Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Et restriktionsenzym Baseret Kloning metode til at vurdere den doi: 10.3791/51506 Published: August 31, 2014
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bestemme både vært og virale karakteristika, der påvirker HIV-1 patogenese og sygdomsudviklingen er altafgørende for en rationel vaccine design. Det cellulære immunrespons er et centralt element i indsatsen mod hiv-1-infektion menneskelige immunsystem. Cytotoksiske T-lymfocytter (CTL) er nødvendige i den indledende kontrol af akut viræmi og tillade værten at etablere en stabil tilstand (setpunkt) virusbelastning 1,2. Eksperimentel udtømning af disse effektorcellerne resulterer i tab af viral kontrol 3,4. På trods af dette, flygte mutationer opstår i det virale genom, der undergrave CTL anerkendelse af virusinficerede celler 5-9.

Visse HLA-alleler er blevet forbundet med lavere virale belastninger og langsommere sygdomsprogression, herunder B * 57 B * 27 og B * 81 10-15. En del af den beskyttende fordel af HLA klasse I alleler kan tilskrives det faktum, at de er målrettet mod funktionelt begrænsede områder af genomet, såsom Gagog vælge efter escape mutationer, der reducerer evnen af virusset til at replikere in vitro 16-21. Selv flygte fra det cellulære immunsystem er gavnlig for virus i forbindelse med valg HLA klasse I allel, kan virkningen af disse mutationer har differentierede konsekvenser for værten ved overførsel til en HLA-mismatchede individuel 22,23. Derfor vil forstå effekten af ​​transmitterede HLA-associerede escape mutationer på viral replikation kapacitet være vigtigt at fremme vores forståelse af tidlig hiv-1 patogenese.

Selvom der er gjort store fremskridt for at identificere og karakterisere fitness defekter af enkelte kvitterede mutationer forbundet med specifikke HLA klasse I-alleler 24-29, naturligt forekommende HIV-1-isolater har unikke og komplekse fodspor af HLA-associeret polymorfier, sandsynligvis som følge af HLA medieret immun tryk forskellige immunogenetisk baggrunde 30. APorrige analyse Goepfert et al. viste, at en akkumulering af HLA-associerede mutationer i de transmitterede Gag sekvenser afledt fra 88 akut inficerede Zambianerne blev associeret med en reduktion i setpunkt viral belastning 31. Dette antydede, at overførslen af ​​skadelige kvitterede mutationer, specielt i Gag, at HLA-uoverensstemmende modtagere giver en klinisk fordel, og kan skyldes svækket viral replikation. Bevæger sig fremad, er det bydende nødvendigt at undersøge, hvordan komplekse kombinationer af Gag polymorfier indenfor naturligt forekommende isolater arbejder i fællesskab for at definere karakteristika for den transmitterede virus såsom replikation kapacitet, og hvor tidligt replikation kan til gengæld påvirke HIV-1 kliniske parametre og sen-fase patogenese.

Brockman et al. Først påvist en sammenhæng mellem replikation kapacitet gag-Pro sekvenser isoleret under kronisk fase infektion og viral belastning i både subtype C og B-infektioner32-35. Den eksperimentelle tilgang, der præsenteres i disse undersøgelser, selv om det er relevant for behandlingen af in vitro-replikation kapacitet sekvenser afledt af kronisk inficerede individer, har flere tekniske forbehold og begrænsninger, der gør studerer HIV-1 replikationskapacitet i undertype C akut inficerede individer vanskelig. Denne metode bygger på rekombination af befolkningen baserede PCR-amplificerede sekvenser i undertype B NL4-3 proviruset, der blev afledt dels fra LAV, et laboratorium tilpasset virus lager 36. Virus generation blev opnået ved co-transfektion af en CEM-baserede T-celle linie 37 med PCR amplikoner og fordøjet deltace- gag-pro NL4-3 DNA. Denne metode kræver, at udvækst af virus over en periode på uger til måneder, hvilket potentielt skråstilling arten af det udvundne virus lager i forhold til den virale quasispecies in vivo og derfor ændring af måling af replikation kapacitet in vitro. Denne metode Ier mere egnet til at studere kronisk inficerede individer, hvor det effektivt vælges for virus med den højeste replikative kapacitet, og hvor kloning mange forskellige virusvarianter fra et stort antal af kronisk inficerede individer er ganske arbejdskrævende og derfor ikke er mulig. Men inden for en akut inficeret individ, der generelt 1-2 varianter til stede, og dermed eliminere risikoen for skråstilling arten af det udvundne virus lager gennem in vitro selektionstryk, giver mulighed for en mere nøjagtig vurdering af in vitro-replikation kapacitet. For det andet kræver denne metode rekombinerer subtype C gag-Pro sekvenser i en undertype B afledt rygrad, og kunne indføre backbone uforenelighed bias i analysen. På grund af disse begrænsninger, må et stort antal sekvenser analyseres med henblik på at overvinde eventuelle fordomme indført.

Her beskriver vi en alternativ eksperimenterende hensigtsver egnet til at studere sekvenser afledt fra subtype C akut inficerede individer. Vi bruger et restriktionsenzym baseret kloning strategi om at introducere gag-gen afledt af akut infektion tidspunkter af HIV-1 subtype C inficerede individer i subtype C provirale rygrad, MJ4. Anvendelsen af MJ4 som en fælles rygrad til at klone gag generne er afgørende for analysen af subtype C afledte sekvenser. MJ4 er afledt fra et primært isolat 38, og således ville være mindre tilbøjelige til at indføre bias som følge af undertype inkompatibilitet mellem rygraden og gag-genet. Hertil kommer, at tilgang til brug baseret begrænsning kloning enzym tillader den provirale konstruktioner, der skal transficeres direkte ind i 293T-celler og til genopretning af en klonal virusstamme identisk med den klonede gag-sekvensen.

Den præsenteres nedenfor metoden er en high throughput metode til at vurdere replikation kapacitet af subtype C afledt Gag-MJ4kimæriske vira. Transfektion i 293T-celler er ligetil og inddrivelse af virus tager kun tre dage. In vitro-replikation kapacitet analyseres på samme CEM-CCR5 baseret T-celle linie skabt af Brockman et al. 37, men ved hjælp af vigtige protokol ændringer er nødvendige for en vellykket replikation subtype, K MJ4 kimære virus. Brugen af ​​et passende T-celle linie snarere end PBMC'er giver mulighed for et stort antal subtype C MJ4-kimære virus, der skal testes med høj analyse reproducerbarhed. Endelig, ved hjælp af et radioaktivt mærket revers transkriptase-assay til kvantificering af virus i supernatanten er mere omkostningseffektiv end ved anvendelse af kommercielt tilgængelige p24 ELISA kits. Det giver også en højere dynamikområde, som var vigtigt for at detektere både dårligt og stærkt replikerende virus inden for samme analyse og til påvisning af subtile forskelle i replikation mellem isolater.

Konklusionen er, at den metode, der præsenteres her tilladt forden grundige undersøgelse af replikation kapacitet gag-sekvenser afledt fra HIV-1 subtype C akut inficerede individer fra Zambia, og som skrevet, kan også udvides til at studere andre undertype C inficerede befolkninger. Blev observeret en høj grad af variation i replikation kapacitet mellem forskellige Gag isolater. Desuden var vi i stand til at vise en statistisk sammenhæng mellem replikation kapacitet transmitterede Gag og indstille punkt viral belastning samt med CD4 + tilbagegang over en tre-årig periode 39. Sådanne resultater understreger vigtigheden af ​​at studere, hvordan transmitterede virale egenskaber, såsom replikation kapacitet, interagere med værtens immunsystem til at påvirke patogenese under tidlig infektion og vil være integreret for at udvikle effektiv vaccine indgreb samt behandling.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Forstærkning af HIV-1 gag-genet fra inficerede, frossen plasma

  1. Uddrag viralt RNA fra 140 pi optøede HIV-1-inficerede plasma ved hjælp af en udvinding kit.
    1. Når det er muligt, straks videre til cDNA-syntese efter RNA-ekstraktion som frosne viralt RNA giver de bedste amplifikationsprodukter resultater. Hvis det er muligt, der er nedsat PCR mester mix til første runde DNA-amplifikation og opbevares ved 4 ° C forud for viral RNA-ekstraktion.
  2. Reverse-transskribere cDNA fra RNA og forstærke første runde DNA-produkter ved hjælp af revers transkriptase og en termostabil DNA-polymerase i en et-trins-RT-PCR.
    1. Tag RNA ud af -80 ° C fryser (hvis frost var nødvendigt) og kortvarigt tø ved stuetemperatur og placeres derefter i kold blok. Overfør 5 pi RNA til hvert PCR-rør indeholdende 45 ul mester mix at give en endelig volumen på 50 ul. Straks placere resterende RNA-prøver i -80 ° C fryser.
    2. Efter enzym er endded til den første runde PCR Master Mix (tabel 1A), alikvot 45 ul i hver tyndvægget PCR-amplifikation rør til antallet af reaktioner ønskes. Sørg for at bruge PCR-rør med individuelle hætter og ikke fratage hætter til at sikre minimal krydskontaminering mellem prøverne. Anbring PCR-rør i en kold blok for at beskytte det temperaturfølsomme RT-enzym og RNA-template. Bemærk: Prøver skal køres i tre eksemplarer med henblik på i tilstrækkelig grad at prøve de virale quasispecies. Det er også vigtigt at anvende et produkt med en high fidelity DNA-polymerase-enzym for at minimere PCR-introducerede fejlinkorporering. Der henvises til listen over reagenser til det anbefalede produkt.
    3. Efter RNA-template er blevet tilføjet til alle reaktionsrørene overføres PCR-rør til en thermocycler til amplifikation ved hjælp af cyklusmekanismen, der er beskrevet i tabel 1B. Bemærk: Produktet af denne amplifikation vil blive anvendt i en anden runde indlejret PCR.
  3. Udfør en indlejret selvbet-runde PCR-amplifikation under anvendelse af 1 ml af den første runde PCR-amplifikation (1,2) som DNA-skabelon.
    1. Alikvot 49 pi anden runde PCR Master Mix (Tabel 2A) til hver tyndvæggede PCR-rør for antallet af reaktioner ønskede. Overfør 1 pi fra den første runde PCR-amplifikation til hvert reaktionsglas for at give et slutvolumen på 50 ul. Bemærk: Dette vil tjene som skabelon-DNA for anden-runde forstærkning. Det er også vigtigt at anvende en DNA-polymerase med meget høje fidelity og korrekturlæsning kapaciteter for at minimere PCR-introducerede fejlinkorporering. Der henvises til listen over reagenser til det anbefalede produkt.
    2. Overfør anden runde PCR mix termocyklusapparat og kør programmet beskrevet i tabel 2B. Bemærk: Efter afslutning af programmet, vil produkterne af denne reaktion køres på en agarosegel at bekræfte produktionen af ​​produktet.
  4. Tilsæt 3 pi 5x påføringsfarvestof til 5 & #181 og l anden runde reaktion volumen på 50 mikroliter og køre på 120 V på en 1% agarose-TAE-gel, der indeholder en UV-fluorescerende DNA-farve indtil bands er løst. Visualiser 1,6 kb bånd på et blåt lys lampe (se figur 1A).
  5. Kør de resterende 45 ul reaktion volumen på en 1% agarose-TAE-gel, der indeholder en DNA-farve, og udskære de nødvendige bånd med en ren barberblad.
    1. Uddrag DNA fra gelskiven ved hjælp af en gel-oprensningskit, elueres i nuklease-frit vand, kombinere tre positive reaktioner per individ, og fryse produktet ved -20 ° C til senere brug.

2. Forberedelse gag Amplikoner til kloning ved introduktionen af det nødvendige Restriction websteder

  1. Forstærk Long Terminal Repeat (LTR) / 5 'UTR portion af MJ4 plasmidet (se tabel 3).
  2. Visualiser 1,3 kb PCR-produkter på illuminator, punktafgifter positive amplikationsprodukter, gel rense og fryse som tidligerebeskrevet (1.4,1.5; se figur 1B).
  3. Opret smeltet MJ4 LTR- gag ampliconer via "splejseoverlapinterval-udvidelse" PCR (se tabel 4).
  4. Visualiser, punktafgifter, rense og fryse de 3,2 kb amplikoner som i 1.4,1.5 (se figur 1C).

3. Kloning Amplified gag gener i MJ4, undertype C, infektiøs molekylær klon

  1. Fordøj 1,5 ug MJ4 plasmidet og 1,5 ug oprenset LTR- gag-PCR-produkt med BclI (methylering følsom) restriktionsendonuklease i 1,5 timer ved 50 ° C (se tabel 5A).
  2. Tilsæt 1 pi NgoMIV til digereringsreaktionen og inkuberes ved 37 ° C i 1 time.
  3. Tilføj 5x påføringsfarvestof til begrænsning fordøje reaktioner og langsomt Elektroforesér samlede mængde på en 1% agarose-TAE-gel indeholdende en DNA gel pletten i 1-2 timer ved 100 V. Visualiser, punktafgifter og rense angivne bånd til kloning som tidligere described (se figur 2).
  4. Forbered ligeringsreaktioner anvendelse af oprenset LTR- gag insert og MJ4 vektor-DNA på et 3: 1 Indsæt vektor forholdet. Inkuber ligeringsreaktioner natten over ved 4 ° C (se tabel 5B).
  5. Transform JM109 kemisk kompetente bakterier med ligeringsprodukter og spredt på LB-agarplader med 100 ug / ml ampicillin og vokse ved 30 ° C i 22 + timer.
    1. Optø JM109 kompetente celler på is i 15 min. Label 1,5 ml mikrocentrifugerør og chill på is.
    2. Alikvot 50-100 ul af JM109-celler til at pre-kølet 1,5 ml mikrocentrifugerør. Tilføj 2,5-5 ul ligeringsreaktion til JM109-celler, svippede rør let at blande og straks vender tilbage til is. Inkuber kompetente celler med ligeringsprodukt på is i 30 minutter.
    3. Varmechok 1,5 ml mikrocentrifugerør indeholdende JM109-kompetente celler og ligeringsreaktionen i en 42 ° C varmeblok i 45 sekunder og vender tilbage til is i mindst 3 min.
    4. Der tilsættes 50 ul SOC medie til hver mikrocentrifugerør og pladen hele transformationsreaktionen på stuetemperatur LB-agarplader suppleret med 100 ug / ml ampicillin.
    5. Overfør plader til en 30 ° C inkubator og lad for 20 timer, eller indtil kolonier tydeligt dannet.
  6. Pick isolerede kolonier og vokse i 4 ml LB med 100 ug / ml ampicillin ved 30 ° C i 22 + timer.
  7. Spin ned kulturerne ved 3.200 x g i 15 minutter, hæld bouillon og ekstrahere plasmid-DNA.
  8. For at bekræfte kloning fidelity skære miniprep DNA med NgoMIV og HpaI restriktionsenzymer i en dobbelt fordøjelse ved 37 ° C i 2 timer. Analyser på 1% agarose-TAE-gel (se tabel 5C).
  9. Sekvens LTR-gag insert region i hvert plasmid ved hjælp af følgende primere: GagInnerF1, GagF2, REV1, REV3 og GagR6 (tabel 6) for at bekræfte sekvens identitet.
  10. Sammenlign de klonede sekvenser opnået med befolkningen sekvenser derived fra den oprindelige oprensede amplikon fra 1.5.1. Bemærk: Det er vigtigt, at i sidste ende at vurdere replikation kapacitet på to uafhængige kloner for at sikre, at alle in vitro-replikation fænotyper ikke skyldes backbone fejl indført under kloning processen.

4. generation og titrering replikationskompetent Gag-MJ4 Kimære Vira

  1. Generate replikationskompetent virus ved transfektion af 1,5 ug af det kimære MJ4 plasmid-minipræp-DNA ind i 293T-celler under anvendelse af en 4: 1-forhold mellem Fugene HD som beskrevet af Prince et al 39.
  2. Titer høstet virusstammer på TZM-BL celler som beskrevet nedenfor og i Prince m.fl. 39.
    1. Plate TZM-bl celler 24 timers før infektion med virus med henblik på at få en 30-40% sammenflydende cellemonolag den følgende dag. Dette kan normalt opnås ved at tilsætte 5 x 10 4 celler i et totalt volumen på 800 pi per brønd i en 24-brønds plade.
    2. Efter tilsætning af celler til brønden, forsigtigt flytte 24-brønds plade frem og tilbage, så side til side med henblik på effektivt at distribuere celler. Aldrig swirl - dette vil resultere i celler akkumuleres i midten af ​​pladen.
    3. Den følgende dag, forberede 1% FBS i DMEM; dette vil blive anvendt til at fortynde DEAE-dextran og at fortynde virusstammer. Stock DEAE-dextran er 10 mg / ml eller 125x, og en endelig koncentration på 80 pg / ml eller 1x ønskes.
    4. Tag virusstamme, der skal testes fra -80 ° C fryser og sted på rysteapparat tø op ved stuetemperatur.
    5. Ved hjælp af en multikanalpipette, serielt fortyndet virusstammer i en rundbundet vævskulturbehandlede 96-brønds plade med låg. Dette er en 3-ganges fortynding protokol. Se tabel 7 til fortynding ordningen.
    6. Fjern medier fra podet TZM-bl plader med 24 brønde ved hjælp af et vakuum aspirator sørg for ikke at forstyrre cellemonolag. Kun fjerne mediet fra en 24-brønds plade på et tidspunkt, så cellerne gørikke tørre ud.
    7. Tilføj 150 ul af 1x DEAE-dextran + 1% FBS i DMEM-blanding til hver brønd med en 1.000 pi pipette. Brug ikke gentage pipette, da dette forstyrrer monolag.
    8. Tilføj 150 ul af hver virusfortynding til den passende brønd. Tilføj virus til centrum af brønden og bland forsigtigt for at fordele virus i cellemonolaget. Inkuber inficerede celler i 2 timer i en vævsdyrkningsinkubator ved 37 ° C og 5% CO2.
    9. Efter 2 timers inkubation tilsættes 0,5 ml 10% FBS i DMEM til hver brønd og returnere pladerne inkubator for yderligere 48 timer.
    10. Efter 48 timer bør celler være 100% sammenflydende. Fordi MJ4 er et replikationskompetent virus, vil der være nogle celledød, men det kan forventes.
    11. Fjern medier fra hver brønd, og der tilsættes 400 ul / brønd af fastsættelsen opløsning (se tabel 8A om opskriften). Fix kun én plade ad gangen. Tilføj fikseringsopløsning anvendelse af en 1.000 pi pipette og lad det sidde i 5 minutter vedstuetemperatur.
    12. Fjern fikseringsopløsning og vaskes 3x med PBS med Ca2 + / Mg2 +. Brug en sprøjteflaske til forsigtigt tilføje PBS til den side af godt for at undgå at forstyrre monolag. Efter den tredje vask, skamplet plade tørre på absorberende papir.
    13. Tilsæt 400 gl / brønd farveopløsning (se tabel 8B til opskrift) til hver brønd i 24-brønds plade, og der inkuberes ved 37 ° C i mindst 2 timer. Længere inkubationstider er acceptable, men inkubationstiderne bør holdes konsistent mellem titrering eksperimenter.
    14. Vask 2x med PBS med Ca 2 + / Mg2 + og score til infektion eller tilføje PBS og opbevares ved 4 ° C til scoring senere. Pladerne kan opbevares ved 4 ° C i op til fire dage, så længe monolaget holdes hydreret.
    15. For at score infektion, skal du bruge en permanent markør for at opdele brønde i 24-brønds plade i kvadrater. Tæl alle blå celler inden for et synsfelt ved hjælp af en total forstørrelse 200X, en gang ihver af de fire kvadranter af en brønd.
    16. Beregne Infektiøse enheder pr pi som følger: [(# blå celler / 4) x 67] / (pi virus tilsat) = IE / ul. Se Tabel 8C til volumen i pi virus tilsat til hver brønd. Gennemsnitlige flere brønde sammen; tallene bør være relativt ens for en nøjagtig titrering.

5. Fremstilling af Kultur Medier og formering af GXR25 celler til replikation in vitro assay

  1. Forbered komplet RPMI (cRPMI) til formering af GXR25 celler. BEMÆRK: Det er ekstremt vigtigt at kultur GXR25 celler mindst 4 måneder før planlagt replikering eksperimenter (se tabel 9).
  2. Split celler 1:10 to gange om ugen og vedligeholde celle tæthed mellem 1 x oktober 5-2 x 10 6 celler / ml.

6. In vitro Replikation af Gag-MJ4 kimærer i GXR25 (CEM-CCR5-GFP) Celler

  1. Dagen før jegnfection, opdele cellerne til en koncentration mellem 2-3 x 10 5 celler / ml, således at de er i logaritmisk vækst på dagen for infektion.
  2. På dagen for infektion, fjerne virusstammer fra -80 ° C fryser og tø. Beregn mængden af virus til fra hver bestand baseret på IU / ul titer fra TZM-bl celleassay for at inficere 5 x 10 5 GXR25 celler ved en infektionsmultiplicitet på 0,05 ved anvendelse af formlen:
    Volumen af ​​virus til infektion (pl) = 1 gl / X IU x 0,05 x 500.000
    BEMÆRK: Vi har valgt en MOI på 0,05, da dette resulterer i en logaritmisk vækstfase for alle de vira, som vi har testet. Det er vigtigt at foretage indledende forsøg for at bestemme den optimale MOI for at fange logaritmisk vækst for virus, der skal testes.
  3. Fortyndet virus i cRPMI til et volumen på 100 pi (for at opnå en 0,05 MOI) og tilsæt i en brønd af en V-bund vævskulturbehandlede 96-brønds plade. Bemærk: Medtag både en Posi-ve (MJ4 WT smittet) og en negativ (mock inficerede celler) kontrol i hvert sæt af replikation eksperimenter. Opsætning af pladen sådan at hver anden kolonne er tomt at begrænse krydskontaminering mellem brønde. Den positive kontrol er nødvendigt, da det senere som en standard vil blive anvendt til at normalisere replikation skråninger, som er et mål for replikation på eksperimentelle gentagelser.
  4. Grev GXR25 celler ved anvendelse af en automatiseret celle tæller. Beregn antallet af celler, der er nødvendige i alt for alle infektioner (5 x 10 5 x # infektioner). Alikvot den nødvendige mængde i en 50 ml konisk rør og centrifuge til pelletering celler. Altid beregner for 25% flere infektioner end nødvendigt.
  5. Aspirer medier omhyggeligt og resuspender i cRPMI i en koncentration på 5 x 10 5 celler / 100 ul.
  6. Pipette celler i en steril trug, og der blandes. Ved hjælp af en multi-kanal pipette tilsættes 100 ul celler til hver brønd i 96-brønds plade indeholdende fortyndet virus. Mix grundigt.
  7. Tilsæt 2 pi af 5 mg / ml (100x) opløsning af polybren til hver brønd, og bland celler grundigt.
  8. Der inkuberes ved 37 ° C i vævskultur inkubator med 5% CO2 i 3 timer.
  9. For at vaske inficerede celler, at centrifugen 96-brønds V-bundplade pelletere cellerne. Fjern derefter forsigtigt 150 pi af mediet og erstatte med friske 150 ul cRPMI uden at forstyrre cellepelleten. Gentag to gange mere (herunder centrifugering) i tilstrækkelig grad at vaske cellerne.
  10. Efter den sidste centrifugering og tilsætning af 150 pi cRPMI, resuspendere cellepelleten med en multikanalpipette og tilsæt hele cellen / virus blandingen (ca. 200 ul) fra hver brønd uafhængigt til 800 pi cRPMI i en brønd i en 24-brønds væv dyrkningsplade.
  11. Sæt plade i 5% CO 2 vævsdyrkningsinkubator ved 37 ° C.
  12. Hver to dage, fjernes 100 pi supernatant fra overfladen af ​​kulturen godt og overføre til en 96-brønds UBunden plade og opbevares nedfrosset ved -80 ° C, indtil der kører virus kvantificering assay. BEMÆRK: Forsigtig arrangement af supernatanter i 96-brønds plader vil give mulighed for multi-kanal pipette overførsel af kultursupernatanter under virion kvantificering via en radiomærket reverse transkriptase (RT) assay. Hver plade skal indeholde prøver fra en infektion standard for at normalisere inter-plade variation i RT-assay udlæsning.
  13. Efter hver 100 ul prøve at fjerne, opdele celler 1: 2 ved grundigt resuspenderes cellerne og fjerne halvdelen af ​​det resterende volumen (450 ul). Restore oprindelige volumen (1 ml) ved tilsætning af 550 pi frisk cRPMI til hver brønd.

7. Analyse af revers transkriptase (RT) i cellekultursupernatanterne

Protokol tilpasset fra Ostrowski et al 40.

  1. Opsætning biologiske sikkerhed hætte i en BSL-3 anlæg til brug med radioaktive materialer.
    1. Placer absorberende papir i hood og erstatte aspirator til udsugningsapparat udpeget til radioaktiv brug. Bemærk: Alt radioaktivt affald skal bortskaffes korrekt med overensstemmelse med sikkerhedsreglerne.
  2. Tilføj 1-2 ul 10 mCi / ml [α- 33P] dTTP og 4 pi 1 M dithiothreitol (DTT) til hver 1 ml portion RT mastermix (se tabel 10 og Ostrowski et al. 40).
  3. Bland forsigtigt hver 1,5 ml mikrocentrifugerør RT Master Mix, DTT, og [α- 33 P] dTTP med en 1.000 ul pipette og overføres til en steril truget.
  4. Dispensér 25 pi mærket RT blandes i hver brønd på 96-brønds tyndvægget PCR-plade. Bemærk: inkluder plads til en positiv kontrol (MJ4 WT infektion) og negativ kontrol (Mock infektion).
  5. Der tilsættes 5 ul af hver supernatant til PCR-plade indeholdende RT stamblanding.
  6. Seal PCR-pladen med den selvklæbende folie låg og inkuberes i 2 timer ved 37 ° C i en thermocycler. Af sikkerhedsmæssige årsager, rinSE pipettespidser med Amphyl og afhænde tips i lille beholder indeholdende Amphyl affald, som senere vil blive afhændet i radioaktivt affald.
  7. Efter inkubation lave små huller i folien låg ved hjælp af en 200 pi multi-kanal pipette. Bemærk: Hvis pipettespidser berøre væske i godt erstatte tips, før du flytter til den næste kolonne eller række.
  8. Bland prøver 5x og overførsel 5 pi af hver prøve til DE-81 papir. Lufttørres 10 minutter.
  9. Vask blots 5x med 1x SSC (natriumchlorid, natriumcitrat) og derefter 2 gange med 90% ethanol ved 5 minutter per vask. Lad det lufttørre.
    1. Placer hver blot i en separat vask beholder, såsom en sandwich opbevaringskasse, tilføje nok vaskebuffer (1x SSC eller 90% EtOH) til at dække blot og rystes i 5 min.
    2. Hæld vaskebuffer i separat beholder og gentag. Bemærk: De første 3 vaske betragtes radioaktive og skal bortskaffes korrekt. De sidste 2 vaske kan bortskaffes regelmæssigt.
  10. Når det er tørt, bilefully wrap skamplet i Saran wrap og udsættes for en phosphoscreen i en tæt forseglet kassette natten over ved stuetemperatur.
  11. Analyser phosphoscreens med phosphorbilleddanner og kvantificere radioaktive afskrifter.
  12. Tegn en cirkel rundt om hvert radioaktivt signal ved hjælp OptiQuant software. Tegn de digitale lys Unit (DLU) værdier til at generere replikation kurver.
  13. For at generere replikationskapacitet scoringer, DLU værdier var log 10 transformerede og skråninger blev beregnet ved hjælp af dag 2, 4 og 6 tidspunkter. Replication skråninger er derefter divideret med hældningen af ​​WT MJ4 i orden generere replikationskapacitet scoringer. Det er vigtigt at normalisere baseret på MJ4 WT værdier opnået fra samme RT plade for at reducere intra-assay variation.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

For at kunne udføre denne protokol, hvilket skaber en proviralt plasmid i stand til at samle fuldt funktionelle, smitsomme Gag-MJ4 kimærer, må man være meget omhyggelig med at generere de relevante PCR amplikonerne. Vurdering af, om PCR har genereret den passende størrelse gag amplikon er afgørende. Produkterne bør være inden for 100 basepar (bp) af cirka 1.700 bp amplikon afbildet i figur 1A. Den nøjagtige længde af dette fragment vil variere afhængigt af gag-genet under undersøgelse. Dernæst skal de 5 lange terminale gentagelse (LTR) del af MJ4 molekylære klon amplificeres og splejset til gag-amplikon for at gøre det egnet til efterfølgende kloning. Den MJ4 LTR amplikon bør være 1.474 bp i længde. Figur 1B viser en repræsentativ gel billede, som er angivet korrekte båndstørrelser. Efter splejseoverlapinterval--PCR 41 bør kombinerede LTR- gag produkter væreca. 3.200 bp i længde, som vist i figur 1C.

Når gag-genet er blevet gjort egnede til kloning ved fusion til 5'-LTR fra MJ4, som indeholder sitet nødvendigt NgoMIV begrænsning, både vektoren og gag Indsatsen skal fordøjes med NgoMIV og BclI restriktionsenzymer og udskåret fra en agarosegel efter elektroforetisk adskillelse. Det er bydende nødvendigt at udskære den egnede vektor og insert bands. En repræsentativ gel er vist i figur 2. Vektoren del af MJ4 plasmidet bør være cirka 10.000 bp i længde, mens LTR- gag indsatsen bør forblive på omkring 3.000 bp i længde, som restriktionsstederne er placeret ved de yderste ender af amplikonet. Enhver væsentlig nedgang i størrelse vil indikere en yderligere nedskæring-site inden for gag-genet under undersøgelse.

Efter ligering af de to fragmenter, bakteriel transformation, ennd isolering af plasmid-DNA, skal Gag-MJ4 kimærer kontrolleres for passende størrelse ved at udføre en dobbelt fordøjelse med NgoMIV og HpaI restriktionsenzymer. Fuld længde Gag-MJ4 kimærer, der ikke er afholdt fjernelser begivenheder i bakteriereplikation bør have en begrænsning mønster, der svarer til den, der er afbildet i figur 3, med to bånd på omtrent 8.700 og 4.300 bp.

En vigtig forskel på denne protokol i forhold til tidligere metoder, er brugen af ​​HIV-1 subtype C infektiøs molekylær klon, MJ4, snarere end den mere almindelige laboratorie-tilpasset NL4-3 virus. Imidlertid kunne de fremgangsmåder, der er beskrevet i det foregående afsnit ændres til kloning af subtype B gag-sekvenser i pNL4-3.

En optimering af infektionsmultiplicitet (MOI) til anvendelse i efterfølgende eksperimenter blev udført med henblik på at vælge den ideelle MOI der viste logaritmisk vækst af et flertal af de testede vira.Figur 4 viser repræsentative replikation kurver fra tre forskellige MOI (0,01, 0,05 og 0,25) for MJ4 (figur 4A) samt til NL4.3 (figur 4B). MJ4 replikerer meget mindre effektivt i GXR25 celler end NL4-3, hvilket er vigtigt at tage hensyn til, som en MOI passende for NL4-3 replikation sandsynligvis ville være for lav til at detektere effektiv MJ4 replikation. Som det ses i figur 4A, en MOI på 0,05 i modsætning til 0,01 eller 0,25, var det ideelle valg, fordi logaritmisk vækst blev observeret mellem dag 2-6 til MJ4. For lavere MOI, 0,01, dag 6 DLU værdier er næppe påvises, og vi forventede generering af Gag-MJ4 kimære virus, der kopieres lavere end MJ4. Denne MOI vil derfor ikke fange væksten i de mere svækkede Gag-MJ4 kimærer, som også kan være den mest biologisk kritiske. Derudover en MOI på 0,25 var ikke ideel, fordi den hurtige kinetik for viral replikation dræbt en betydelig Amount af celler, selv på dag 4. Dette bevirker, at replikering kurven til plateau, og beregne en hældning baseret på en kurve som denne ville undervurdere replikation kapacitet. Baseret på kurver genereret med NL4-3, selv ved en MOI på 0,01, har til rådighed celle målene blevet mærkbart udmattet af dag 6 efter infektion. Afslutningsvis blev en MOI på 0,05 viste sig at være optimalt for et stort panel af Gag-MJ4 kimære virus, som alle havde forskellige Gag sekvenser og forskellige grader af replikation.

I alt 149 Gag-MJ4 kimæriske vira afledt af akut subtype C Gag-sekvenser er blevet testet for in vitro-replikation ved hjælp af dette assay. De normaliserede RC værdier varierede fra 0,01 til over 3,5 med nogle vira replikerer mere end 100 gange mere effektivt end vildtype-MJ4. Figur 5 viser replikation kurver fra ni repræsentative Gag-MJ4 kimære vira, med vildtype-MJ4 afbildet i rød, og viser den brede vifte af replikation capacities overholdes. Således kan sekvensen mangfoldighed i gag-genet alene drastisk påvirke virusets evne til at replikere in vitro. Mens dette er repræsentativt for Gag-MJ4 kimære virus stammer fra akut inficerede zambiere andre undertype C-sekvenser ikke er blevet grundigt testet, og kan udvise forskellige replikation kinetik. Derfor skal der udvises stor omhu for at optimere MOI, der passer til specifikke replikation af virus i en bestemt undersøgelse, fordi der kan være en bred vifte i niveauet af replikation mellem forskellige HIV-1-backbones og gag-isolater.

En af fordelene ved at bruge en T-cellelinie, såsom GXR25 cellelinie, der understøtter replikation af MJ4, er niveauet af reproducerbarhed observeret i forhold til replikation eksperimenter under anvendelse af stimulerede perifere mononukleære blodceller som mål. I indledende optimering eksperimenter MJ4 vildtype udviste en intra-assay variation på 8,7%, og font kloner af samme Gag-MJ4 kimære virus udviste variation i replikation af 8,5%. Da forskellige masterblandinger og phosphoscreen eksponeringer kan give DLU værdier, der adskiller en smule i størrelse, kan intra-assay variation yderligere styres ved at køre den samme virus standard (i vores tilfælde vildtype MJ4) i hver RT assayplade. Figur 6 grafer den DLU-værdier afledt af den samme MJ4 infektion, kvantificeret i otte forskellige RT-plader. Normalisering af en virus, der er fælles for alle RT-assays kan bidrage til at begrænse den potentielle fejl fremkaldt af disse små ændringer i signalet størrelsesorden mellem assays.

Inter-assay trinløst blev også testet og replikater gentaget på forskellige dage var stærkt korrelerede. Figur 7 parceller de normaliserede RC score værdier fra to uafhængige forsøg udført omkring et år fra hinanden. En høj grad af korrelation med fraværet af større outliers (R2 = 0,873) blev observeret mellem kølinglem de to uafhængige gentagelser.

Selvom højt korreleret, der er en vis variation i den samlede størrelse af replikation kinetik mellem de to uafhængige forsøg. Dette kan til dels tilskrives forskellen i antal passage mellem GXR25 celler arter, der anvendes i hvert forsøg. I almindelighed GXR25 celler lagre, der er blevet passeret i en tidsperiode større end 6 måneder tendens til at støtte mere effektiv replikation af Gag-MJ4 kimærer. Derfor er det tilrådeligt at vurdere replikation kapacitet blandt grupper af kimærer i en måneds tid. Når de forrige trin følges nøje, dette assay er stand til at producere meget robust og reproducerbare resultater, der gælder for en bred vifte af undersøgelser.

Figur 1
Figur 1. Repræsentant gel images afbilder elektroforetisk separation af PCR-produkter. For alle PCR-produkter, blev 5 pi af hver 50 ul reaktion blandet med 3 pi 5x påføringsfarvestof, fyldt i en 1% agarose-TAE-gel suppleret med 1X SYBR-sikker DNA-gel-plet, og separeret ved elektroforese ved 120 V i 45 minutter. Promega 1 kb DNA-stige (bane 1) blev anvendt til at tilnærme amplicon størrelser. A) gag-genet blev amplificeret fra virus-RNA under anvendelse af et nested PCR strategi. På grund af insertioner og deletioner kan gag amplikon variere fra 1.600-1.700 bp i længde og synes lidt over 1500 bp DNA-stige markør. Banerne 2-5 afbilder vellykket amplifikation gag-genet. B) 5'-LTR MJ4 blev amplificeret fra vildtype-MJ4 plasmidet og visualiseres via elektroforetisk adskillelse. Banerne 2-5 skildrer vellykket forstærkelse af 1.474 bp LTR produkt, som synes lidt under 1.500 bp DNA ladder markør. C) at 5R17; LTR afledt fra vildtype MJ4 og gag-genet amplificeret fra patient plasma smeltet sammen via splejseoverlapinterval-forlængelse PCR og visualiseres via elektroforetisk adskillelse. Banerne 2-5 skildre succes sammensmeltede amplikoner der er cirka 3.200 bp i størrelse, og som optræder lidt over 3.000 bp DNA stigen markør.

Figur 2
Figur 2. repræsentant gel, som viser elektroforetisk separation af restriktionsfordøjelser til kloning patientens gag generne i MJ4. Vildtype MJ4 plasmidet og LTR- gag fusionsprodukter blev fordøjet med BclI i 1,5 timer ved 50 ° C og NgoMIV i 1 time ved 37 ° C C. Vektor og insert-fragmenter blev visualiseret ved hjælp af elektroforetisk separation på en 1% agarose-TAE-gel suppleret med 1X SYBR-sikker DNA-gel plet ved 100 V i 2 timer og under anvendelse af et blåt lys lampen for at reducere UV-induceret DNA-beskadigelse. Vektoren og insertionsfragmenter egnet til efterfølgende kloningstrin vises omkring 10.000 bp og 2900 bp.

Figur 3
Figur 3. repræsentant gel, som viser elektroforetisk separation af restriktionsspaltninger oprenset Gag-MJ4 kimære plasmid-DNA. Renset Gag-MJ4 kimære plasmid-DNA blev dobbelt fordøjet med NgoMIV og Hpal restriktionsenzymer i 2 timer ved 37 ° C. Restriktionsfordøjelser blev visualiseret ved hjælp af elektroforetisk separation på en 1% agarose-TAE-gel suppleret med 1X SYBR-sikker DNA-gel-pletten ved 120 V i 45 minutter. Plasmider uden store sletninger vil løse to forskellige bands på cirka 8.700 og 4.300 bp.


Figur 4. Replikation af MJ4 og NL4-3 isolater af HIV-1 i GXR25 cellelinje i forskellige infektionsmultipliciteter (MOI). 5 x 10 5 GXR25 celler blev inficeret som beskrevet i metodeprotokollen med 5-fold stigende MOI hver virusstamme. Supernatanter blev opsamlet på dag 2, 4, 6 og 8 efter infektion og virion-produktion blev kvantificeret ved hjælp af en radioaktivt mærket revers transkriptase-assay. Infektioner blev kørt tredobbelt og fejlsøjler angiver standardafvigelsen for de tre gentagelser. (A) MJ4 (B) NL4-3.

Figur 5
Figur 5. repræsentativt udvalg af replikation for forskellige Gag-MJ4 kimærer. 5 GXR25-celler inficeret med vildtype-MJ4 eller Gag-MJ4 kimærer ved en MOI på 0,05, blev supernatanter indsamlet fra to dages intervaller efter infektionen, og virionproduktion kvantificeres ved en radiomærket RT-assay. Indsættelse af forskellige undertype C afledt gag generne kan have en dramatisk effekt på replikation kapacitet MJ4. Vildtype MJ4 replikation er betegnet med rødt.

Figur 6
Figur 6. Sammenligning af intra-assay variationen i den radiomærkede reverse transkriptase (RT) kvantificering assay. Grafen viser iboende intra-assay variationen ved at plotte DLU værdier af samme supernatanter fra en enkelt vild type MJ4 infektion i otte forskellige RT-assay plader. Variationen i kurver afspejler de små ændringer i signal størrelsesorden væddemålWeen plader, der kan korrigeres for ved at køre en standard på hver RT plade, som efterfølgende kan bruges til at normalisere skråningerne af gag-MJ4 kimærer analyseret på den samme plade.

Figur 7
Figur 7. Reproducerbarhed af replikation assayet over tid i GXR25 cellelinje. De samme Gag-MJ4 kimæriske vira blev anvendt til at inficere GXR25 celler i to uafhængige forsøg udført cirka et års mellemrum. Replication scoringer blev genereret ved at beregne hældningen af ​​log-transformerede DLU værdier og normalisere denne hældning til vildtype MJ4. Gag-MJ4 kimærer, der kopierer mere effektivt end vildtype MJ4 har replikation scoringer større end 1, og dem, der replikerer mindre effektivt end vildtype MJ4 har replikation scorer mindre end 1. De to uafhængige målinger er stærkt korrelerede (R2 = 0,87, lineær regression), og fremhæve reproducerbarheden af analyser udført på forskellige tidspunkter og med celler i forskellige passager.

A)

Reagens Volumen til 1x reaktion (ul)
2x Reaction Mix (Invitrogen) 25
Nuclease-free H2O 17
Forward primer GOF (20 uM koncentration) 1
Reverse primer Vifor (20 uM koncentration) 1
SuperScript III Et-trins Enzyme Mix 1
RNA-template 5
Samlet 50

B)

Antal cykler Tid (timer: min: sek) Temperatur (° C)
1 01:00:00 50
1 02:00 94
10 00:15 94
00:30 56
05:00 68
40 00:15 94
00:30 56
05:00 + 5 sek / cyklus 68
1 00:00 68
1 4
SLUT

Tabel 1.) Master mix og B) gag forstærkning. * Bemærk: GOF primersekvensen: 5'-ATTTGACTAGCGGAGGCTAGAA-3 '. Vifor primersekvens: 5'-TTCTACGGAGACTCCATGACCC-3 '.

A)

Reagens Volumen til 1x reaktion (ul)
Nuclease-free H2O 35.5
5x Phusion HF Buffer 10
dNTP'er (40 mM deoxynukleotider) 1
Forward primer GagInnerF1 (20 uM koncentration) 1
Revers primer BclIDegRev2 (20 uM koncentration) 1
Phusion Hot Start II Polymerase 0,5
Første runde PCR som skabelon 1
Samlet 50

B)

Antal cykler Tid (timer: min: sek) Temperatur (° C)
1 00:30 98
29 00:10 98
00:30 53
01:00 72
1 10:00 72
1 4
SLUT

Tabel 2. En) Master mix og B) Thermocycler betingelser for indlejrede anden runde gag forstærkning. * Note: GagInnerF1 primersekvens: 5'-AGGCTAGAAGGAGAGAGATG-3 '. BclIDegRev2 primersekvens: 5'-AGTATTTGATCATAYTGYYTYACTTTR-3 '.

A)

Reagens Volumen til 1x reaktion (ul)
Nuclease-free H2O 35.5
5x Phusion HF Buffer 10
dNTP'er (40 mM deoxynukleotider) 1
Forward primer MJ4For1b (20 uM koncentration) 1
Revers primer MJ4Rev (20 uM koncentration) 1
Phusion Hot Start II Polymerase 0,5
MJ4 plasmid som skabelon (10 ng / ul) 1
Samlet 50

B)

Antal cykler Tid (timer: min: sek) Temperatur (° C)
1 00:30 98
29 00:10 98
00:30 58
00:45 72
1 10:00 72
1 4
SLUT

Tabel 3. En) Master mix og B) Thermocycler betingelser for 5'MJ4 LTR forstærkning. * Bemærk: MJ4For1b primersekvensen: 5'-CGAAATCGGCAAAATCCC-3 '. MJ4Rev primersekvensen: 5 '-CCCATCTCTCTCCTTCTAGC-3 '.

A)

Reagens Volumen til 1x reaktion (ul)
Nuclease-free H2O 34.5
5x Phusion HF Buffer 10
dNTP'er (40 mM deoxynukleotider) 1
Forward primer MJ4For1b (20 uM koncentration) 1
Revers primer BclIRev (20 uM koncentration) 1
MJ4 LTR 1,3 kb amplikon (geloprenset ~ 50 ng) 1
Phusion Hot Start II Polymerase 0,5
Gag amplikon (geloprenset ~ 100 ng) 1
Samlet 50

B)

Antal cykler Tid (timer: min: sek) Temperatur (° C)
1 00:30 98
29 00:10 98
00:30 58
01:30 72
1 10:00 72
1 4
SLUT

Tabel 4. A) Master mix og B) Thermocycler betingelser for splejseoverlapinterval-udvidelse PCR til at generere LTR- gag skær. * Bemærk: BclIRev primersekvensen: 5'-TCTATAAGTATTTGATCATACTGTCTT-3 '

A)

Reagens Volumen til 1x reaktion (ul) Inkubationstid (HR) Inkubation Temperatur (° C)
1,5 ug af 3 kb LTR- gag amplikon eller MJ4 plasmid x pi 1,5 pg
NEB CutSmart Buffer (tidligere NEB buffer # 4) 2
BclI restriktionsenzym 1
Nuclease-free H2O x
Samlet 19 1.5 50
Enzym NgoMIV begrænsning 1
Samlet 20 1 37

B)

Reagens Volumen til 1x reaktion (ul) Inkubationstid (HR) Inkubation Temperatur (° C)
50 ng snit MJ4 plasmidvektor x pi 50 ng
45 ng skære LTR- gag indsatsen (3: 1) x pi til 45 ng
Roche 10x ligasebuffer 2
Roche T4 DNA-ligase (5 U / pl) 1
Nuclease-free H2O
Samlet 20 18 + (natten over) 4

C)

Reagens Volumen til 1x reaktion (ul) Inkubationstid (HR) Inkubation Temperatur (° C)
450 ng Gag-MJ4 plasmid x pi til 450 ng
NEB CutSmart Buffer (tidligere NEB buffer # 4) 2
Enzym NgoMIV begrænsning 0,5
Hpal restriktionsenzym 0,5
Nuclease-free H2O x
Samlet 20 2 37

Tabel 5. A) restriktionsfordøjelsesprodukt masterblanding og B) ligeringsreaktion til generering af Gag-MJ4 kimære provirus. C) Diagnostisk restriktionsfordøjelse at sikre Gag-MJ4 kloning troskab.

Primer navn Nukleotidsekvensen (5 '- 3')
GagInnerF1 AGGCTAGAAGGAGAGAGATG
GagF2 GGGACATCAAGCAGCCAT
For3 CTAGGAAAAAGGGCTGTTGGAAATG
GagR6 CTGTATCATCTGCTCCTG
REV3 GACAGGGCTATACATTCTTACTAT
Rev1 AATTTTTCCAGCTCCCTGCTTGCCCA

Tabel 6. Liste over sekvensprimere for at bekræfte, 5'-LTR og gag sekvensidentitet Gag-MJ4 kimære provirus.

Nå A 8 pi virus + 232 ul 1% FBS i DMEM
Well B 80 ul fra brønd A + 160 ul 1% FBS i DMEM
Nå C 80 pi fra Well B + 160 ul 1% FBS i DMEM
Nå D 80 ul fra brønd C + 160 ul 1% FBS i DMEM
Nå E 80 pi fra Well D + 160 ul 1% FBS i DMEM
Nå F 80 ul fra brønd E + 160 ul 1% FBS i DMEM

Tabel 7. Udvanding ordning (3-fold) til titrering infektiøse virus på TZM-bl celler.

A)

Reagens Volumen
PBS uden Ca2 + eller Mg2 + 500 ml
Glutaraldehyd 4 ml
Formaldehyd 11 ml

* Bemærk: Opbevares ved 4 ° C.

B)

Reagens Volumen
PBS uden Ca2 + eller Mg2 + 4,75 ml
Kaliumferricyanid (0,2 M) 100 pi
Kaliumferrocyanid (0,2 M) 100 pi
Magnesiumchlorid (1 M) 20 pi
X-gal (50 mg / ml) 40 pi

* Bemærk: Kontroller frisk og gemme væk fra lys indtil brug.


C.

Oprindelig Fortynding godt En B C D E F
Volumen af ​​virus (ul) blev tilsat til brøndene i en 24-brønds plade række 5 1,6667 0,5556 0,1852 0,06173 0,02057

Tabel 8. A) b) fastsættelse af løsninger til titrering af Gag-MJ4 kimære virus på TZM-bl indikator cellelinje. c) mængden af virus, der tilsættes pr godt for beregning af infektiøse enheder / ul.

Reagens Volumen
Føtalt bovint serum (FBS), defineret 55 ml
Penicillin, streptomycin, glutamin (100x) 6 ml
HEPES-buffer (1 M) 6 ml

Tabel 9. Opskrift på komplet RPMI medium til opformering af GXR25 celler.

Reagens Volumen (ml)
Nuclease-fri H2O 419,5
Tris-CI, pH 7,8 (1 M) 30
Kaliumchlorid (1 M) 37.5
Magnesiumchlorid (1 M) 2.5
Nonidet P-40 (10%) 5
EDTA (0,5 M) 1.02
Polyadenylsyre, kaliumsalt (2 mg / ml) 1.25
Oligo-dT-primer (25 ug / ml) 3.25
Samlet 500

Tabel 10. Opskrift på radioaktivt mærket revers-transkriptase-assay mester mix. * Bemærk: Gem som 1 ml prøver ved -20 ° C.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

På grund af længde og tekniske karakter af denne protokol, der er flere trin, der er afgørende for både en vellykket opførelse af kimære Gag-MJ4 plasmider samt til kvantificering af viral replikation kapacitet. Selvom restriktionsenzym baseret kloning strategi for indførelsen af udenlandske gag generne i MJ4 skitseret i denne protokol har mange fordele i forhold til tidligere anvendte rekombination baserede metoder, kan protokollen være teknisk udfordrende, hvis kritiske trin ikke følges nøjagtigt.

For det første er det absolut nødvendigt at bruge MJ4 plasmid-DNA, der er blevet produceret i en kompetent bakteriestamme mangler DCM og dæmningen DNA methylaser. Dette er nødvendigt, da den enzymatiske aktivitet af BclI restriktionsendonuklease, som anvendes til at klone gag generne i MJ4 rygrad, er dæmning / DCM methylering følsom. Den JM110 og SCS110 (en endA negativ JM110 derivat) E. coli-stammer enre egnet til frembringelse af ikke-methyleret MJ4 plasmid-DNA. Derudover, for excision af vektor og insert bands, er det stærkt anbefales, at et blåt lys lampe bruges til visualisering. Dette vil reducere UV-bølgelængde-afhængige DNA-skader og drastisk øge kloning effektiviteten. Hvis et blåt lys illuminator ikke er tilgængelig, kan kloning effektivitet maksimeres ved at visualisere DNA med SYBR Safe DNA gel plet i stedet for ethidiumbromid og minimering af UV-eksponering tid.

Endelig har molekylær kloning med store (> 10 kb) og / eller retrovirale plasmider, såsom MJ4 traditionelt været vanskeligt for en række forskellige årsager. Store plasmider reducere transformationseffektivitet kompetente bakteriestammer 42 mens retrovirale skær, som indeholder terminale gentagelse lang (LTR) sekvenser, reducere stabiliteten af plasmidet og kompromis replikation nøjagtigheden af plasmid-DNA'et i den bakterielle vært, der fører til deletioner af det retrovirale genom 43 E. coli-stamme over DH5a stammen, i vores hænder. På grund af ustabile natur af plasmidet, bør oprensede plasmid produkter altid kontrolleres for korrekt plasmid størrelse ved restriktionsenzymfordøjelse; her, en dobbelt fordøjelse med NgoMIV og HpaI restriktionsendonucleaser ved 37 ° C i 2 timer.

Når vellykket generering af kimære Gag-MJ4 plasmider er blevet udført, er virus genereres via transfektion af 293T celler, titrerede på en indikator cellelinie, TZM-bl celler, og replikation kapacitet måles ved anvendelse af en CEM-baserede T-cellelinie. CEM-baserede GXR25 cellelinie anvendes til disse replikation undersøgelser er en af ​​de få etablerede T-cellelinier, der understøtter indtastning og replikation af CCR5-tropiske stammer af HIV-1. Dette er blevet opnået ved retroviral transduktion for at tillade stabil ekspression af human CCR5 37. Denne cellelinie naturligt udtrykker CXCR4 og vil understøtte replikation af CXCR4-tropiske HIV-1, såsom laboratoriet tilpasset stamme NL4-3. Men for at støtte effektiv replikation af CCR5-tropiske stammer, såsom MJ4 skal GXR25 celler opformeret til ikke mindre end 4 måneder før infektion. Korrekt passerede kulturer kan støtte replikation selv efter passage i op til 1 år. Omhyggelig monitorering af CCR5-tropisk replikation hele passage er afgørende for vellykkede eksperimenter.

Som med enhver teknik, der er begrænsninger på prokol, der skal overvejes. På grund af placeringen af restriktionssites i MJ4 plasmidet samt tilgængeligheden af konserverede restriktionssteder i naturligt forekommende HIV-1-isolater, er 3 'distale restriktionssted, BclI, placeret 137 nukleotider fra gag-stopkodonen. Selv om dette genererer en kimære proteasegen, denne region er 96,5% bevaret i denne kohorte, og vi ikke observere en overflod af døde eller defekte kimære virus.

En af fordelene ved at bruge MJ4 undertype C infektiøs molekylær klon med undertype C afledte sekvenser er, at det reducerer risikoen for suboptimale gen parring mellem gag generne og backbone vektorer af forskellige undertyper. , En vis mængde inden-clade mangfoldighed eksisterer dog som det fremgår af den gruppering af HIV-1-sekvenser af land eller område, selv når fundet inden for samme undertype 31. Dette kunne bidrage til suboptimal parring mellem gag generne thereived fra akut inficerede zambiere og MJ4 infektiøse molekylære klon rygrad, der var afledt af en kronisk inficeret person fra Botswana 38. Et flertal af de analyserede konstruktioner producerede infektiøst afkom virus. Da forskellige HIV-1 subtype C infektiøse molekylære kloner bliver mere bredt tilgængelige, vil det være vigtigt for yderligere at validere dette system ved kloning i disse HIV-1 clade C gag generne i andre skeletter med henblik på at sikre, at der er en minimal skævhed indført på grund til backbone uoverensstemmelser.

Den GXR25 cellelinien er en unik cellelinie, specifikt på grund af dets evne til at understøtte både CXCR4 og CCR5-tropiske stammer og HIV-1-inducerbare GFP reporter 37. Der er dog visse begrænsninger og bør overvejes nøje, før du bruger denne cellelinje til eksperimenter tilpasset fra denne protokol. Den GXR25 cellelinie synes ikke at understøtte indtastning af et flertal af undertype C eller A, CCR5-tropisk, PRimary isolerer vi har testet. Derudover forælder CEM cellelinje, hvorfra GXR25 cellelinje blev afledt udstiller høje niveauer af cyclophilin A, op til 2 til 4 gange højere udtryk end Jurkat cellelinje 44. På grund af høje niveauer af cyclophilin A normalt replikationsdefekt forbundet med den kanoniske HLA-B * 57 forbundet flugt mutation T242N, hvilket skyldes en nedsat evne til capsid at binde cyclophilin A, ikke let kan påvises i denne cellelinie 25. Således CEM-baserede GXR25 cellelinje ikke er ideel til at studere replikation defekter forbundet med mutationer i HIV-1-capsid cyclophilin-bindende løkke.

Endelig, mens denne protokol er ideel til analyse af replikation kapacitet gag-sekvenser afledt fra akut tidspunkter ændringer skal foretages for at studere replikationen kapacitet gag gener afledt fra kronisk inficerede individer. Denne protokol omfatter amstærkning af befolkningens sekvenser fra akutte tidspunkter (median 45 dage poste forventede dato for infektion), når viral mangfoldighed er begrænset. Gag-genet fra hvert kimære derefter sekventeret og sammenlignet med den oprindelige population PCR-amplikon for at sikre kloning fidelity. På grund af begrænset sekvens mangfoldighed på akutte tidspunkter kloning fra population PCR-produkter er mulig. Der er imidlertid sekvens mangfoldighed i den virale quasispecies i en kronisk inficeret individ; derfor med henblik på præcist at vurdere replikation kapacitet de kroniske quasispecies, enkelt genom forstærkning skal være ansat til at fange flere repræsentative varianter. Hver af disse varianter skal så analyseres for in vitro-replikation.

Denne teknik har flere bredere applikationer, som stammer fra dets fordele i forhold til eksisterende metoder. Da denne proces resulterer i en klonal replikationskompetent plasmid, er det nemt at anvende konstruktioner for yderligere mutagenesis undersøgelser, der kan bidrage til at belyse bidrag specifikke rester til viral replikation. Endvidere ved kloning i gag generne fra langsgående tidspunkter, kan man vurdere udviklingen af viral replikation kapacitet over tid, og hvordan disse ændringer kan påvirke patogenesen i en HIV-1 inficeret individ.

Denne teknik kan ændres for at udvide dens anvendelighed til forskellige formål. Yderligere HIV-1-virale proteiner kan splejses ind i MJ4 plasmidet med henblik på at vurdere deres virkninger på viral replikation eller deres samspil med værtsproteiner. Dette kan opnås ved at manipulere yderligere restriktionssteder ved ønskede områder i genomet ved at indføre tavse nucleotidændringer. Dog skal særligt hensyn tages, når ingeniørmæssig nye restriktionssteder i 3'-halvdelen af ​​HIV-1-genomet så mange accessoriske proteiner er kodet i alternative læserammer og tavse ændringer i enprotein kan føre til aminosyresubstitutioner i en anden. I dette tilfælde restriktionssite uafhængige kloning fremgangsmåder såsom dem diskuteret Dudley et al. 45 kan overvinde denne begrænsning. Virale sekvenser afledt fra forskellige populationer, kan have varierende intervaller af replikation kapacitet og MOI kan justeres i overensstemmelse hermed for at fange størstedelen af ​​virale isolater i deres logaritmiske vækstfase. Endelig har GXR25 cellelinien blevet stabilt transficeret med GFP under en LTR-drevet, Tat-inducerbar promotor, og viral spredning kan måles som en funktion af GFP-positive celler via flowcytometri 37 som et alternativ til RT-assayet her eller beskrives en traditionel p24 ELISA.

Afslutningsvis denne protokol giver en effektiv og kraftfuld teknik til vurdering af HIV-1 viral replikation, som er tillagt ved gag-genet, som koder for et bevaret strukturelt protein nødvendigt for en ordentlig virion dannelse, Spirende, modning, demontering 46-48. Desuden er denne teknik genererer et replikationskompetent klonal plasmid, som er ideel til mutagenesestudier og tilvejebringer således en fremgangsmåde til at belyse de specifikke aminosyresekvenser determinanter af viral fitness. Undersøgelser som disse er bydende nødvendigt at øge forståelsen af, hvordan immun-drevet viral evolution påvirker patogenese og sygdomsprogression i HIV-1 inficerede individer.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
PCR Reagents
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagF2: 5' GGGACATCAAGCAGCCAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagR6: 5' CTGTATCATCTGCTCCTG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
CoolRack PCR 96 XT Biocision BCS-529
CoolRack M15 Biocision BCS-125
Nuclease free water Fisher SH30538FS Manufactured by Hyclone
QIAamp Viral RNA Mini Kit Qiagen 52906
Simport PCR 8 Strip Tubes, Blue (Flat Cap) Daigger EF3647BX
SuperScript III one-step RT-PCR system Life Technologies/Invitrogen 12574035
Phusion Hot-start II DNA polymerase Fisher F-549L
PCR Nucleotide Mix Roche 4638956001
Agarose, high gel strength Fisher 50-213-128
TAE 10X Life Technologies/Invitrogen AM9869
Promega 1 kb DNA ladder Fisher PRG5711 Manufactured by Promega
Sybr Safe DNA Gel Stain, 10,000x Life Technologies/Invitrogen S33102
Wizard SV Gel and PCR Clean-Up System Promega A9282
Razor blades, single-edged Fisher 12-640 Manufactured by Surgical Design
Thermocycler, PTC-200 MJ Research
Microbiology & Cloning Reagents
LB Agar, Miller Fisher BP1425-2
LB Broth, Lennox Fisher BP1427-2
Sterile 100 x 15 mm polystyrene Petri dishes Fisher 08-757-12
Ampicillin sodium salt Sigma-Aldrich A9518-5G
Falcon 14 ml Polypropylene round-bottom tubes BD Biosciences 352059
NgoMIV restriction endonuclease New England BioLabs R0564L
BclI restriction endonuclease New England BioLabs R0160L
HpaI restriction endonuclease New England BioLabs R0105L
T4 DNA Ligase, 5 U/μl Roche 10799009001
JM109 competent cells, >108 cfu/μg Promega L2001
PureYield plasmid miniprep system Promega A1222
Safe Imager 2.0 Blue Light Transilluminator Invitrogen G6600
Microfuge 18 centrifuge Beckman Coulter 367160
Cell Culture Reagents
Amphyl cleaner/disinfectant Fisher 22-030-394
Fugene HD, 1 ml VWR PAE2311 Manufactured by Promega
Hexadimethrine bromide (Polybrene) Sigma-Aldrich H9268-5G
Costar Plates, 6-well, flat Fisher 07-200-83 Manufactured by Corning Life
Costar Plates, 24-well, flat Fisher 07-200-84 Manufactured by Corning Life
Costar Plates, 96-well, round Fisher 07-200-95 Manufactured by Corning Life
Flasks, Corning filter top/canted neck, 75 cm2 Fisher 10-126-37
Flasks, Corning filter top/canted neck, 150 cm2 Fisher 10-126-34 Manufactured by Corning Life
Conical Tubes, 50 ml, blue cap Fisher 14-432-22 Manufactured by BD Biosciences
Conical Tubes, 15 ml, blue cap Fisher 14-959-70C Manufactured by BD Biosciences
Trypsin-EDTA Fisher MT25052CI Manufactured by Mediatech
RPMI, 500 ml Life Technologies/Invitrogen 11875-119
DMEM, 500 ml Life Technologies/Invitrogen 11965-118
Penicillin/Streptomycin/Glutamine, 100x Life Technologies/Invitrogen 10378-016
PBS with magnesium and calcium, 500 ml Life Technologies/Invitrogen 14040-133
PBS without magnesium and calcium Life Technologies/Invitrogen 20012-050
Sarstedt tubes, assorted colors Sarstedt 72.694.996
Reservoir Trays for Multichannel, 55 ml Fisher 13-681-501
DEAE-Dextran Fisher NC9691007
Corning 96 well clear V bottom tissue culture treated microplate Fisher 07-200-96 Manufactured by Corning Life
HEPES, 1 M Buffer Solution Life Technologies/Invitrogen 15630-080
FBS, Defined, 500 ml Fisher SH30070 03
X-gal VWR PAV3941 Manufactured by Promega
Glutaraldehyde, Grade II, 25% in H2O Sigma-Aldrich G6257-100ML
1 M Magnesium chloride solution Sigma-Aldrich M1028-100ML
Formaldehyde solution, for molecular biology, 36.5% Sigma-Aldrich F8775-500ML
Potassium hexacyanoferrate(II) trihydrate Sigma-Aldrich P9387-100G
Potassium hexacyanoferrate(III) Sigma-Aldrich P8131-100G
Allegra X15-R centrifuge Beckman Coulter 392932
TC10 automated cell counter Bio-Rad 1450001
VistaVision inverted microscope VWR
Reverse-Transcriptase Quantification Assay Reagents
dTTP, [α-33P]- 3000 Ci/mmol, 10 mCi/ml, 1 mCi Perkin-Elmer NEG605H001MC
1 M Tris-Cl, pH 8.0 Life Technologies/Invitrogen 15568025 Must be adjusted to pH 7.8 with KOH
2 M Potassium chloride (KCl) Life Technologies/Invitrogen AM9640G Adjust to 1 M solution
0.5 M EDTA Life Technologies/Invitrogen 15575-020
Nonidet P40 Roche 11333941103
Polyadenylic acid (Poly rA) potassium salt  Midland Reagent Co. P-3001
Oligo d(T) primer Life Technologies/Invitrogen 18418-012
Dithiothreitol (DTT) Sigma-Aldrich 43815-1G
SR, Super Resolution Phosphor Screen, Small Perkin-Elmer 7001485
Corning Costar Thermowell 96-well plate model (M) Polycarbonate Fisher 07-200-245 Manufactured by Corning Life
Corning 96-well Microplate Aluminum Sealing Tape, Nonsterile Fisher 07-200-684 Manufactured by Corning Life
DE-81 anion exchange paper Whatman 3658-915
Trisodium citrate dihydrate Sigma-Aldrich S1804-1KG
Sodium Chloride Fisher S671-3
Autoradiography cassette Fisher FB-CA-810
Cyclone storage phoshpor screen Packard

DOWNLOAD MATERIALS LIST

References

  1. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., Oldstone, M. B. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. Journal of virology. 68, 6103-6110 (1994).
  2. Koup, R. A., et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. Journal of virology. 68, 4650-4655 (1994).
  3. Jin, X., et al. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. The Journal of experimental medicine. 189, 991-998 (1999).
  4. Schmitz, J. E., et al. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science. 283, 857-860 (1999).
  5. Brumme, Z. L., et al. Marked epitope- and allele-specific differences in rates of mutation in human immunodeficiency type 1 (HIV-1) Gag, Pol, and Nef cytotoxic T-lymphocyte epitopes in acute/early HIV-1 infection. Journal of virology. 82, 9216-9227 (2008).
  6. Leslie, A. J., et al. HIV evolution: CTL escape mutation and reversion after transmission. Nature medicine. 10, 282-289 (2004).
  7. Phillips, R. E., et al. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature. 354, 453-459 (1991).
  8. Price, D. A., et al. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proceedings of the National Academy of Sciences of the United States of America. 94, 1890-1895 (1997).
  9. Goulder, P. J., et al. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nature. 3, 212-217 (1997).
  10. Tang, J., et al. Favorable and unfavorable HLA class I alleles and haplotypes in Zambians predominantly infected with clade C human immunodeficiency virus type 1. Journal of virology. 76, 8276-8284 (2002).
  11. Prentice, H. A., et al. HLA-B*57 versus HLA-B*81 in HIV-1 infection: slow and steady wins the race. Journal of virology. 87, 4043-4051 (2013).
  12. Migueles, S. A., et al. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proceedings of the National Academy of Sciences of the United States of America. 97, 2709-2714 (2000).
  13. Leslie, A., et al. Additive contribution of HLA class I alleles in the immune control of HIV-1 infection. Journal of virology. 84, 9879-9888 (2010).
  14. Kaslow, R. A., et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nature medicine. 2, 405-411 (1996).
  15. Altfeld, M., et al. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS. 17, 2581-2591 (2003).
  16. Kiepiela, P., et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nature medicine. 13, 46-53 (2007).
  17. Mothe, B., et al. Definition of the viral targets of protective HIV-1-specific T cell responses. Journal of translational medicine. 9, 208 (2011).
  18. Peyerl, F. W., Barouch, D. H., Letvin, N. L. Structural constraints on viral escape from HIV- and SIV-specific cytotoxic T-lymphocytes. Viral immunology. 17, 144-151 (2004).
  19. Rolland, M., et al. Broad and Gag-biased HIV-1 epitope repertoires are associated with lower viral loads. PloS one. 3, e1424 (2008).
  20. Wagner, R., et al. Molecular and functional analysis of a conserved CTL epitope in HIV-1 p24 recognized from a long-term nonprogressor: constraints on immune escape associated with targeting a sequence essential for viral replication. J Immunol. 162, 3727-3734 (1999).
  21. Wang, Y. E., et al. Protective HLA class I alleles that restrict acute-phase CD8+ T-cell responses are associated with viral escape mutations located in highly conserved regions of human immunodeficiency virus type 1. Journal of virology. 83, 1845-1855 (2009).
  22. Chopera, D. R., et al. Transmission of HIV-1 CTL escape variants provides HLA-mismatched recipients with a survival advantage. PLoS pathogens. 4, e1000033 (2008).
  23. Crawford, H., et al. Evolution of HLA-B*5703 HIV-1 escape mutations in HLA-B*5703-positive individuals and their transmission recipients. The Journal of experimental medicine. 206, 909-921 (2009).
  24. Boutwell, C. L., et al. Frequent and variable cytotoxic-T-lymphocyte escape-associated fitness costs in the human immunodeficiency virus type 1 subtype B Gag proteins. Journal of virology. 87, 3952-3965 (2013).
  25. Brockman, M. A., et al. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. Journal of virology. 81, 12608-12618 (2007).
  26. Crawford, H., et al. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. Journal of virology. 81, 8346-8351 (2007).
  27. Martinez-Picado, J., et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. Journal of virology. 80, 3617-3623 (2006).
  28. Schneidewind, A., et al. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. Journal of virology. 81, 12382-12393 (2007).
  29. Wright, J. K., et al. Impact of HLA-B*81-associated mutations in HIV-1 Gag on viral replication capacity. Journal of virology. 86, 3193-3199 (2012).
  30. Kawashima, Y., et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature. 458, 641-645 (2009).
  31. Goepfert, P. A., et al. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. The Journal of experimental medicine. 205, 1009-1017 (2008).
  32. Brockman, M. A., et al. Early selection in Gag by protective HLA alleles contributes to reduced HIV-1 replication capacity that may be largely compensated for in chronic infection. Journal of virology. 84, 11937-11949 (2010).
  33. Huang, K. H., et al. Progression to AIDS in South Africa is associated with both reverting and compensatory viral mutations. PloS one. 6, e19018 (2011).
  34. Wright, J. K., et al. Gag-protease-mediated replication capacity in HIV-1 subtype C chronic infection: associations with HLA type and clinical parameters. Journal of virology. 84, 10820-10831 (2010).
  35. Wright, J. K., et al. Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype. C. Journal of virology. 85, 3996-4006 (2011).
  36. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of virology. 59, 284-291 (1986).
  37. Brockman, M. A., Tanzi, G. O., Walker, B. D., Allen, T. M. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. Journal of virology. 131, 134-142 (2006).
  38. Ndung'u, T., Renjifo, B., Essex, M. Construction and analysis of an infectious human Immunodeficiency virus type 1 subtype C molecular clone. Journal of virology. 75, 4964-4972 (2001).
  39. Prince, J. L., et al. Role of transmitted Gag CTL polymorphisms in defining replicative capacity and early HIV-1 pathogenesis. PLoS pathogens. 8, e1003041 (2012).
  40. Ostrowski, M. A., Chun, T. W., Cheseboro, B., Stanley, S. K., Tremblay, M., et al. Detection assays for HIV proteins. Current protocols in immunology / edited by John E. Coligan ... [et al.]. 12, (Unit 12 15), Forthcoming.
  41. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, 61-68 (1989).
  42. Inoue, H., Nojima, H., Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene. 96, 23-28 (1990).
  43. Bichara, M., Pinet, I., Schumacher, S., Fuchs, R. P. Mechanisms of dinucleotide repeat instability in Escherichia coli. Genetics. 154, 533-542 (2000).
  44. Ackerson, B., Rey, O., Canon, J., Krogstad, P. Cells with high cyclophilin A content support replication of human immunodeficiency virus type 1 Gag mutants with decreased ability to incorporate cyclophilin A. Journal of virology. 72, 303-308 (1998).
  45. Dudley, D. M., et al. A novel yeast-based recombination method to clone and propagate diverse HIV-1 isolates. BioTechniques. 46, 458-467 (2009).
  46. Ganser-Pornillos, B. K., von Schwedler, U. K., Stray, K. M., Aiken, C., Sundquist, W. I. Assembly properties of the human immunodeficiency virus type 1 CA protein. Journal of virology. 78, 2545-2552 (2004).
  47. Forshey, B. M., von Schwedler, U., Sundquist, W. I., Aiken, C. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. Journal of virology. 76, 5667-5677 (2002).
  48. Gottlinger, H. G., Dorfman, T., Sodroski, J. G., Haseltine, W. A. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proceedings of the National Academy of Sciences of the United States of America. 88, 3195-3199 (1991).
Et restriktionsenzym Baseret Kloning metode til at vurdere den<em&gt; In vitro</em&gt; Replikationskapacitet af HIV-1 subtype C Gag-MJ4 Kimære Vira
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).More

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter