Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Dan Tagged Çekirdeğin Affinity-tabanlı yalıtım doi: 10.3791/51418 Published: March 25, 2014

Summary

Drosophila dokusu sık sık hücre tipleri heterojen bir karışım içerir. Belirli bir doku, spesifik hücre tiplerinde gen ekspresyonunu incelemek için, çekirdekler, genetik olarak etiketlendi ve daha sonra bir afinite dayalı bir yaklaşım kullanılarak izole edilebilir. İzole edilmiş çekirdek bu gen ekspresyon analizi ve kromatin immüno olarak alt uygulamalar için kullanılabilir.

Abstract

Drosophila melanogaster embriyonik ve larva dokular genellikle bu dokularda gen ekspresyon analizi karmaşık hücre türleri arasında yüksek ölçüde heterojen bir karışımı içerir. Bu nedenle, Drosophila dokulardan hücreye spesifik gen ekspresyon profillerini analiz etmek için, yüksek saflıkta ve bu transkripsiyon profil ve kromatin immüno olarak alt uygulamalar için yeterli bir verimde özel hücre tiplerini izole etmek için gerekli olabilir. Bununla birlikte, bu dokularda spesifik hücre tipleri nadir nüfusu ile birleştiğinde örneğin merkezi sinir sistemi gibi dokularda düzensiz hücre morfolojisi, ayırma lazer mikro-kesim ve floresans ile aktive edilmiş hücre gibi hücre izolasyonu için geleneksel yöntemlerle (FACS) zorluklar oluşturabilir . Burada, etiketlenmiş çekirdeklerin afinite bazlı izolasyon yerine, tüm hücreleri kullanılarak hücre spesifik gen ekspresyon profillerini karakterize için alternatif bir yaklaşım tarif edilmektedir. Belirli c çekirdeklerilgi ell tür genetik olarak Gal4/UAS ikili sentezleme sistemi kullanılarak bir çekirdek zarı-lokalize EGFP etiket ile etiketlenir. Bu EGFP-etiketli çekirdekleri manyetik boncuklara bağlanmış olan GFP karşı antikorlar kullanılarak izole edilebilir. Bu protokol açıklanan yaklaşım, bu hücre tipleri, toplam hücre popülasyonunun en az% 2 edilmiş olsa dahi, yüksek saflıkta Drosophila larva, merkezi sinir sisteminde ve ekspresyon analizi için yeterli seviyelerde özel hücre tiplerinden çekirdeklerinin tutarlı izolasyonu sağlar doku. Bu yaklaşım, Drosophila embriyonik ve belirli Gal4 sürücüleri kullanarak larva hücre tipleri çok çeşitli çekirdek izole etmek için kullanılabilir, ve FACS veya lazer mikro-kesim için uygun değildir hücre tiplerinden olan çekirdek izole edilmesi için faydalı olabilir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Gibi, merkezi sinir sistemi gibi dokularda Drosophila hücre tipleri karmaşık bir karışımını içerir. Bu nedenle, Drosophila dokulardan hücreye spesifik gen ekspresyon profillerini analiz etmek için, bu alt uygulamaları sağlamak için yeterli miktarlarda spesifik hücrelere homojen bir popülasyonu izole etmek için ilk olarak gereklidir. Dokulara hücreleri izole etmek için yöntemler lazer mikrodiseksiyon ve bütün hücre sınıflandırması (FACS) floresan-aktive edilmiş hücre içerir. FACS 1-3 gen ekspresyonu ve kromatin için Drosophila embriyolardan ve Caenorhabditis elegans hücreler ve çekirdekler izole etmek için kullanılmış olsa da, FACS ve lazer mikrodiseksiyon yüksek harmanlanmış hücre tipleri ya da içeren hücreler ile birlikte içeren dokularda başarılı bir şekilde gerçekleştirmek zor olabilir nöronlar gibi düzensiz morfolojisi. Bu zorluğun üstesinden gelmek için, çok hücrelere göre çekirdek, özel hücre tipleri izole edilmiştir ve daha sonra gen için kullanılabilire ekspresyon profili. Önemli olarak, nükleer RNA numuneleri kullanılarak mikro-dizi-bazlı mRNA ifadesi analiz, toplam RNA 4, 5 kullanılarak gerçekleştirilmiştir genel olarak benzer sonuçlar göstermektedir. Ayrıca, nükleer RNA kullanılarak gen ekspresyon analizi başarılı bir şekilde C de dahil olmak üzere bir çok mikroorganizma gen ifadesini incelemek için kullanılmıştır elegans, Arabidopsis thaliana, Drosophila ve insanlar 4, 5, 2, 3.

Yakın zamanda çeşitli yaklaşımlar gen ekspresyon analizi ve / veya kromatin immüno için uygun olan Drosophila dokulardan etiketli çekirdeklerinin özel popülasyonlarının izole edilmesi için anlatılmıştır. Immünopresipitasyon (bit çipli) yöntemi için dokuya özel kromatin toplu izolasyonu nükleer lokalize GFP 2'nin hücre türüne özgü ifade bazında sabit bir çekirdek izole etmek için FACS kullanır. Bu yaklaşım, su olmuşturccessfully Drosophila embriyoların 2'nin mezodermden izole edilmiş çekirdeklerin Kromatin immüno-çökeltmesi kullanılarak histon modifikasyon ve transkripsiyon faktörlerinin dağılımı analiz etmek için kullanılır. Bununla birlikte, FACS-bazlı yaklaşımlar nedeniyle alt uygulamalar için uygun numaraları elde etmek için gerekli olan yüksek sıralama zaman bir karışık nüfusun sadece küçük bir kısmını oluşturan etiketli çekirdek izole edilmesi için daha az uygun olabilir. Bu sınırlamaların üstesinden gelmek için, birkaç grup özel bir hücre tipinde belirli bir epitop ile etiketlenir çekirdek saflaştırılması için afinite bazlı izolasyon teknikleri kullandık. Arabidopsis thaliana 6, 7 kullanılmak için geliştirilmiş, özel hücre tipleri (bozulmamış) yöntemi etiketli çekirdeklerin son izolasyonu Drosophila 8 kullanılmak üzere adapte edilmiştir. Bu yöntemde, in vivo biyotinilasyon için bir substrat olan bir çekirdek zarı füzyon proteini olup coexpresspesifik hücre tiplerinde Escherichia coli biotin ligazı BirA ile sed. Biotin-etiketli çekirdekler ardından streptavidin bazlı afinite izolasyonu kullanarak karışık popülasyonlardan saflaştırılabilir. Bu yaklaşımı kullanarak, çekirdek çekirdek zarı başarılı bir füzyon proteini, bir mezoderm özgü arttırıcı 8 kontrolü altında eksprese edildiği, Drosophila embriyoların mezodermden etiketlenmiş ve izole edilmiştir. Yazarlar ayrıca, Gal4 düzenleyici dizi, UAS 9 kontrolü altında, herhangi bir hücre tipinde ifade edilebilir çekirdek zarı füzyon proteinlerini oluşturulur. Bu yaklaşım, hızlı bir şekilde karışık nüfusu etiketli çekirdeklerinin alt kümelerini izole edilmesi yeteneğine sahiptir, ama üç farklı transjenik yapıları gerektirir ve bu nedenle de, özellikle genetik uygulamalar için uygun olabilir. Son zamanlarda, bir yaklaşım SUN (S AD1 ve UN C-84), nükleer zarfın iç zarına lokalize etki alanı içeren proteinler ile etiketlendi edildiği tarif edilmiştirfloresan proteinleri ve Gal4/UAS sisteminin 10 kontrolü altında ifade edilmiştir. Çekirdekler nükleer zarfın dış zar kaldırmak için iyonik olmayan deterjanın varlığında, izole edilir ve anti-GFP antikorları bağlanmış manyetik boncuklar kullanılarak afiniteyle saflaştırıldı. Bu yaklaşım, Drosophila 10 yetişkin beyin içinde spesifik sinir hücresi alt tiplerinin etiketli çekirdeklerin küçük popülasyonlarının izole edilmesi için kullanılmıştır.

Burada, Drosophila larva dokudan hücrelerin karışık bir nüfusu etiketli çekirdeklerin izolasyonu için bir protokolü tarif edilmektedir. Bu yöntem, bağımsız bir şekilde, geliştirilmiş, ancak Henry vd. 10 Birinci tarafından açıklanan yaklaşım benzer olan, çekirdek karışık popülasyonlarında etiketli çekirdeklerin daha sonra izole edilmesini kolaylaştırmak için, sadece Drosophila melanogaster, spesifik hücre tiplerinde ifade edilen bir floresan etiket ile etiketlenmiş afinite-temelli bir yaklaşım kullanarak. Çekirdekler etiketlemek için,KASH (K larsicht / A nc-1 / S yne h omology) etki kullanılmıştır. KASH etki perinükleer alanı 11 içinde SUN etki alanı içeren proteinleri ile etkileşim yoluyla kısmen nükleer zarfın dış membran, lokalize bir transmembran etki alanıdır. Bunların N-terminal etki alanları, örneğin sitoplazma içinde 12-14, aktin ya da mikro tüpler gibi hücre iskeleti proteinleri ile etkileşim sırasında Drosophila Msp-300 ve Klarsicht gibi proteinlerin C-terminal KASH etki, dış nükleer membran proteinleri için, bu tutturur. Konstruktlar hangi Drosophila Msp-300 KASH etki pUAST-attB vektörü 15, 16 'de Gal4 düzenleyici dizi, UAS kontrolü altında, EGFP C-terminine kaynaştırılmıştır üretilmiştir. PhiC31 siteye özgü entegrasyon kullanılarak, transjenik sinekler oluşturulan UAS-EGFP :: Msp-300 KASH transgen kromozomu üzerindeki attP2 lokus olarak sokulmuştur hangi3L 17. UAS-EGFP :: Msp-300 KASH uçan, ilgi konusu bir hücre tipinde dış çekirdek zar üzerinde EGFP hedeflenen eksprese edilmesine yol açan, özel bir hücre tipinde ifade Gal4 sürücü sinek ile çaprazlanabilir. Etiketli çekirdekleri daha sonra manyetik boncuklara bağlanmış GFP karşı antikorlar kullanarak karışık hücre popülasyonlarından saflaştırılabilir. Bu yaklaşımda, iyonik olmayan deterjanın kullanımı EGFP etiket dış çekirdek zarının sitoplazmik yanı lokalize olduğu için gerekli olan ve bu nedenle, antikorlar için erişilebilir değildir.

Aşağıda tarif edilen protokol saflık ve izole edilmiş verimi çekirdeklerin ölçmek için, Drosophila larva dokularda spesifik hücre tiplerinden EGFP etiketli çekirdek zenginleştirmek / izole etmek ve (kantitatif ters transkripsiyon polimeraz zincir reaksiyonu için uygun nükleer RNA çıkarmak için kullanılabilir qRT -PCR) gen ekspresyon analizi. Çekirdeklerin izolasyonu ve afiniteyle saflaştırma (tissu hariçdiseksiyon e) en az bir saat içinde gerçekleştirilebilir. Sonuçlar glial çekirdekleri başarıyla larva optik lob ve göz hayali diskten izole edilir ve daha sonra gen ekspresyon analizi için kullanılabileceğini gösteren sunulmaktadır. Bu yaklaşım, hedef hücreler, genel nüfusun% 5'ten az teşkil eden embriyonik ve larva dokularından etiketli çekirdeklerin izolasyon / zenginleştirilmesi için yararlı olacağı tahmin edilmektedir. Bu çalışmada oluşturulan tüm Drosophila hisse senetleri ve plazmalar istek üzerine yazarlarda mevcuttur.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1.. EGFP üretimi ve karakterizasyonu :: KASH Drosophila

  1. Çapraz Gal4 sürücü Msp-300 KASH uçar UAS-EGFP'nin :: uçar. Alternatif olarak, sürücü ve Gal4 UAS-EGFP :: Msp-300 KASH transgeni taşıyan yeniden birleştirici hem de sinekler standart genetik teknikleri kullanılarak oluşturulabilir. Döl sayıda gerekmektedir, bu ikinci bir yaklaşım, avantajlıdır.
  2. Standart mikroskopi teknikleri kullanarak EGFP :: KASH işaretleyicinin ekspresyonunu karakterize eder. Not: EGFP ekspresyonu ya da bütün larvaları, kesilmiş, sabitlenmiş Drosophila dokularda standart mikroskopi teknikleri ile gözlenebilir, ve bir antikorun kullanımını gerektirmez.
    1. EGFP ifade modelini belirleyecektir :: flöresanlı bir diseksiyon mikroskobu altında tüm organizma içinde KASH işaretleyici (Malzemeler PDF bakınız). Not: Şekil 1 'de gösterilen Repo-GAL4 sürücü, sergi n sürücüleri dahil olmak üzere birçok Gal4,Ancak tükürük bezi gibi diğer larva dokularda ifade onspecific kalıpları (Sonuçlar bakınız).
    2. Konfokal mikroskopi kullanılarak ilgilenilen kesilir dokusundaki EGFP :: KASH ekspresyon modelini analiz edin.
      1. EGFP lokalizasyonunu :: DNA'ya KASH etiket göreli görselleştirmek için 0.1 ug / ml 'lik bir nihai konsantrasyonda DAPI kullanılarak, nihai konsantrasyonu% 4 ve leke DNA de formaldehit kullanılarak, ilgi konusu doku tespit edin.
      2. Ilgi dokusunun büyüklüğüne bağlı 40X / 1.30 immersiyon yağı hedefi veya 20X / 0.75 immersiyon yağı hedefi, kullanarak görüntü kazanır. Aşağıdaki uyarım / emisyon şartlar görüntü elde etmek için kullanılabilir: 408 nm nm/425-475 (DAPI), 488 nm / 525-550 nm (GFP).

2. Drosophila Larvaların Dokular Çekirdeği izole

  1. Larva doku diseksiyonu ve sonraki çekirdekler izolasyon ekipmanları hazırlayın. NotBütün dechorionated embriyoları, aynı zamanda eğer istenirse başlangıç ​​maddesi olarak kullanılabilir. Bu ilgi, hücre tipi, hayali disk gibi belirli bir dokuda mevcut ise yerine tüm larvalara göre kısmen kesilmiş, larva dokularından kullanılması önerilir. Bu spesifik olmayan bağlanma azaltır, ve aynı zamanda hedef olmayan hücrelerde bir Gal4 sürücüsü ifade neden olabilir sorunları ortadan kaldırır.
    1. (Malzeme PDF görmek) keskin forseps iki çift hazırlayın, bir silikonlu 9-sıra cam plaka (Malzeme PDF görmek) ve PBT (1x PBS, pH 7.4;% 0.1 Tween-20).
    2. Manyetik boncuk GFP antikor Prebind. Bu adım diseksiyonu başlamadan önce başlanmalıdır. Yıkama tamponunun 400 ul (Malzemeler PDF bakınız, Roche) manyetik boncuk 10 ul (Invitrogen, malzemeler PDF) ve GFP antikor 2 ug ekle (1 x PBS, pH 7.4, 2.5 mM MgCI2) 1.5 ml bir tüp içinde . Gerektiğinde kullanılan boncuk ve antikor miktarı, sam hedefin miktarına göre optimize edilebilirple ve tanelere antikorun bağlanma afinitesi.
    3. , Oda sıcaklığında en az 30 dakika boyunca rotasyon ile boncuk ve antikorun inkübe edin.
    4. Manyetik rafa boncuklar ve antikor ihtiva eden 1.5 ml bir tüp (Malzeme PDF bakınız) yerleştirin ve boncuklar yaklaşık 1-2 dakika boyunca, manyetik bağlamaya olanak sağlar. Ilişkisiz antikor içeren süpernatantı ve 1 ml pipet kullanarak yıkama tamponu. Boncuklar mıknatıs bitişik tarafında 1.5 ml tüpün duvarına bağlı kalacaktır.
    5. Bölüm 2.1.4 'de tarif edildiği gibi her yıkama tampon içinde, 1 ml ile iki kez boncuk durulayın. Manyetik raftan 1.5 ml tüp çıkarın ve boncuk karıştırın ve her yıkama adımında yıkama tamponu kısaca ters.
    6. Adım 2.7 ile devam etmek için hazır olana kadar yıkama tamponu içinde antikor-bağlı boncuk saklayın. Boncuklar protokol herhangi bir aşamasında kurumasına izin verilmemelidir.
  2. PBT, larva dokularından inceleyin ve etmek için parçalandı dokular aktarmak9-iyi bir yemeğin biri iyi. Tipik haliyle, 100, üçüncü instar larvaları arasındaki optik lob ve göz hayali diskin diseksiyon çekirdekleri ayrılmasından sonra, aşağı doğru gen ekspresyon analizi için yeterli malzeme sağlar.
  3. Nükleer ekstre tamponu içinde izole edilmiş doku durulayın (10 mM HEPES-KOH, pH 7.5; 2.5 mM MgCI2, 10 mM KCI), 1.5 ml bir tüp içinde. Taze nükleer ekstre tamponu içeren 1 ml buz üzerinde (Malzemeler PDF bakınız), 1 ml Dounce homojenizatörü içine izole edilmiş larva dokuları aktarın. 5 dakika boyunca buz üzerinde inkübe edin. Bu RNA izolasyonu çekirdekleri aşağıdaki ekstre edilecek ise, proteaz inhibitörlerinin eklemek gerekli değildir.
  4. Gevşek havan tokmağı ile 20 darbeleri doku bozabilir ve daha sonra hücreler, şişmeye imkan vermek için 10 dakika boyunca buz üzerinde inkübe örnek. Sıkı havan tokmağı ile 15 vuruş kullanılarak hücrelerden çekirdek ekstrakte edin. Gevşek ve sıkı bir havan elleri ile dokunuşların sayısı farklı dokular ve hücre tipleri için optimize edilmesi gerekmektedir, aşırı homojen hale getirme neden olabiliryetersiz homojenleştirme dokudan tüm çekirdeklerin ayıklamak olmaz ise, çekirdek makaslanmış.
  5. Nükleer homojenizasyon tampon maddesi ile prerinsed edilmiş bir 40 mikron gözenek boyutlu süzgeç (Malzemeler PDF bakınız) sayesinde, hücreler ve hücre artıklarının içeren Homojenat, filtre. Yeni bir tüp içinde, süzüldü Homojenat toplayın.
  6. Çekirdekler verim, çekirdekleri bütünlüğünü belirlemek için, ve izolasyon çekirdeklerin önce hedef genlerin transkript seviyelerini belirlemek için bir sonraki analiz için ön izolasyon örnekleri toplayın.
    1. Bir pipet kullanarak yeni bir 1.5 ml tüp aktarın süzüldü homojenat 50 ul. Bu, ön yalıtım örneğidir. Trizol tepkin 500 ul ekleyin sonradan RNA izolasyonu (adım 3.1) -20 ° C'de, karıştırmak için invert ve mağaza (Malzeme PDF, DİKKAT bakınız).
    2. Yeni bir 1.5 ml tüp aktarın süzüldü homojenat 20 ul.
      1. 0.1 ug / ml 'lik bir son konsantrasyona DAPI ekleyin ve inc10 dakika boyunca buz üzerinde Ubate örneği.
      2. Bir poli-lisin kaplı lamel DAPI ile boyanmış çekirdek transferi ve bir mikroskop lamı üzerine yerleştirin. Net oje kullanarak lamel kapatılmalıdır.
      3. Çekirdekler bütünlük ve floresan mikroskop kullanılarak ilgi GFP-etiketli çekirdeklerin varlığı kontrol edin. Not: Bu, çekirdekleri gidermek için, veya bunların slaytlar (24 saat içinde) hazırlanması Aşağıdaki oldukça hızlı bir şekilde analiz edilir ise GFP için leke için gerekli değildir.
    3. Yeni bir 1.5 ml tüp aktarın süzüldü homojenat 10 ul yıkama tamponu ve 90 ul (1 x PBS, pH 7.4, 2.5 mM MgCI2) ekleyin. 0.1 ug / ml 'lik bir son konsantrasyona DAPI ekleyin ve 10 dakika boyunca buz üzerinde inkübe edilir. 10X hava objektif altında Epifloresans kullanarak DAPI-pozitif çekirdeklerin saymak Hemasitometre kullanarak ön-izolasyon numunesinde çekirdekleri verimi belirlemek.
  7. Manyetik bir rafa (bölüm 2.1.6 hazırlandı) antikor-bağlı boncuklar ihtiva eden 1.5 ml tüp yerleştirinve bölüm 2.1.4 'de tarif edildiği gibi, manyetik boncuklar, en az 2 dakika boyunca mıknatısın bağlamak için izin verir. 1 ml pipet kullanarak antikora bağlı boncuklardan yıkama tamponunu çıkarın ve 1 ml bir pipet kullanılarak 1.5 ml tüp aşama 2.5 'ten süzüldü Homojenat ekleyin.
  8. Hafifçe karıştırmak için tüpü birkaç kez ters çevirin ve uçtan uca fazla çalkalama ile 30 dakika boyunca 4 ° C'de inkübe edin. Mümkünse, bu çekirdeklerin topaklanma neden olabilir bu yana tüp içinde kabarcıklar kaçının.
  9. Manyetik bir rafa antikor-bağlı boncuklar ve Homojenat ihtiva eden 1.5 ml tüp yerleştirin ve bölüm 2.1.4 'de tarif edildiği gibi, manyetik boncuklar, en az 2 dakika boyunca mıknatısın bağlamak için izin verir. 1 ml pipet kullanarak, bağlanmamış çekirdekleri fraksiyonu içeren Homojenat çıkarın.
  10. Yıkama 3x 1 ml her tampon örnek yıkayın. Tarif edildiği gibi boncuklar, bağlı çekirdek içeren 1.5 ml tüp çıkarın ve raftan yıkama tamponu ile pek çok kez çevrilerek karıştırılmıştır, daha sonra manyetik rafa tüp yerleştirmekadımda 2.9 ve 1 ml pipet kullanarak süpernatant kaldırmak.
  11. Hedef çekirdeklerine bağlı olması boncuklar, yıkama tampon 150 ul ekle. Bu post-izolasyon örneğidir. Mikroskopi analizi ve sonraki RNA ekstraksiyonu için numune hazırlayın.
    1. Yeni bir 1.5 ml tüp ve DAPI ile leke transfer sonrası izolasyon örnek 20 ul ve bölüm 2.6.2 tarif edildiği gibi analiz edin. GFP + / + ve DAPI GFP-/DAPI + sonrası izolasyon numunedeki zenginleştirilmiş GFP + çekirdeklerin saflığını belirlemek için manyetik boncuk tarafından yakalanan çekirdek sayısı.
    2. , Post-izolasyon numunenin geri kalanına Trizol reaktifi 1 ml ilave edilir karıştırmak için ters ve saklamak daha sonra RNA izolasyonu (adım 3.1) -20 ° C 'de. Not: Trizol numuneler gerektiğinde -20 ° C'de birkaç hafta saklanabilir Bu, Trizol reaktif maddesi kullanılarak önce RNA ekstre manyetik boncuk çekirdek elüt edilmesi için gerekli değildir because Boncuklar daha sonra RNA izolasyonu karışmaz.

3. Larva Dokular İzole Çekirdeğin içinde Transkript Düzeyleri belirleyin

  1. Aşağıdaki modifikasyonlarla (Malzemeler PDF bakınız) Trizol tabanlı RNA ekstraksiyonu için tarif edilen standart protokol kullanılarak bölümleri 2.6.1 ve 2.11.2 'de hazırlanan ön izolasyon ve sonrası izolasyon RNA örneklerinden izole:
    1. RNA pelet ile presipitasyondan sonra, pelet RNase-içermeyen su içinde 19.2 ul ve RNASecure tepkin 0.8 ul (bkz. Malzeme PDF) ekleyin ve RNaz'larına inaktive etmek için 20 dakika boyunca 60 ° C'de inkübe edin.
  2. Üreticinin protokolü takip QubitR 2.0 florometre kullanılarak bu tür Qubit RNA deney kiti gibi bir floresan-RNA bağlayıcı boya (Malzemeler PDF bakınız) RNA konsantrasyonunun belirlenmesi.
  3. Örneğin EpiScr gibi bir ters transkriptaz kullanılarak amplifiye cDNA sentezlemeipt üreticinin talimatlarına Transcriptase kiti ve oligodT Ters primerleri. Not: Genellikle, RNA 50-100 ng birden fazla gen ekspresyonu analiz gerçekleştirmek için yeterli cDNA oluşturur. Önceden izolasyonu ve post-RNA izolasyon eşdeğer miktarları cDNA oluşturmak için kullanılmalıdır.
  4. Bu 10-kat önce, gerçek zamanlı kantitatif PCR (qPCR) analizi seyreltilmesi için 20 ul cDNA numunesine nükleaz içermeyen su içinde 180 ul ekleyin. Sulandırılmamış cDNA örnekleri qPCR inhibe çünkü bu seyreltme, önemli bir adımdır.
  5. Polimeraz ve dNTP, 4 pmol ileri her biri ile bir QPCR ana karışım hazırlanarak, ters primer, 20 ul nihai reaksiyon hacmi için steril su ile oluşur.
    1. Ilgilenilen bir hücre tipinde eksprese beklenmektedir genleri hedef ve doku toplanmış edildiği gelişim aşamasında QPCR için primerler dizayn. Bir intron span astar tasarımı mümkünse, o kadar genomik vecDNA PCR ürünleri ayırt edilebilir. Not: Hedef hücre tipinin gen ekspresyon profili bilinmiyorsa, etiketli çekirdekler popülasyonunda spesifik olarak ifade edilmelidir eGFP karşı primerler, belirli bir hücre tipi ve dokusunda (Tablo 1) için protokol optimize etmek için kullanılabilir.
  6. Bütün dokusundan hazırlanan cDNA'dan bir seyreltme serisi ile karşılaştırma ile ön izolasyon ve sonrası izolasyon örneklerde, ilgi konusu her genin nispi transkript seviyelerini belirlemek. Hedef genlerin transkript seviyeleri, Rpl32 (ya da tercihen çok sayıda referans genler) gibi bir referans genine normalize edilmesi gerekmektedir.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Repo-GAL4 sürücü (Bloomington stok no 7415) özel olarak bir gelişme 18 çeşitli aşamalarında Drosophila sinir sistemindeki glial hücrelerde ifade edilir. Sinekler stabil standart genetik teknikler kullanılarak repo-GAL4 sürücünün kontrolü altında UAS-EGFP :: Msp-300 KASH ifade eden üretildi. EGFP ifade deseni :: KASH transgen Bu sinekler karakterize etmek için, üçüncü instar larvaları arasındaki kesilerek optik lob ve göz hayali disk GFP ekspresyon paterni konfokal mikroskopi kullanılarak incelenmiştir. Disseke dokular, fotoreseptör aksonlarını (mAb24B10 etiketlemek için DNA ve α-chaoptin 19 ile işaretlemek için DAPI ile zıt ) Malzemeler PDF bkz. Şekil 1A Repo-GAL4 tahrik EGFP :: KASH transgen Tahmini ifade düzenine de optik lob ve göz hayali disk glia olarak ifade edilir olduğunu göstermektedir. Yüksek büyütme altında,EGFP ifade EGFP nükleer lokalizasyon zarf ile tutarlı DAPI pozitif DNA, :: KASH etiketi (Şekil 1B) çevreleyen dairesel bir model gözlenmiştir. EGFP ifade GFP karşı bir antikor kullanılarak bir sinyal amplifikasyonu için gerek kalmadan sabit ve tespit edilmemiş olan dokulardaki her iki tespit edilebilir; GFP karşı antikorlar, Şekiller 1 ve 2'de gösterilen görüntüler EGFP :: KASH sentezleme görselleştirmek için kullanılmamıştır. EGFP :: KASH transgen Drosophila larvalarının herhangi bir diğer dokularda spesifik olmayan bir tarzda eksprese olup olmadığını belirlemek için, GFP ifade diseksiyon mikroskobu bir floresan kullanılarak bütün üçüncü instar larvaları incelenmiştir. Özellikle, EGFP ekspresyonu spesifik olmayan :: KASH transgen üçüncü instar larvalarının tükürük bezlerinde yüksek seviyelerde gözlenmiştir. Bu, Repo-GAL4 sürücü gelişme larva aşamasında glia dışında bir hücre tiplerinde aktiviteye sahip olduğunu gösterir. Bu nedenle, özel olarak maskeden izole etmek içinal çekirdekler, üçüncü instar larvaları arasındaki optik lob ve göz hayali disk homojenleştirmeden önce ve afiniteyle izolasyon diseksiyon kullanılarak izole edilmiştir.

Bu protokol, Drosophila dokulardan çekirdeklerin çıkarılması için uygun olduğunu doğrulamak için, ve optik lob ve göz elde edilen homojenatları, belirli bir doku, ön yalıtım örnek (bölüm 2.6.2) 'de mevcut etiketli çekirdekleri yüzdesini tahmin Repo-GAL4 hayali disk, UAS-EGFP :: Msp-300 KASH üçüncü instar larvaları incelenmiştir. Şekil 2A konfokal mikroskopi kullanılarak elde edilmiş olan ön-izolasyon örnek temsili bir görüntüsünü gösterir. Bu resimde, çekirdeklerin varlığı DAPI pozitif olaylar gösterilir. Seyrek dağılmış GFP-pozitif, DAPI-pozitif çekirdeklerin glial az bir kısmı da gözlenmektedir. Biz GFP pozitif çekirdekler bu toplam çekirdekleri nüfusun az% 2'sini tahminörnek (Şekil 2A). Bölüm 2.6.3 (Tablo 2) tarif edildiği gibi optik lob ve 100 larva kesilerek çıkartıldı göz hayali disklerinden toplam çekirdek verimi ön izolasyon örnek için belirlenmiştir. Yaklaşık% 2 GFP pozitif olan 0.8 ve 1.2 x 10 7 çekirdekleri arasında bulunan 100 disseke optik lob ve göz hayali diskler, A tipik ön-izolasyon örnek. Şekil 2B tanımlı bir bölgede DAPI-pozitif çekirdeklerin temsili bir görüntüsünü gösterir hemasitometre. Çekirdekleri sağlam olduğuna dikkat edin, ve (Şekil 2A ve 2B) protokolde kullanılan ekstraksiyon koşulları altında, tutarlı bir dairesel şeklini korumak.

Bu protokol izole etmek ve / ya da son derece karışık hücre popülasyonu içeren dokulardan etiketli çekirdeklerin belirli popülasyonlarının zenginleştirilmesi için de kullanılabilir olup olmadığını belirlemek için, α-GFP, antikor kaplı manyetik boncuklar kullanımı idioptik lob ve 100 repo-GAL4'ün, UAS-EGFP :: Msp-300 KASH üçüncü dönem larva göz hayali disk elde homojenatlarından etiketli çekirdekleri izole d. Şekil 2C ve 2D, alternatif olarak EGFP :: KASH α-GFP kaplı manyetik boncuk glial çekirdekleri bağlama etiketlendi ve sonra manyetik ayırma sonrası izolasyon örnek (bölüm 2.11.1) gözlenir görülebilir. Manyetik boncuklar GFP kanalda bir otoflüoresanı sergileyen, ancak, hali hazırda, bu da daha küçük boyutta (çekirdekleri için yaklaşık 5 um karşı manyetik boncuklar için 2.8 mm) ve DAPI lekelemesi eksikliğinden boncuk bağlama çekirdeklerden ayırt edilebilir. GFP + / + DAPI çekirdekleri sonrası izolasyon numunesinde DAPI pozitif olayların fazla% 95 için hesap. Bu nedenle, hedef çekirdekler nüfus etiketli yüksek ön izolasyon sonrası izolasyon örnek göreceli olarak zenginleştirilmişörnek. Post-izolasyon örnek göstermek güçlü nükleer zarf lokalize GFP floresan, ve çekirdeklerin çoğunluğu genellikle boncuk ile çevrilidir. Bununla birlikte, etiketsiz bir çekirdek, az sayıda, aynı zamanda, bu numune içinde mevcut olabilir mümkündür. Bu nedenle, Şekil 2C ve Şekil 3'teki gen ekspresyon analizi sonuçları (aşağıya bakınız), hedef, glial çekirdekler nüfusu oldukça zenginleştirilmiş etiketli olduğuna işaret etmesine rağmen başka bir spesifik olmayan hücre türleri bazı çekirdekleri de ayrıca numunede mevcut olması olasılığı göz ardı edilemez. Kullanıcıların, özel bir hücre tipi ve ilgili dokuya hedef çekirdekleri nüfusun zenginleştirme en üst düzeye çıkarmak için, ve spesifik olmayan bağlanma, çekirdekleri gidermek için bu protokolü optimize önerilir. Özellikle, antikor ve boncuk malzeme göreceli başlangıç ​​oranı hedef çekirdeklerin uygun zenginleştirilmesi için önemli olması muhtemeldir. Bu nedenle, toplam aralıklarıBizim tipik ön izolasyon örneklerde mevcut çekirdekler numaraları Tablo 2 'de gösterilmiştir. Ön izolasyon numune içindeki mevcut toplam çekirdek sayı ve optik lob ve göz hayali diskinden karışık bir popülasyonda glial hücrelerin oranı tahmin göre, post-izolasyon örnekteki maksimum çekirdek verimi 1.6 arasında olması bekleniyordu 10 x 5 ve 2.4 x 10 5 çekirdekleri. Bununla birlikte, aşama 2.6.3 'de tarif edildiği gibi çekirdekler verimi belirlemek için hemositometre kullanılarak, post-izolasyon örneğinde elde edilen gerçek çekirdeklerinin verimi 10 4 x 4 ila 10 x 1.3 ile 2.7 çekirdekler oldu. Post-izolasyon numunede mevcut boncuk hemositometreyle doğru yüklenmesini etkilemez görünür, çünkü bu çekirdekler verimleri çok kaba tahminler temsil eder. Bazı GFP-pozitif çekirdekler gösteren, ilişkisiz homojenat gözlenir ki s tüm GFP-pozitif çekirdeklerverimli bu protokolde kullanılan koşullar altında boncuklar için yeterli bağlanır. Sıralı izolasyon adımları bağlayıcı veya icra süresini artırarak potansiyel olarak bu verimini artırabilir, ama bu saflık ve RNA bütünlüğü hem pahasına gelebilir. Bu protokolde tarif edilen koşulları kullanarak, RNA yeterli miktarda qRT-PCR (Tablo 2), aşağı doğru gen ekspresyon analizi için post-izolasyon numunesinde elde edilebilir. Böylece, bu protokol, hızlı ve sıkı bir şekilde karıştırılmış hücre popülasyonları içerir dokulardan hedef çekirdek izole yeteneğine sahiptir. Ayrıca, spesifik olarak belirli bir popülasyondaki hücrelerin sadece küçük bir kısmını, en az% 5, çekirdek izole hedef teşkil edebilir.

Bundan başka, post-yalıtım örnek yüksek hedef glial çekirdekleri nüfus için zenginleştirilmiş olduğunu doğrulamak için, ön izolasyon 4 farklı genler için transkript seviyeleri post-izolasyon örnekleri RT-qPCR karşılaştırıldı. ELAV, nrv2 ve EGFP transkript seviyeleri iki numunelerinde belirlenen ve (Şekil 3) glial hücrelerinde aynı düzeyde ve çevreleyen merkezi sinir sisteminde ifade edilir, referans gen, Rpl32, normalize edilmiştir. Post-izolasyon örneğinde kat fark birine ayarlanır ön izolasyon numûnesine nispetle gösterilmiştir. Şekil 3'te, post-izolasyon örnek öncesi izolasyon numunesine özgü nöronal gen ELAV nisbetle daha düşük transkript seviyelerini göstermektedir. Bu, nöronal hücrelerin çekirdekleri az temsil sonrası izolasyon örneğinde olduğunu gösterir. Bunun aksine, glial bakımından zenginleştirilmiş nrv2 gen 10 ve hem de daha yüksek eGFP transkript seviyeleri sonrası isola bulunurlarön izolasyon örneğe tion örnek göreli. Bu sonuç, post-izolasyon örnek yüksek hedef glial çekirdekleri nüfus için zenginleştirilmiş olduğunu gösterir. Bu protokolde ölçülen transkript seviyeleri, nükleer transkript temsil dikkat etmek önemlidir ve bu nedenle aktif transkripsiyon seviyeleri yerine sabit durum mRNA göstermek için olasıdır. Repo tekrarlanabilir ifadesi repo-GAL4 sürücüsü tarafından ifade Gal4 protein endojen repo genin aktif transkripsiyon sonra da devam edebilir bittikten düşündüren, bizim pre-izolasyon veya post-izolasyon örneklerinde ya da tespit edilmemiştir. Bu Twi promoteri kullanılarak işaretli çekirdekleri, belki de protein stabilitesi 8 karşı transkripsiyon gelişimsel zamanlaması farklılıklara, TWI transkriptlerin zenginleştirilmiş seviyeleri göstermezler hangi başka çalışmalardan elde edilen sonuçlar ile uyumludur. Taken birlikte, bu sonuçlar çok başarılı bir şekilde tarif edilen protokol hücrelerin karışık popülasyonları içerir dokulardan hedef çekirdek zenginleştirmek ve izole edilmiş çekirdekleri gen ekspresyon analizi için uygun olduğu için kullanılabileceğini göstermektedir.

Şekil 1
Şekil 1. Repo-GAL4'ün ifade desen, UAS-EGFP :: Msp-300 KASH hattını sinek. (A) Üçüncü dönem larva olarak, repo-GAL4 optik glial hücrelerde UAS-EGFP :: Msp-300 KASH transgeninin ifadesini sürücüler lob, optik sapı (os) ve göz hayali disk (ed). Glial hücrelerde çekirdek zarı EGFP :: KASH (yeşil) ile etiketlenir. R1 - R8 fotoreseptör hücre aksonları karşılaştırma için α-chaoptin (mAB24B10, kırmızı) ile etiketli ve DNA sta olduğunu vardırDAPI (mor) ile ined. GFP-etiketli glial çekirdekleri (oklarla işaretlenmiştir) optik lob içinde tabakanın (la) boyunca görebilir. Ölçek çubuğu, 50 mm. (B) EGFP :: KASH içeren optik lobun lamina ganglionlar Yükseköğretim büyütme görüntü glial hücre çekirdekleri etiketli. Ölçek çubuğu, 50 mm. Konfokal görüntüleri a ya kullanılarak elde edildi   40X / 1.30 yağı ya da bir   20X / 0.75 yağ daldırma objektif ve 408 nm/425-475 nm (DAPI) uyarma / emisyon dalga boyları kullanılarak; 488 nm/525-550 nm (GFP); 561 nm/595-620 nm (Alexa 5,6,8 ). , bu rakamın daha büyük bir versiyonunu görmek için buraya tıklayınız.

Şekil 2,
Şekil 2. Çekirdeklerin karakterizasyonu"pre-izolasyon" ve "post-izolasyon" örneklerinde. (A) Temsilcisi görüntü içinde bir repo-GAL4, UAS-EGFP :: Msp-300 KASH öncesi izolasyon örnek 20 / 0.75 yağ daldırma objektif ve standart bir X kullanılarak analiz konfokal mikroskop. DNA DAPI (mavi) ile boyandı ve EGFP :: KASH glial çekirdekleri (oklarla işaretli) yeşil gösterilmiştir etiketlenmiş. Ölçek çubuğu, 50 mm. (B) X 10 hava hedefini ve standart epifluorışıma mikroskobu kullanarak bir menositometrede bir ön-izolasyon numuneden DAPI-lekeli çekirdeklerinin Temsilcisi görüntü. Hemositometre ızgaraları açık gri gösterilir. GFP floresan mikroskop epifluorışıma bu amaç altında görünür değildi sadece DAPI-pozitif çekirdekler, bu resimde gösterilmiştir. (C) repo-GAL4, UAS-EGFP :: Msp-300 KASH sonrası izolasyon örnekten Temsilcisi görüntüPanel A için tarif edildiği gibi analiz edildi. izole edilmiş EGFP :: KASH DAPI için pozitif leke (oklarla işaretlenmiştir) glial çekirdek etiketlendi ve boncuklar, çevrilidir GFP kanalda düşük seviyelerde bu autofluoresce. Ölçek çubuğu, 50 mm. Tipik bir izole EGFP'nin :: KASH (D) Yüksek büyütmeli görüntü boncuk çevrili (okla işaretli) glial çekirdekleri etiketledi. Ölçek çubuğu, 5 um. , bu rakamın daha büyük bir versiyonunu görmek için buraya tıklayınız.

Şekil 3,
Şekil 3,. "Pre-izolasyon" ve "post-izolasyon" örneklerinden Temsilcisi Mah-PCR verileri. Hedef gen transkript seviyeleri önceden isol of QRT-PCR ile tespit edilmiştirrepo-GAL4'ün, UAS-EGFP'nin :: Msp-300 KASH optik loblar ve göz hayali diskler elde tirme ve post-izolasyon örnekleri. Tüm transkript seviyeleri Rpl32 transkript seviyeleri için normalleştirilmiş ve her bir hedef gen için ön izolasyon örnek birine ayarlanır. Bir biyolojik deneyden Örnek sonuçlar aşağıdaki genler için gösterilmiştir: ELAV, nrv2 ve eGFP.

Gen Primer dizi (5 '3') Ebat PCR ürünü (bp)
eGFP GAGGGATACGTGCAGGAGAG 102
GATCCTGTTGACGAGGGTGT
nrv2 GGCTGGTTGTAGTCGCAGTT 125
GGCACCCAACACGAGAACTA
ELAV GCACCATTCGGAGCAATAAT 153
TGTGCAGCTGGATGGTGTAG
Rpl32 GCTAAGCTGTCGCACAAATG 160
CGTTGTGCACCAGGAACTT

Tablo 1. QRT-PCR analizi için kullanılan primerler.

Ön izolasyon örnekteki çekirdeklerin sayısı Post-izolasyon örnekteki çekirdeklerin tahmini toplam sayısı Post-izolasyon örnekten RNA verimi (ng)
0,8-1,2 x 10 7 1,3-2,7 x 10 4 160-220 ng

Tablo 2.. Elde Temsilcisi çekirdekleri ve RNA verimleri.Glial hücreler ile etiketlenmiş olduğu 100 disseke optik lob ve repo-GAL4'ün, UAS-EGFP :: Msp-300 KASH genotip, gelen göz hayali diskler öncesi izolasyon ve post-izolasyon örneklerinden elde edilen çekirdekleri ve RNA verimi tipik aralıkları EGFP :: KASH. 2.6.3 tarif edildiği gibi çekirdekler miktarı ve 3.1.2 'de tarif edildiği gibi RNA nicelleştirilmiştir.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bu protokol, Drosophila embriyonik ya da larva dokularda karma hücre popülasyonlarından, özellikle etiketli ya da yüksek ölçüde çekirdek izole zenginleştirmek için kullanılabilir. Bu protokolü kullanarak, çekirdekler, yaklaşık 1 saat içinde kesilmiş dokularından izole edilebilir. İzole edilmiş çekirdeklerin saflığı ve verimi deneysel her hücre tipi için belirlenmelidir. Çünkü numunede mevcut boncukların hemasitometre kullanarak protokol sonrası izolasyon aşamasında boncuk-bağlı çekirdek ölçmek için zor olabilir. Çekirdeklerin tam sayılar alt uygulama için gereklidir böylece, eğer, bu tür DNA içeriği gibi alternatif yöntemine göre çekirdek verimini tahmin etmek gerekli olacaktır. RNA başarılı bir şekilde izole edilebilir ve ölçülebilir eğer çekirdek verimi tam hesaplamalar gen ekspresyon analizi için gerekli değildir. Biz bulduk gibi, RNA verimini ölçmek için bir floresan dayalı bir yöntem kullanmanız tavsiye edilir RNA konsantrasyonunun spektrofotometrik tayiniBu düşük konsantrasyon örneklerde oldukça değişkendir.

Manyetik boncuk ve antikor seçimi: başarısını etkileyecek protokolün iki önemli yönü vardır. GFP ya da protein G'ye bağlanmaktadır manyetik boncuklar çeşitli kaynaklardan ticari olarak temin edilebilir. Bununla birlikte, bu güçlü iki ana nedenden dolayı, bu protokolde tarif edilen prosedüre için Invitrogen'den temin edilebilen, protein G, manyetik boncuk kullanılması önerilir. İlk olarak, 2.8 mikron de Invitrogen tanelerin boyutu yaklaşık 5 um (Şekil 2D) biz inceledik hücre türleri içinde çekirdeklerin ortalama boyutu, den biraz daha küçüktür. Küçük manyetik boncuk (örneğin 50 nm, μMACS α-GFP, Miltenil Biotech) toplu yıkama tarzı mıknatıslar hızla bağlamaz, ve bu boncuklar için sağlanan sütunlar larva doku özleri ile yapışmasına neden olabilir. Daha büyük sayıda manyetik boncuk (örneğin 10 um, PureProteome protein G manyetik bEADS, Millipore) Bu ön testlerde çekirdeklerine iyi bağlanmayan, ve bu da zor, standart mikroskopi teknikleri ile boncuk bağlama örneğinde çekirdek belirlemek için yapım DAPI ve GFP her ikisi ile aynı kanallar içinde güçlü otoflüoresanı sergiler. Manyetik boncuk seçimine ek olarak, bu immüno-çökeltme için çalışmaktadır, ancak bu yüksek bir spesifik olmayan bir geçmiş olan bir GFP antikor kullanmak önemlidir. Bu protokolün tekrarlanabilirlik yardımcı olmak için, biz GFP karşı monoklonal fare antikoru kullanılmıştır. GFP karşı poliklonal tavşan antikorları de başarıyla ön çalışmalarda trialed, ancak bu yüksek olmayan arkaplan eğilimindeydi. Diğer monoklonal antikorlar da başarı çeşitli düzeylerde ile (örneğin Gelişim Çalışmaları Hibridoma Bankası) test edildi. Bu yüzden, antikor, bir seçim etiketli çekirdeklerin başarılı izolasyon önemli bir faktördür.

Bu protokolde biz det yöntemleri tarif rağmenizole edilmiş çekirdeklerde as gen transkript seviyeleri, bu adımda 2,1-2,11 açıklanan yaklaşım, aynı zamanda bir sonraki Kromatin immüno-analizi için kullanılabilir çekirdek izole edilmesi için uygun olacağı düşünülmektedir. Doku homojenleştirmeden önce (2.3 adıma) için% 1 formaldehit içinde sabit ise, daha sonra disseke doku birkaç gün ve kromatin immunoprecipitation analizini gerçekleştirmek için izole yeterli malzeme üzerinde toplanabilir. Yukarıda tartışıldığı gibi sadece kaba tahminler vermektedir hemositometre kullanılarak elde edilen sayımlara dayanarak, biz genellikle x 10 4 1.3 elde ve göz hayali disk ve 100 larvaları (Tablo 2) optik lob 2.7 x 10 4 glial çekirdekler. Böylece, bir yaklaşım kullanarak, bu hedef hücre tipi bolluğuna bağlı olarak, kromatin immüno analiz gerçekleştirmek için yeterli malzeme elde etmek mümkündür, ve ilgi epitop gerekir.

Bu techni biri yararlı bir genetik uygulamasıque olumlu bir resesif öldürücü mutant aleli için homozigos olan embriyolar ya da larva belirli hücre tiplerinde çekirdeklerini etiketlemek için kullanılabilir olmasıdır. Bunu gerçekleştirmek için, iki ayrı sinek stoklarının, ilgi konusu mutant alel özel bir Gal4 sürücü ile rekombine olduğu ya da üçüncü kromozomu üzerindeki UAS-EGFP :: Msp-300 KASH transgen ile oluşturulmuş olması gerekir. Mutant alel ve Gal4 sürücü taşıyan sinekler mutant alelinin iki kopyaları mutant alelleri ile UAS-EGFP :: Msp-300 KASH transgen, sadece soy taşıma sinekler çaprazlanır Eğer dokuda GFP ile etiketlenmiş edilecektir Gal4 sürücü ifade edilir. Böylece, resesif öldürücü alellerin hücre-spesifik etkileri önce letalitesinin aşamasına, embriyonik veya larva evreleri incelenebilir. Bu teknik, daha önce olumlu genetik, SAGA alt birim içinde sgf11 1 mutasyonların için homozigot olan embriyonik kas hücreleri etiketlemek için kullanılmıştır '/ Sup>.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa hiçbir şey yok.

Acknowledgments

Biz UAS-EGFP :: Msp-300 KASH plazmid sağlamak için Janice Fischer teşekkür ederim. MAB24B10 antikor NICHD himayesinde geliştirilen Gelişim Çalışmaları Hibridoma Bankası elde edilen ve Iowa Üniversitesi, Biyoloji Bölümü tarafından muhafaza edilmiştir. Repo-GAL4 stok (BL7415) Indiana Üniversitesi Bloomington Stok Merkezinden elde edilmiştir. Kanser Araştırma Purdue University Center Amerikan Kanser Derneği Kurumsal Araştırma Bursu (IRG # 58-006-53) den destek minnettarlıkla olduğunu. Jingqun Ma Purdue Üniversitesi'nde Gıda ve Tarım Purdue ASİSTANLIĞA bir Tarımsal Araştırma tarafından desteklenmektedir.

Materials

Name Company Catalog Number Comments
Anti-chaoptin antibody (mouse, monoclonal) Developmental Studies Hybridoma Bank mAB24B10
Anti-GFP antibody (mouse, monoclonal) Roche 11814460001 This specific antibody is recommended for this protocol. However, alternative antibodies could also be used.
2x Bullseye EvaGreen qPCR Mastermix with ROX MidSci BEQPCR-R
DAPI (4',6-diamidino-2-phenylindole, dihydrochloride salt) Biotium 40011
Dounce Homogenizer (1 ml) VWR 62400-595
Dumont #5 Tweezers, 11 cm World Precision Instruments 14095
Dynabeads Protein G for Immunoprecipitation Invitrogen 10003D This specific brand of magnetic beads is recommended for this protocol.
EpiScript Reverse Transcriptase Epicentre ERT12910K http://www.epibio.com/docs/default-source/protocols/episcript-reverse-transcriptase.pdf
Falcon cell strainers, 40 μm pore size VWR 21008-949 Alternative pore sizes could be used, depending on the size of the target cell nuclei.
Magnetic stand (8 x 1.5 ml tubes) Millipore LSKMAGS08 
Mini tube rotator Genemate H-6700
Qubit starter kit Life Technologies Q32871 Similar fluorescence-based methods for quantifying RNA yield could be used. http://tools.invitrogen.com/content/sfs/manuals/mp32852.pdfZ
RNAsecure (Ambion) Life Technologies AM7010 The use of this reagent to inactivate RNAses is optional.
RT-PCR machine Thermal Cycler BioRad CFX Connect Thermal Cycler
Siliconized 9-well glass plate Hampton Research HR3-134
Stereomicroscope Fluorescence Adapter (Royal Blue (440-460 nm) excitation + yellow barrier Nightsea This adaptor enables GFP fluorescence to be examined using a typical dissecting microscope (eg Nikon)
StereoZoom Microscope 83604 Set with 10X Wide Field Eyepieces and Universal Boom Stand Nikon SMZ 745
Thermal Cycler BioRad T100
Trizol reagent Life Technologies 15596018 CAUTION; Alternative RNA extraction methods can be used. http://tools.invitrogen.com/content/sfs/manuals/trizol_reagent.pdf
Tween 20 Amresco 0777-1L

DOWNLOAD MATERIALS LIST

References

  1. Weake, V. M., et al. Post-transcription initiation function of the ubiquitous SAGA complex in tissue-specific gene activation. Genes Dev. 25, 1499-1509 (2011).
  2. Bonn, S., et al. Cell type-specific chromatin immunoprecipitation from multicellular complex samples using BiTS-ChIP. Nat. Protoc. 7, 978-994 (2012).
  3. Haenni, S., et al. Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq. Nucleic Acids Res. 40, 6304-6318 (2012).
  4. Barthelson, R. A., Lambert, G. M., Vanier, C., Lynch, R. M., Galbraith, D. W. Comparison of the contributions of the nuclear and cytoplasmic compartments to global gene expression in human cells. BMC Genom. 8, 340 (2007).
  5. Zhang, C., Barthelson, R. A., Lambert, G. M., Galbraith, D. W. Global characterization of cell-specific gene expression through fluorescence-activated sorting of nuclei. Plant Physiol. 147, 30-40 (2008).
  6. Deal, R. B., Henikoff, S. The INTACT method for cell type-specific gene expression and chromatin profiling in Arabidopsis thaliana. Nat. Protoc. 6, 56-68 (2011).
  7. Deal, R. B., Henikoff, S. A simple method for gene expression and chromatin profiling of individual cell types within a tissue. Dev Cell. 18, 1030-1040 (2010).
  8. Steiner, F. A., Talbert, P. B., Kasinathan, S., Deal, R. B., Henikoff, S. Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling. Genom. Res. 22, 766-777 (2012).
  9. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, 401-415 (1993).
  10. Henry, G. L., Davis, F. P., Picard, S., Eddy, S. R. Cell type-specific genomics of Drosophila neurons. Nucleic Acids res. 40, 9691-9704 (2012).
  11. Starr, D. A. KASH and SUN proteins. Curr Biol. 21, 414-415 (2011).
  12. Fischer, J. A., et al. Drosophila klarsicht has distinct subcellular localization domains for nuclear envelope and microtubule localization in the eye. Genetics. 168, 1385-1393 (2004).
  13. Patterson, K., et al. The functions of Klarsicht and nuclear lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye. Mol. Biol. Cell. 15, 600-610 (2004).
  14. Yu, J., et al. The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Dev. Biol. 289, 336-345 (2006).
  15. Bischof, J., Maeda, R. K., Hediger, M., Karch, F., Basler, K. An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc. Natl. Acad. Sci. U.S.A. 104, 3312-3317 (2007).
  16. Kracklauer, M. P., Banks, S. M., Xie, X., Wu, Y., Fischer, J. A. Drosophila klaroid encodes a SUN domain protein required for Klarsicht localization to the nuclear envelope and nuclear migration in the eye. Fly. 1, 75-85 (2007).
  17. Markstein, M., Pitsouli, C., Villalta, C., Celniker, S. E., Perrimon, N. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat. Genet. 40, 476-483 (2008).
  18. Sepp, K. J., Schulte, J., Auld, V. J. Peripheral glia direct axon guidance across the CNS/PNS transition zone. Dev. Biol. 238, 47-63 (2001).
  19. Fujita, S. C., Zipursky, S. L., Benzer, S., Ferrus, A., Shotwell, S. L. Monoclonal antibodies against the Drosophila nervous system. Proc. Natl. Acad. Sci. U.S.A. 79, 7929-7933 (1982).
Dan Tagged Çekirdeğin Affinity-tabanlı yalıtım<em&gt; Drosophila</emGen ekspresyon analizi için&gt; Dokular
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).More

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter