn om de kraal gebonden kernen kwantificeren bij de post-isolatie fase van het protocol met behulp van een hemocytometer vanwege de in het monster aanwezige korrels. Dus om exacte aantal kernen die voor een stroomafwaartse toepassing is het nodig te schatten kernen opbrengst op basis van een alternatieve werkwijze zoals DNA inhoud. Exacte berekeningen kernen oogsten zijn niet noodzakelijk genexpressieanalyse of RNA succes kan worden geïsoleerd en gekwantificeerd. Het wordt aanbevolen om een ​​fluorescentie gebaseerde methode voor het kwantificeren van RNA-opbrengst, zoals we hebben geconstateerd dat spectrofotometrische bepaling van de RNA-concentratiein deze lage concentratie monsters is zeer variabel.

Er zijn twee belangrijke aspecten van het protocol dat het succes zal beïnvloeden: de keuze van de magnetische korrels en antilichaam. Magnetische kralen die zijn gekoppeld aan GFP of proteïne G zijn commercieel verkrijgbaar uit verschillende bronnen. Het is echter sterk aanbevolen om het eiwit G magnetische korrels verkrijgbaar bij Invitrogen gebruiken voor de in dit protocol beschreven voor twee belangrijke redenen procedure. Ten eerste, de grootte van de Invitrogen bolletjes op 2,8 urn is iets kleiner dan de gemiddelde grootte van de kernen in de celtypen die we hebben onderzocht, namelijk ongeveer 5 micrometer (Figuur 2D). Magnetische korrels die kleiner zijn (bv. 50 nm, μMACS α-GFP, Miltenyi Biotech) niet snel binden aan batch-wash stijl magneten, en de kolommen voorzien voor deze kralen kunnen verstoppen met larvale weefsel extracten. Grotere magnetische korrels (bijvoorbeeld 10 urn, PureProteome proteïne G magnetische bEADS, Millipore) niet goed binden aan de kernen in onze inleidende tests, en deze vertonen eveneens sterke autofluorescentie in dezelfde kanalen als zowel DAPI en GFP, waardoor het moeilijk kernen in de kralen gebonden monster te identificeren door standaard microscopische technieken. Naast de keuze van de magnetische korrels, is het belangrijk om een ​​GFP antilichaam dat goed werkt voor immunoprecipitatie maar die geen hoge-specifieke achtergrond gebruik. Om te helpen bij de reproduceerbaarheid van dit protocol, hebben we een monoklonaal antilichaam muis gebruikt tegen GFP. Polyklonale konijnen antilichamen tegen GFP werden ook met succes uitgetest in onze voorstudies, maar deze neiging om hogere niet-specifieke achtergrond hebben. Andere monoklonale antilichamen werden ook getest (bv. Developmental Studies Hybridoma Bank), met wisselend succes. Aldus antilichaam keuze een belangrijke factor in de succesvolle isolatie van gelabelde kernen.

Hoewel we in dit protocol beschrijven methoden om dethermelijn gen transcript niveaus in geïsoleerde kernen, wordt verwacht dat de in stap 2,1-2,11 beschreven benadering ook geschikt voor het isoleren van kernen die kunnen worden gebruikt voor verdere chromatine immunoprecipitatie analyse zijn. Als weefsel is opgelost in 1% formaldehyde voorafgaand aan homogenisering (stap 2.3), kan vervolgens ontleed weefsels worden verzameld over meerdere dagen en voldoende materiaal geïsoleerd chromatine immunoprecipitatie analyses uit te voeren. Gebaseerd op tellingen verkregen met de hemocytometer, die op ruwe schattingen als hierboven beschreven, hebben we meestal verkregen 1,3 x 10 4 en 2,7 x 10 4 gliale kernen van het oog denkbeeldige schijf en optische kwab van 100 larven (Tabel 2). Dus, door onze benadering, moet mogelijk zijn om voldoende materiaal te verkrijgen chromatine immunoprecipitatie analyses uit te voeren, afhankelijk van de overvloed van het beoogde celtype en het epitoop van belang.

Een bruikbare genetische toepassing van deze technischeque is dat het kan worden gebruikt om positief etiket kernen in bepaalde celtypes in embryo's en larven die homozygoot voor een recessief dodelijke mutant allel. Hiertoe moeten twee fly bestanden zijn waarmee het mutante allel van belang wordt gerecombineerd met een specifiek Gal4 driver of met de UAS-EGFP :: Msp-300 KASH transgen op het chromosoom. Als vliegen die het mutante allel en Gal4 driver worden gekruist met vliegen die de mutante allelen en de UAS-EGFP :: Msp-300 KASH transgen slechts nakomelingen die beide kopieën van het mutante allel wordt met GFP in het weefsel worden geëtiketteerd waarin de Gal4 driver wordt uitgedrukt. Aldus kan celspecifieke effecten van recessieve letale allelen worden onderzocht of de embryonale larvale stadia vóór het stadium van letaliteit. Deze genetische techniek is eerder gebruikt om positief label cellen in embryonale spier die homozygoot mutaties waren de SAGA subeenheid sgf11 1 </ Sup>.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Wij danken Janice Fischer voor het verstrekken van de UAS-EGFP :: Msp-300 KASH plasmide. De mAB24B10 antilichaam werd verkregen van de Developmental Studies Hybridoma Bank ontwikkeld onder auspiciën van de NICHD en onderhouden door de Universiteit van Iowa, Departement Biologie. De repo-GAL4 voorraad (BL7415) werd verkregen uit de Bloomington Stock Center aan de Universiteit van Indiana. Steun van de American Cancer Society Institutioneel Onderzoek Subsidie ​​(IRG # 58-006-53) aan de Purdue University Center for Cancer Research is dankbaar erkend. Jingqun Ma wordt ondersteund door een landbouwkundig onderzoek aan de Purdue-assistentschap in Voedsel-en Landbouworganisatie van de Purdue University.

Materials

Name Company Catalog Number Comments
Anti-chaoptin antibody (mouse, monoclonal) Developmental Studies Hybridoma Bank mAB24B10
Anti-GFP antibody (mouse, monoclonal) Roche 11814460001 This specific antibody is recommended for this protocol. However, alternative antibodies could also be used.
2x Bullseye EvaGreen qPCR Mastermix with ROX MidSci BEQPCR-R
DAPI (4',6-diamidino-2-phenylindole, dihydrochloride salt) Biotium 40011
Dounce Homogenizer (1 ml) VWR 62400-595
Dumont #5 Tweezers, 11 cm World Precision Instruments 14095
Dynabeads Protein G for Immunoprecipitation Invitrogen 10003D This specific brand of magnetic beads is recommended for this protocol.
EpiScript Reverse Transcriptase Epicentre ERT12910K http://www.epibio.com/docs/default-source/protocols/episcript-reverse-transcriptase.pdf
Falcon cell strainers, 40 μm pore size VWR 21008-949 Alternative pore sizes could be used, depending on the size of the target cell nuclei.
Magnetic stand (8 x 1.5 ml tubes) Millipore LSKMAGS08 
Mini tube rotator Genemate H-6700
Qubit starter kit Life Technologies Q32871 Similar fluorescence-based methods for quantifying RNA yield could be used. http://tools.invitrogen.com/content/sfs/manuals/mp32852.pdfZ
RNAsecure (Ambion) Life Technologies AM7010 The use of this reagent to inactivate RNAses is optional.
RT-PCR machine Thermal Cycler BioRad CFX Connect Thermal Cycler
Siliconized 9-well glass plate Hampton Research HR3-134
Stereomicroscope Fluorescence Adapter (Royal Blue (440-460 nm) excitation + yellow barrier Nightsea This adaptor enables GFP fluorescence to be examined using a typical dissecting microscope (eg Nikon)
StereoZoom Microscope 83604 Set with 10X Wide Field Eyepieces and Universal Boom Stand Nikon SMZ 745
Thermal Cycler BioRad T100
Trizol reagent Life Technologies 15596018 CAUTION; Alternative RNA extraction methods can be used. http://tools.invitrogen.com/content/sfs/manuals/trizol_reagent.pdf
Tween 20 Amresco 0777-1L

DOWNLOAD MATERIALS LIST

References

  1. Weake, V. M., et al. Post-transcription initiation function of the ubiquitous SAGA complex in tissue-specific gene activation. Genes Dev. 25, 1499-1509 (2011).
  2. Bonn, S., et al. Cell type-specific chromatin immunoprecipitation from multicellular complex samples using BiTS-ChIP. Nat. Protoc. 7, 978-994 (2012).
  3. Haenni, S., et al. Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq. Nucleic Acids Res. 40, 6304-6318 (2012).
  4. Barthelson, R. A., Lambert, G. M., Vanier, C., Lynch, R. M., Galbraith, D. W. Comparison of the contributions of the nuclear and cytoplasmic compartments to global gene expression in human cells. BMC Genom. 8, 340 (2007).
  5. Zhang, C., Barthelson, R. A., Lambert, G. M., Galbraith, D. W. Global characterization of cell-specific gene expression through fluorescence-activated sorting of nuclei. Plant Physiol. 147, 30-40 (2008).
  6. Deal, R. B., Henikoff, S. The INTACT method for cell type-specific gene expression and chromatin profiling in Arabidopsis thaliana. Nat. Protoc. 6, 56-68 (2011).
  7. Deal, R. B., Henikoff, S. A simple method for gene expression and chromatin profiling of individual cell types within a tissue. Dev Cell. 18, 1030-1040 (2010).
  8. Steiner, F. A., Talbert, P. B., Kasinathan, S., Deal, R. B., Henikoff, S. Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling. Genom. Res. 22, 766-777 (2012).
  9. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, 401-415 (1993).
  10. Henry, G. L., Davis, F. P., Picard, S., Eddy, S. R. Cell type-specific genomics of Drosophila neurons. Nucleic Acids res. 40, 9691-9704 (2012).
  11. Starr, D. A. KASH and SUN proteins. Curr Biol. 21, 414-415 (2011).
  12. Fischer, J. A., et al. Drosophila klarsicht has distinct subcellular localization domains for nuclear envelope and microtubule localization in the eye. Genetics. 168, 1385-1393 (2004).
  13. Patterson, K., et al. The functions of Klarsicht and nuclear lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye. Mol. Biol. Cell. 15, 600-610 (2004).
  14. Yu, J., et al. The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Dev. Biol. 289, 336-345 (2006).
  15. Bischof, J., Maeda, R. K., Hediger, M., Karch, F., Basler, K. An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc. Natl. Acad. Sci. U.S.A. 104, 3312-3317 (2007).
  16. Kracklauer, M. P., Banks, S. M., Xie, X., Wu, Y., Fischer, J. A. Drosophila klaroid encodes a SUN domain protein required for Klarsicht localization to the nuclear envelope and nuclear migration in the eye. Fly. 1, 75-85 (2007).
  17. Markstein, M., Pitsouli, C., Villalta, C., Celniker, S. E., Perrimon, N. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat. Genet. 40, 476-483 (2008).
  18. Sepp, K. J., Schulte, J., Auld, V. J. Peripheral glia direct axon guidance across the CNS/PNS transition zone. Dev. Biol. 238, 47-63 (2001).
  19. Fujita, S. C., Zipursky, S. L., Benzer, S., Ferrus, A., Shotwell, S. L. Monoclonal antibodies against the Drosophila nervous system. Proc. Natl. Acad. Sci. U.S.A. 79, 7929-7933 (1982).
-Affiniteit gebaseerde Isolatie van Tagged Kernen uit<em&gt; Drosophila</em&gt; Tissues voor de analyse van genexpressie
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).More

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter