Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Une enzyme de restriction basée sur le clonage méthode pour évaluer la doi: 10.3791/51506 Published: August 31, 2014
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Déterminer à la fois l'hôte et des caractéristiques virales qui influent sur le VIH-1 pathogenèse et la progression de la maladie est primordiale pour la conception rationnelle de vaccins. La réponse immunitaire cellulaire est un élément clé de la réponse immunitaire humaine au VIH-1 infection. Les lymphocytes T cytotoxiques (CTL) sont nécessaires pour le contrôle initial de la virémie aiguë, et permettent à l'hôte d'établir un état ​​stable (point de consigne) de la charge virale de 1,2. Épuisement expérimentale de ces cellules effectrices en résulte une perte de contrôle viral 3,4. Malgré cela, les mutations se produisent à l'intérieur de s'échapper du génome viral qui renverser CTL reconnaissance des cellules infectées par des virus 9.5.

Certains allèles HLA ont été associés à une charge virale plus faibles et plus lente progression de la maladie, y compris 57 * B, B * et B * 27 81 10 à 15. Une partie de l'effet protecteur des allèles HLA de classe I peut être attribué au fait qu'ils ciblent les régions fonctionnellement limitées du génome tels que Gaget pour sélectionner des mutations d'échappement qui diminuent la capacité du virus à se répliquer in vitro de 16 à 21. Bien évasion du système immunitaire cellulaire est bénéfique pour le virus dans le contexte de la classe de sélection de l'allèle HLA I, l'effet de ces mutations peut avoir des conséquences différentielles de l'hôte lors de la transmission d'un individu HLA-incompatibles 22,23. Par conséquent, la compréhension des effets des mutations transmises évacuation de HLA-associé sur la capacité de réplication virale sera important d'approfondir notre compréhension de début de la pathogenèse du VIH-1.

Bien que beaucoup de progrès ont été faits pour identifier et caractériser les défauts de remise en forme de mutations d'échappement individuelles associées à HLA de classe spécifique je allèles 24-29, naturellement isolats VIH-1 ont des empreintes uniques et complexes de polymorphismes HLA-associé, probable découlant de l'HLA pression immunitaire médiée par des milieux différents immunogénétiques 30. En apanalyse revious, Goepfert et al. a montré que l'accumulation de mutations HLA-associés dans les séquences Gag transmissibles provenant de 88 Zambiens infection aiguë a été associée à une réduction de la valeur de consigne de la charge virale 31. Ceci suggère que la transmission de mutations délétères d'échappement, en particulier dans Gag, à des destinataires HLA-incompatibles fournit un bénéfice clinique, et peut être dû à la réplication virale atténuée. Aller de l'avant, il est impératif d'étudier la complexité des combinaisons de polymorphismes Gag dans les isolats naturels travaillent de concert pour définir les caractéristiques du virus transmissibles telles que la capacité de réplication et de la réplication précoce pourrait à son tour affecter le VIH-1 paramètres cliniques et à un stade avancé pathogenèse.

Brockman et al. D'abord démontré un lien entre la capacité de réplication des séquences gag-pro isolé lors de l'infection de stade chronique et la charge virale dans les deux sous-type C et les infections B32-35. L'approche expérimentale présentée dans ces études, bien approprié pour l'examen de la capacité de réplication in vitro de séquences provenant d'individus infectés de manière chronique, présente plusieurs réserves techniques et des limitations qui rendent l'étude du VIH-1 sous-type à capacité réplicative C individus infectés aiguë difficile. Cette méthode repose sur la recombinaison de séquences amplifiées par PCR basée sur la population dans le sous-type B NL4-3 provirus, qui a été dérivé en partie de VBL, un laboratoire adapté stock de virus 36. génération du virus a été réalisée par co-transfection d'une lignée de cellules T CEM à base 37 avec des amplicons PCR et digéré delta NL4-3 ADN de gag-pro. Cette méthode nécessite l'excroissance du virus au cours d'une période de plusieurs semaines à plusieurs mois, ce qui pourrait fausser la nature du stock de virus récupérée par rapport à la quasi-espèce virale in vivo, et en modifiant par conséquent la mesure de la capacité de réplication in vitro. Cette méthode is plus approprié pour étudier les individus infectés de manière chronique, où il sélectionne de manière efficace contre le virus de la capacité réplicative plus élevé, et où le clonage de nombreux différents variants viraux à partir d'un grand nombre d'individus infectés de manière chronique est très laborieuse et donc non réalisable. Cependant, au sein d'une personne gravement infectée, il ya généralement de un à deux variantes présent, et éliminant ainsi le risque de biaiser la nature du stock de virus récupéré, grâce à des pressions de sélection in vitro, permet une évaluation plus précise de vitro la capacité à la réplication. Deuxièmement, cette méthode nécessite recombiner sous-type C séquences gag-pro dans un squelette dérivé sous-type B, et pourrait introduire squelette biais d'incompatibilité dans l'analyse. En raison de ces limitations, un grand nombre de séquences doivent être analysés afin de surmonter les biais potentiels introduits.

Nous décrivons ici une appro expérimental alternatifhaque approprié pour étudier des séquences dérivées de sous-type C personnes infectées de façon aiguë. Nous utilisons une stratégie de clonage basé sur des enzymes de restriction pour introduire le gène gag provenant de points de VIH-1 sous-type C individus infectés temps de l'infection aiguë dans le proviral épine dorsale sous-type C, MJ4. L'utilisation de MJ4 comme une épine dorsale qui en commun pour cloner les gènes gag est crucial pour l'analyse de sous-type C de séquences dérivées. MJ4 est issu d'un isolat primaire 38, et seraient donc moins susceptibles d'introduire un biais en raison de sous-type incompatibilité entre la colonne vertébrale et le gène gag. De plus, l'approche de clonage en utilisant l'enzyme de restriction sur la base permet la proviral construit pour être directement transfectées dans des cellules 293T, et pour la récupération d'un stock de virus clonal identique à la séquence gag clone.

Le procédé présenté ci-dessous est un procédé à haut débit pour évaluer la capacité de réplication de sous-type C provenant Gag-MJ4les virus chimériques. La transfection dans des cellules 293T est simple et la récupération de virus ne prend que trois jours. In vitro la capacité de réplication est analysée sur la même lignée de cellules T à base de CEM-CCR5 créé par Brockman et al. 37, mais en utilisant des modifications du protocole importants nécessaires à la replication réussie des sous-types des virus chimériques C MJ4. L'utilisation d'une lignée de cellules T approprié plutôt que de PBMC permet à un grand nombre de virus de sous-type chimérique MJ4-C à tester avec une grande reproductibilité test. Enfin, en utilisant un dosage radio-marqué de la transcriptase inverse pour la quantification du virus dans le surnageant est plus économique que l'utilisation des kits ELISA disponibles dans le commerce p24. Il donne également une gamme dynamique plus élevée, ce qui était important pour détecter les virus faiblement et hautement répliquant dans le même dosage et pour détecter des différences subtiles dans la réplication entre les isolats.

En conclusion, la méthode présentée ici a permis del'étude approfondie de la capacité de réplication des séquences gag dérivés du VIH-1 sous-type C infection aiguë individus de la Zambie, et comme il est écrit, pourrait aussi être élargie pour étudier d'autres sous-type C infecté populations. Un haut degré de variation dans les capacités de réplication entre les différents isolats Gag a été observée. En outre, nous avons pu montrer une association statistique entre la capacité de réplication du Gag transmis et la consigne de la charge virale ainsi que des CD4 + baisse sur une période de trois ans 39. Ces résultats soulignent l'importance d'étudier les caractéristiques virales faire transmis, tels que la capacité de réplication, interagissent avec le système immunitaire de l'hôte d'influencer la pathogenèse lors de l'infection précoce et feront partie intégrante de l'élaboration d'interventions efficaces de vaccination ainsi que le traitement.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1 Amplification du VIH-1 gag Gene de Infected, le plasma congelé

  1. Extraire un ARN viral à partir de 140 ul décongelés VIH-1 plasmatique infecté en utilisant un kit d'extraction.
    1. Lorsque cela est possible, de procéder immédiatement à la synthèse d'ADNc, après extraction de l'ARN viral comme l'ARN non congelé, on obtient les meilleurs résultats d'amplification. Si possible, mettre en place PCR master mix pour la première ronde amplification de l'ADN et conserver à 4 ° C avant l'extraction de l'ARN viral.
  2. L'inversion de transcrire l'ADNc à partir d'ARN et d'ADN amplifier des produits du premier tour à l'aide de la transcriptase inverse et une ADN-polymérase thermostable en une seule étape de RT-PCR.
    1. Prenez ARN de -80 ° C congélateur (si le gel était nécessaire) et dégel brièvement à la température ambiante, puis placer dans le bloc froid. Transférer 5 pl d'ARN de chaque tube PCR contenant 45 ul de mélange maître pour obtenir un volume final de 50 ul. Placer immédiatement restant échantillons d'ARN en -80 ° C congélateur.
    2. Après enzyme est unedded au premier tour de PCR Master Mix (Tableau 1A), aliquot de 45 ul dans chaque tube d'amplification par PCR à paroi mince pour le nombre de réactions désirées. Assurez-vous d'utiliser des tubes PCR avec bouchons individuels et pas dépouiller bouchons pour assurer la contamination croisée minimale entre les échantillons. Placez les tubes PCR dans un bloc froid pour protéger le sensible et l'enzyme ARN modèle RT de température. Note: Les échantillons doivent être en triple afin d'échantillonner convenablement les quasi-espèces virales. Il est également important d'utiliser un produit avec une haute fidélité de l'ADN polymerase de l'enzyme de façon à minimiser une mauvaise incorporation par PCR introduit. S'il vous plaît se référer à la liste des réactifs pour le produit recommandé.
    3. Après matrice d'ARN a été ajouté à tous les tubes de réaction, à transférer des tubes de PCR pour l'amplification d'un thermocycleur en utilisant le programme de thermocycleur décrit dans le tableau 1B. Remarque: Le produit de cette amplification sera utilisé dans un second tour de PCR nichée.
  3. Effectuez une soi nichécond-tour d'amplification par PCR, en utilisant 1 pi de la première amplification par PCR circulaire (1.2) en tant que matrice d'ADN.
    1. Aliquote de 49 pi de deuxième ronde PCR Master Mix (tableau 2A) à chaque tube à paroi mince PCR pour le nombre de réactions souhaitées. Transfer 1 ul de l'amplification par PCR du premier tour de chaque tube de réaction pour donner un volume final de 50 ul. Remarque: Cela servira ADN comme matrice pour l'amplification du second tour. Il est également important d'utiliser une ADN polymérase avec des capacités très haute fidélité et de relecture afin de minimiser misincorporation PCR introduit. S'il vous plaît se référer à la liste des réactifs pour le produit recommandé.
    2. Transfert de deuxième ronde mélange réactionnel de PCR pour thermocycleur et démarrer le programme décrit dans le tableau 2B. Note: Après la fin du programme, les produits de cette réaction sont exécutés sur un gel d'agarose pour confirmer la production de ce produit.
  4. Ajouter 3 pi de 5x colorant de charge à 5 & #181; l de 50 pi volume de réaction de deuxième ronde et de fonctionner à 120 V sur un gel d'agarose-TAE 1% contenant un colorant ADN fluorescente sous rayonnement UV jusqu'à ce que les bandes sont résolus. Visualisez 1,6 kb bandes sur un illuminateur bleu (voir figure 1A).
  5. Exécutez le volume de réaction de 45 ul restant sur un gel d'agarose-TAE 1% contenant une tache d'ADN, et exciser les bandes appropriées avec une lame de rasoir propre.
    1. Extraire l'ADN de la tranche de gel en utilisant un kit de purification de gel, élution dans l'eau sans nucléase, combiner trois réactions positives par individu, et de geler produit à -20 ° C pour une utilisation ultérieure.

2. Préparation amplicons de bâillon pour le clonage par l'introduction des sites de restriction nécessaires

  1. Amplifier le Long Terminal Repeat (LTR) / 5 de partie 'UTR du plasmide MJ4 (voir le tableau 3).
  2. Visualisez les produits 1.3 ko PCR sur illuminateur, accises amplicons positifs, gel purifier et geler comme précédemmentdécrit (1.4,1.5; voir la figure 1B).
  3. Créer fusionné MJ4 LTR- amplicons gag par "épissure chevauchement-extension" PCR (voir tableau 4).
  4. Visualiser, d'accise, de purifier et de geler les amplicons 3.2 ko comme dans 1.4,1.5 (voir figure 1C).

3. Clonage amplifiés gag gènes dans le MJ4, sous-type C, clone moléculaire infectieux

  1. Digérer 1,5 pg de plasmide MJ4 et 1,5 pg de produit PCR purifié LTR- gag avec le Bell (sensible à la méthylation) endonucléase de restriction pendant 1,5 heure à 50 ° C (voir tableau 5A).
  2. Ajouter 1 pi de NgoMIV de la réaction de digestion et incuber à 37 ° C pendant 1 heure.
  3. Ajouter 5x colorant de charge de digestion de restriction des réactions et l'électrophorèse lentement le volume total sur un gel d'agarose-TAE 1% contenant une tache d'ADN sur gel pendant 1-2 heures à 100 V. Visualiser, d'accise, et purifier bandes indiquées pour le clonage comme précédemment described (voir Figure 2).
  4. Préparer les réactions de ligature en utilisant LTR- gag insert purifié et ADN vecteur MJ4 à 3: 1 insert rapport de vecteur. Incuber les réactions de ligature durant la nuit à 4 ° C (voir Tableau 5B).
  5. Transformer les bactéries JM109 compétentes chimiquement avec les produits de ligation et étalées sur des plaques de gélose LB avec 100 ug / ml d'ampicilline et de croître à 30 ° C pendant 22 + heures.
    1. Décongeler JM109 cellules compétentes sur la glace pendant 15 min. Étiqueter 1,5 ml microtubes et froid sur la glace.
    2. Aliquote 50-100 ul de cellules JM109 de pré-réfrigéré 1,5 ml microtubes. Ajouter 2,5-5 ul de la réaction de ligature à JM109 cellules, effleurant légèrement le tube pour mélanger et retourner immédiatement à la glace. Incuber les cellules compétentes avec le produit de ligature sur de la glace pendant 30 min.
    3. Le choc thermique 1,5 ml microtubes contenant des cellules compétentes JM109 et réaction de ligature dans un bloc chauffant à 42 ° pendant 45 secondes et revenir à la glace pendant au moins 3 min.
    4. Ajouter 50 ul de milieu SOC à chaque microtube et plaquer la réaction de transformation sur l'ensemble de la température ambiante des plaques d'agar-LB complété avec 100 pg / ml d'ampicilline.
    5. plaques de transfert à un incubateur à 30 ° et laisser pendant 20 heures, ou jusqu'à ce que les colonies sont bien formés.
  6. Prélever des colonies isolées et de grandir dans 4 ml de LB avec 100 pg / ml d'ampicilline à 30 ° C pendant 22 + heures.
  7. Isoler cultures à 3200 g pendant 15 min, verser le bouillon, et extraire l'ADN plasmidique.
  8. Pour confirmer le clonage fidélité, couper l'ADN miniprep avec NgoMIV et Hpal enzymes de restriction dans une double digestion à 37 ° C pendant 2 heures. Analyser le gel à 1% d'agarose-TAE (voir le tableau 5C).
  9. Séquence de la région d'insertion LTR-gag de chaque plasmide en utilisant les amorces suivantes: GagInnerF1, GagF2, Rév1, Rev3, et GagR6 (tableau 6) pour confirmer l'identité de séquence.
  10. Comparer les séquences clonées obtenues avec les séquences de la population derIved de l'amplicon purifié initial de 1.5.1. Remarque: il est important de déterminer en fin de compte la capacité de réplication de deux clones indépendants afin de s'assurer que tous les phénotypes in vitro de la réplication ne sont pas dues à des erreurs de squelette introduites au cours du processus de clonage.

4. génération et de titrage de réplication compétentes Gag-MJ4 chimériques virus

  1. Générer la réplication du virus compétent par transfection de 1,5 pg de l'ADN miniprep MJ4 plasmide chimère dans des cellules 293T en utilisant un ratio de 4: 1 de Fugene HD tel que décrit par le Prince et al 39.
  2. Titre récolté stocks de virus sur les cellules TZM-bl comme décrit ci-dessous et à Prince et al 39.
    1. Plate cellules TZM-bl 24 h avant l'infection par le virus afin d'avoir une monocouche de cellules confluentes de 30-40% le jour suivant. Ceci peut être réalisé en ajoutant 5 x 10 4 cellules dans un volume total de 800 ul par puits dans une plaque à 24 puits.
    2. Après l'ajout de cellules pour le bien, déplacez doucement la plaque de 24 puits en avant et en arrière, puis côté à l'autre afin de répartir efficacement les cellules. Ne pas agiter - cela se traduira par des cellules qui s'accumulent dans le milieu de la plaque.
    3. Le lendemain, préparer 1% de FBS dans DMEM; il sera utilisé pour diluer le DEAE-Dextran et dilué à des stocks de virus. DEAE-Dextran Image est de 10 mg / ml ou 125x, et une concentration finale de 80 pg / ml ou 1 x est souhaité.
    4. Sortez stock de virus à tester de -80 ° C congélateur et le lieu sur un agitateur à décongeler à température ambiante.
    5. En utilisant une pipette multicanaux, diluer en série stocks de virus dans une culture de tissu à fond rond à traiter plaque à 96 puits avec couvercle. Il s'agit d'un protocole de dilution de 3 fois. Voir le tableau 7 pour le schéma de dilution.
    6. Retirez le support de plaques à 24 puits TZM-bl ensemencées en utilisant un aspirateur à vide veillant à ne pas perturber la monocouche cellulaire. Ne retirez le support d'une plaque de 24 puits à la fois pour que les cellules fontne se dessèche pas.
    7. Ajouter 150 ul de la DEAE-Dextran 1x + 1% de FBS dans du DMEM mélange à chaque puits en utilisant une pipette de 1000 ul. Ne pas utiliser la répétition pipette car cela perturbe la monocouche.
    8. Ajouter 150 ul de chaque dilution du virus au puits approprié. Ajouter virus au centre du puits et agiter doucement afin de répartir virus à travers la monocouche cellulaire. Incuber les cellules infectées pendant 2 heures dans un incubateur de culture de tissu à 37 ° C et 5% de CO 2.
    9. Après l'incubation de 2 heures, ajouter 0,5 ml de 10% de FBS dans du DMEM à chaque puits et les plaques revenir à un incubateur à 48 h supplémentaires.
    10. Après 48 h, les cellules doivent être à 100% de confluence. Parce MJ4 est un virus compétent pour la replication, il y aura une certaine mort cellulaire, mais ce doit être prévu.
    11. Retirez le support de chaque puits et ajouter 400 pl / puits de solution (voir le tableau 8A pour la recette) de fixation. Fixer une seule plaque à la fois. Ajouter la solution de fixation à l'aide d'une pipette de 1000 pi, et laisser reposer pendant 5 minutes àla température ambiante.
    12. Enlever la solution de fixation et laver 3 fois avec du PBS avec Ca2 + / Mg 2 +. Utilisez un vaporisateur d'ajouter doucement PBS sur le côté du puits pour éviter de perturber la monocouche. Après le troisième lavage, effacer plaque sèche sur du papier absorbant.
    13. Ajouter 400 pl / puits de solution de coloration (voir le tableau 8B pour la recette) à chaque puits de la plaque de 24 puits et incuber à 37 ° C pendant au moins 2 h. De plus longues durées d'incubation sont acceptables, mais les temps d'incubation doivent être conservés cohérente entre les expériences de titrage.
    14. Laver 2 fois avec du PBS avec Ca2 + / Mg 2 + et le score de l'infection, ou ajouter du PBS et conserver à 4 ° C pour marquer plus tard. Les plaques peuvent être conservées à 4 ° C pendant jusqu'à quatre jours, à condition que la monocouche est maintenu hydraté.
    15. Pour marquer l'infection, utiliser un marqueur permanent pour diviser les puits de la plaque de 24 puits en quadrants. Compter toutes les cellules bleues dans un champ de vue, en utilisant un grossissement total de 200X, une fois danschacun des quatre quadrants d'un puits.
    16. Calculer unités infectieuses par ml comme suit: [(# cellules bleues / 4) x 67] / (pi virus ajouté) = UI / ul. Reportez-vous au tableau 8C pour volume ul de virus ajoutée à chaque puits. Moyenne plusieurs puits ensemble; les chiffres devraient être relativement similaire pour un titrage précis.

5 Préparation de milieux de culture et la propagation des cellules GXR25 pour test in vitro de la réplication dans

  1. Préparer RPMI complet (cRPMI) pour la propagation des cellules GXR25. NOTE: Il est extrêmement important pour la culture de cellules GXR25 au moins 4 mois avant les expériences de réplication prévues (voir le tableau 9).
  2. Fractionnement de cellules 01h10 deux fois par semaine et de maintenir la densité des cellules entre 1 x 10 5 à 2 x 10 6 cellules / ml.

6. Dans réplication in vitro de Gag-MJ4 chimères dans GXR25 (CEM-CCR5-GFP) Cellules

  1. La veille de l'infection, fractionner les cellules à une concentration comprise entre 3.2 x 10 5 cellules / ml, de sorte qu'ils sont en croissance logarithmique, le jour de l'infection.
  2. Le jour de l'infection, enlever des stocks de virus à partir de -80 ° C et décongélation congélateur. Calculer le volume nécessaire de virus à partir de chaque valeur sur la base de la UI / ul titre de test sur ​​des cellules TZM-bl pour infecter 5 x 10 5 cellules GXR25 à une multiplicité d'infection de 0,05, en utilisant la formule:
    Volume du virus de l'infection (pi) = 1 pl / X UI x 0,05 x 500000
    NOTE: Nous avons choisi une MOI de 0,05 comme cela se traduit par une phase de croissance logarithmique pour tous les virus que nous avons testées. Il est important de procéder à des expériences initiales afin de déterminer la MOI optimale de croissance logarithmique pour capturer le virus à tester.
  3. Diluer virus dans cRPMI à un volume de 100 ul (pour parvenir à une MOI de 0,05) et ajouter dans un puits de culture de tissu à fond en V traités plaque à 96 puits. Note: Inclure la fois une positive contrôle (MJ4 WT infecté) et un négatif (cellules infectées simulées) dans chaque série d'expériences de réplication. Mettre en place la plaque de telle sorte que chaque autre colonne est vide afin de limiter la contamination croisée entre les puits. Le contrôle positif est impératif, car il sera utilisé plus tard comme un standard pour normaliser les réplication de ski, qui sont une mesure du taux de répétitions expérimentales de réplication.
  4. Compter les cellules GXR25 l'aide d'un compteur de cellules automatisé. Calculer le nombre de cellules nécessaires au total pour toutes les infections (5 x 10 x 5 # infections). Aliquoter le volume requis dans un 50 ml de tubes et centrifuger pour sédimenter les cellules coniques. Toujours calculer pour 25% des infections plus que nécessaire.
  5. Aspirer le milieu soigneusement et remettre en suspension dans cRPMI à une concentration de 5 x 10 5 cellules / 100 pi.
  6. cellules de pipette dans un bac stérile et bien mélanger. En utilisant une pipette multicanaux, ajouter 100 pi de cellules dans chaque puits de la plaque à 96 puits contenant le virus dilué. Mix soigneusement.
  7. Ajouter 2 pl de 5 mg / ml (100 x) de solution de polybrène à chaque puits et les cellules bien mélanger.
  8. Incuber à 37 ° C dans un incubateur de culture tissulaire avec 5% de CO2 pendant 3 heures.
  9. Afin de laver les cellules infectées, centrifugeuse plaque de 96 puits fond en V à culot cellules. Puis retirez délicatement 150 pi du milieu et les remplacer par de nouvelles 150 pi de cRPMI sans perturber le culot cellulaire. Répétez 2 fois (y compris centrifugation) pour laver suffisamment cellules.
  10. Après la dernière centrifugation et l'addition de 150 ul cRPMI, remettre en suspension le culot de cellules avec une pipette à canaux multiples et ajouter le mélange de cellules / virus entier (environ 200 ul) de chaque puits de manière indépendante à 800 ul de cRPMI dans un puits d'un tissu à 24 puits plaque de culture.
  11. Placer la plaque dans 5% de CO 2 de culture de tissus incubateur à 37 ° C.
  12. Tous les deux jours, supprimer 100 pi de surnageant de la surface de culture bien et transférer dans un puits 96 Uplaque -Fond et magasin congelées à -80 ° C jusqu'à ce que l'exécution de sensibilité du dosage du virus. REMARQUE: agencement attentive des surnageants dans des plaques à 96 puits va permettre le transfert de la pipette à canaux multiples de surnageants de culture au cours de virion quantification par un dosage radio-marqué de la transcriptase inverse (RT). Chaque plaque doit contenir des échantillons à partir d'une norme de l'infection afin de normaliser la variation inter-plaque dans le test de lecture RT.
  13. Après avoir retiré l'échantillon de 100 pi de cellules, par division de 1: 2 par les cellules à fond remet en suspension et l'élimination de la moitié du volume restant (450 pi). Restaurer le volume original (1 ml) en ajoutant 550 pi de frais cRPMI à chaque puits.

7 Analyse de la transcriptase inverse (RT) en culture cellulaire surnageants

Protocole adapté d'Ostrowski et al 40.

  1. Mettre en place le capot de sécurité biologique dans une installation BSL-3 pour une utilisation avec des matières radioactives.
    1. Placez du papier absorbant dans hood et remplacer aspirateur pour aspirateur destiné à être utilisé désigné radioactif. Remarque: Tous les déchets radioactifs doit être correctement mis au rebut avec conformément à la réglementation en matière de sécurité.
  2. Ajouter 1-2 ul de 10 mCi / ml de [α- 33 P] dTTP et 4 pi de 1 M dithiothréitol (DTT) à chaque aliquote de 1 ml RT master mix (voir le tableau 10 et Ostrowski et al. 40).
  3. Mélanger soigneusement chaque tube de 1,5 ml de RT mélange maître, TNT, et [α- 33 P] dTTP avec une pipette de 1000 pi et le transfert à un creux stérile.
  4. Distribuer 25 l de marqué RT mélangent dans chaque puits de la plaque PCR à paroi mince 96 puits. Note: Inclure un espace pour un contrôle positif (MJ4 d'infection WT) et du contrôle négatif (infection Mock).
  5. Ajouter 5 pi de chaque surnageant à la plaque PCR contenant le mélange maître RT.
  6. Sceller plaque PCR avec la couverture de feuille adhésive et incuber pendant 2 heures à 37 ° C dans un thermocycleur. Pour des raisons de sécurité, rinsoi embouts de pipette avec Amphyl et disposer de conseils en petit récipient contenant des déchets Amphyl, qui sera plus tard être éliminés avec les déchets radioactifs.
  7. Après incubation, faire des petits trous dans le couvercle de la feuille à l'aide d'une pipette multi-canaux de 200 pi. Remarque: Si des embouts de pipette toucher le liquide dans le puits, remplacer des conseils avant de passer à la colonne ou la ligne suivante.
  8. Mix échantillons 5x et transfert 5 pl de chaque échantillon sur le papier DE-81. Air sécher 10 min.
  9. Laver les blots avec 5x SSC 1x (chlorure de sodium, le citrate de sodium), puis 2 fois avec 90% d'éthanol à 5 ​​min par lavage. Laisser sécher à l'air.
    1. Placez chaque tache dans un récipient de lavage séparée, comme une boîte de rangement en sandwich, ajouter suffisamment de tampon de lavage (1x SSC ou 90% EtOH) pour couvrir blot, et agiter pendant 5 min.
    2. Verser le tampon de lavage dans le récipient et répétez séparé. Remarque: Les 3 premiers lavages sont considérés comme radioactifs et doivent être éliminés de façon appropriée. Les deux derniers lavages peuvent être éliminés régulièrement.
  10. Une fois sec, voitureefully envelopper blot à Saran wrap et exposer à un phosphoscreen dans une cassette étanche nuit à température ambiante.
  11. Analyser phosphoscreens avec un phosphorimager et quantifier les transcriptions radioactives.
  12. Tracez un cercle autour de chaque signal radioactif en utilisant un logiciel OptiQuant. Représenter les valeurs Unité numérique de la lumière (DLU) pour générer des courbes de réplication.
  13. Afin de générer réplication scores de capacité, les valeurs DLU étaient journal 10 -transformed et les pentes ont été calculées en utilisant le jour 2, 4, et 6 points dans le temps. pentes de réplication sont ensuite divisés par la pente de WT MJ4 en ordre générer réplication scores de capacité. Il est important de normaliser sur la base des valeurs MJ4 WT obtenus à partir de la même plaque RT à réduire la variabilité intra-essai.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Pour exécuter correctement ce protocole, ce qui crée un plasmide proviral capable d'assembler entièrement fonctionnels, infectieuses chimères Gag-MJ4, un grand soin doit être pris pour générer des amplicons PCR appropriées. Déterminer si le PCR a généré l'amplicon gag de taille appropriée est cruciale. Les produits doivent être à moins de 100 paires de bases (pb) de l'amplicon d'environ 1700 pb représenté sur la figure 1A. La longueur exacte de ce fragment sera variable en fonction de gène gag à l'étude. Ensuite, la partie 5 répétition 'terminale longue (LTR) du clone moléculaire MJ4 doit être amplifié et épissé à l'amplicon de gag dans le but de le rendre approprié pour le clonage ultérieur. L'amplicon MJ4 LTR devrait être 1474 pb de longueur. Figure 1B montre une image de gel représentatif pour lequel la taille de la bande correctes sont indiquées. Après l'épissure chevauchement-extension PCR 41, les produits gag LTR- combinés devraient êtreenviron 3200 pb de longueur, tel que représenté sur la figure 1C.

Une fois que le gène gag a été adapté pour le clonage par fusion à la LTR 5 'de MJ4, qui contient le site nécessaire NgoMIV restriction, à la fois vecteur et de l'insert gag doit être digéré avec NgoMIV et Bell enzymes de restriction et excisé à partir d'un gel d'agarose après électrophorèse séparation. Il est impératif pour exciser les bandes de vecteur et insertion appropriées. Un gel représentatif est montré sur la figure 2. L'partie vecteur du plasmide MJ4 doit être d'environ 10 000 pb de longueur, tandis que le gag insert LTR- doit rester à environ 3000 pb de longueur, comme les sites de restriction sont situés aux extrémités de l'amplicon. Toute diminution significative de la taille indique une coupure place supplémentaire dans le gène gag à l'étude.

Après la ligature des deux fragments, la transformation bactérienne, unee isolement de l'ADN plasmidique, les chimères Gag-MJ4 doit être vérifiée pour la taille appropriée en effectuant une double digestion avec NgoMIV et Hpal enzymes de restriction. Sur toute la longueur des chimères Gag-MJ4 qui n'ont pas subies de suppression d'événements lors de la réplication bactérienne devrait avoir un profil de restriction similaire à celui représenté sur la figure 3, avec deux bandes d'environ 8700 et 4300 pb.

Une distinction importante de ce protocole par rapport aux méthodes antérieures, est l'utilisation du clone moléculaire de VIH-1 sous-type C infectieux, MJ4, plutôt que le virus plus courante en laboratoire adapté NL4-3. Cependant, les approches décrites dans la section précédente pourraient être modifiés pour le clonage de séquences sous-type B gag dans pNL4-3.

Une optimisation de la multiplicité d'infection (MOI) pour une utilisation dans les expériences suivantes a été réalisée dans le but de sélectionner la MOI idéal a montré que la croissance logarithmique de la majorité des virus testés.La figure 4 représente les courbes représentatives de réplication à partir de trois différents IAM (0,01, 0,05, et 0,25) pour MJ4 (figure 4A), ainsi que pour NL4.3 (figure 4B). MJ4 reproduit beaucoup moins efficacement dans les cellules GXR25 que NL4-3, ce qui est important à prendre en compte, comme approprié MOI pour la réplication NL4-3 serait probablement trop faible pour détecter la réplication de MJ4 efficace. Comme on le voit sur ​​la figure 4A, une MOI de 0,05 au lieu de 0,01 ou 0,25, a été le choix idéal, car la croissance logarithmique a été observée entre les jours 2-6 pour MJ4. Pour la MOI inférieur, 0,01, jour 6 valeurs DLU sont à peine détectables, et nous nous attendions à la génération de Gag-MJ4 virus chimériques qui reproduit inférieur MJ4. Par conséquent, ce ne serait pas MOI capter la croissance des plus atténués chimères Gag-MJ4, qui peuvent aussi être la plus biologiquement critique. En outre, une MOI de 0,25 n'était pas idéal, car la cinétique rapide de la réplication virale tué un amou importantent de cellules par jour même 4. Cela provoque la courbe de reproduction de plateau, et le calcul d'une pente sur la base d'une courbe telle que cela sous-estimer la capacité de réplication. Sur la base des courbes générées pour NL4-3, même à une MOI de 0,01, les cibles cellulaires disponibles ont été sensiblement épuisés par jour 6 après l'infection. En conclusion, une MOI de 0,05 a été trouvée comme étant optimale pour un grand groupe de Gag-MJ4 virus chimériques, qui tous avaient des séquences gag et divers degrés variables de réplication.

Un total de 149 Gag-MJ4 virus chimériques dérivés de sous-type C aiguë séquences Gag ont été testés pour la réplication in vitro en utilisant ce test. Les valeurs normalisées RC variaient de 0,01 à plus de 3,5 avec certains virus se répliquant plus de 100 fois plus efficace que le type sauvage MJ4. Figure 5 montre les courbes de réplication de neuf virus chimériques Gag-MJ4 représentatives, avec de type sauvage MJ4 représentés en rouge, et démontre la large gamme de réplication cCAPACITÉS observées. Ainsi, la diversité de séquence dans le gène gag seul peut considérablement affecter la capacité du virus à se répliquer in vitro. Bien que ce soit représentatif de Gag-MJ4 virus chimériques dérivés de Zambiens infection aiguë, d'autres séquences sous-type C n'ont pas été testées, et peuvent présenter des cinétiques de réplication. Par conséquent, un grand soin doit être apporté pour optimiser la MOI en fonction de la réplication des virus spécifique d'une étude particulière, car il peut y avoir un large éventail de niveaux de réplication entre différentes du VIH-1 dorsales et Gag isole.

L'un des avantages de l'utilisation d'une lignée de lymphocytes T telles que la lignée cellulaire GXR25, qui prend en charge la replication de MJ4, est le niveau de reproductibilité observés par rapport à des expériences à l'aide de réplication a stimulé des cellules mononucléaires du sang périphérique en tant que cibles. Dans les expériences d'optimisation initiales, MJ4 type sauvage a montré une variabilité intra-essai de 8,7%, et différent clones du même virus chimère Gag-MJ4 exposé variabilité dans la réplication de 8,5%. Parce que les différents mélanges maîtres et les expositions de phosphoscreen peuvent donner des valeurs DLU qui diffèrent légèrement en ampleur, intra-essai variabilité peut plus être contrôlée en exécutant la même norme de virus (dans notre type sauvage cas MJ4) dans chaque plaque d'essai RT. Figure 6 graphiques l' DLU valeurs dérivées de la même infection MJ4, quantifié en huit plaques RT différentes. La normalisation à un virus qui est commune à tous les dosages de transcriptase inverse peut aider à atténuer erreur potentielle induite par ces légères modifications de la grandeur de signal entre les dosages.

Inter-dosage variable a également été testé et réplique répétée sur plusieurs jours ont été fortement corrélés. Figure les valeurs de score de RC normalisées 7 parcelles de deux expériences indépendantes réalisées environ un an d'intervalle. Un haut degré de corrélation avec l'absence de grandes valeurs aberrantes (R 2 = 0,873) a été observée entreen les deux répétitions indépendantes.

Bien que hautement corrélées, il existe une variabilité dans l'amplitude globale de la cinétique de réplication entre les deux expériences indépendantes. Cela peut être attribué en partie à la différence du nombre de passage entre les cellules des stocks GXR25 utilisés dans chaque expérience. En général, les cellules GXR25 stocks qui ont été exposées pendant une période de temps supérieure à 6 mois ont tendance à soutenir la replication plus efficace de Gag-MJ4 chimères. Par conséquent, il est souhaitable d'évaluer la capacité de réplication dans des groupes de chimères dans un laps de temps d'un mois. Lorsque les étapes précédentes sont suivis de près, ce test est capable de produire des résultats très robustes et reproductibles, qui sont applicables à un large éventail d'études.

Figure 1
Figure 1 représentant gel images illustrant la séparation électrophorétique des produits de PCR. Pour tous les produits de la PCR, 5 pi de chaque réaction de 50 ul a été mélangé avec 3 pi de 5x colorant de charge, chargés dans un agarose-TAE gel à 1% complété avec 1X SYBR-safe tache d'ADN sur gel, et séparés par électrophorèse à 120 V pendant 45 min. Le Promega 1 kb échelle d'ADN (piste 1) a été utilisée pour estimer la taille des amplicons. A) Le gène gag a été amplifié à partir de l'ARN viral en utilisant une approche PCR nichée. Grâce à des insertions et des suppressions, l'amplicon gag peut varier de 1,600-1,700 pb de longueur et semble légèrement au-dessus du marqueur échelle d'ADN de 1500 pb. Voies 2-5 représentent succès amplification du gène gag. B) Le LTR 5 'de MJ4 a été amplifié à partir du type sauvage MJ4 plasmide et visualisé par séparation électrophorétique. Voies 2-5 représentent amplification réussie du produit LTR 1474 pb, qui semble légèrement en dessous de 1500 pb échelle d'ADN marqueur. C) Le 5R17; LTR dérivé du type sauvage MJ4 et du gène gag amplifié à partir du plasma du patient sont fusionnées ensemble par l'intermédiaire d'épissage-PCR de chevauchement-extension et visualisées par l'intermédiaire d'une séparation électrophorétique. Voies 2-5 illustrent fusionné avec succès amplicons qui sont d'environ 3200 pb, et qui semblent légèrement au-dessus du marqueur échelle d'ADN de 3000 pb.

Figure 2
Figure 2: image de gel représentatif montrant la séparation électrophorétique de restriction digère pour le clonage de gènes gag patient dans MJ4. Type sauvage MJ4 plasmide et LTR- gag produits de fusion ont été digérés par Bcl I de 1,5 h à 50 ° C et NgoMIV pendant 1 heure à 37 ° C. fragments de Vector et insertion ont été visualisées par séparation électrophorétique sur un gel d'agarose-TAE 1% complété avec de l'ADN 1X SYBR-safe gel tache à 100 V pendant 2 heures et en utilisant un éclairage à lumière bleue afin de réduire les dommages à l'ADN induits par les UV. Les fragments de vecteurs et inserts appropriés pour les étapes ultérieures de clonage apparaissent à environ 10 000 pb et 2900 pb respectivement.

Figure 3
Figure 3. image du gel Représentant représentant séparation électrophorétique des répertoires de l'ADN chimère plasmidique Gag-MJ4 purifiée restriction. Purifiée Gag-MJ4 chimère ADN plasmidique a été digéré avec double NgoMIV et restriction Hpal enzymes pendant 2 heures à 37 ° C. digestions de restriction ont été visualisées par séparation électrophorétique sur un gel d'agarose-TAE à 1% 1X supplémenté avec SYBR-safe gel colorant d'ADN à 120 V pendant 45 min. Les plasmides sans grandes suppressions permettront de résoudre à deux bandes distinctes à environ 8700 et 4300 pb.


La figure 4 et la réplication de MJ4 NL4-3 isolats de VIH-1 dans la lignée cellulaire GXR25 à différentes multiplicités d'infection (MOI). 5 x 10 5 cellules ont été infectées GXR25 comme décrit dans le protocole de la méthode avec l'augmentation de 5 fois de MOI chaque stock de virus. Les surnageants ont été prélevés aux jours 2, 4, 6, et de l'infection et la production virion 8 de poste a été quantifiée par un dosage de la transcriptase inverse radiomarqué. Les infections ont été réalisées en triple et les barres d'erreur représentent l'écart type pour les trois répétitions (A). MJ4 (B) NL4-3.

Figure 5
Figure 5 de gamme représentant de réplication pour différents chimères Gag-MJ4. 5 GXR25 cellules ont été infectées par le type sauvage MJ4 ou Gag-MJ4 chimères à une MOI de 0,05, les surnageants ont été recueillis à des intervalles de deux jours après l'infection, et la production de virions quantifiés par une radiomarqué essai de RT. Insertion de divers gènes gag dérivé sous-type C peut avoir un impact dramatique sur la capacité de réplication des MJ4. MJ4 réplication de type sauvage est indiquée en rouge.

Figure 6
Figure 6 Comparaison de la variation intra-essai à la transcriptase inverse radiomarqué (RT) d'analyse de quantification. Le graphique démontre intrinsèque intra-essai variabilité en reportant les valeurs DLU des mêmes surnageants à partir d'une seule infection de MJ4 de type sauvage dans huit dosage RT différent plaques. La variation dans les courbes reflète les légers changements dans l'amplitude du signal pariween plaques, qui peuvent être corrigées par l'exécution d'une série sur chaque plaque RT, qui peut ensuite être utilisée pour normaliser les pentes de chimères Gag-MJ4 testés sur la même plaque.

Figure 7
Figure 7 Reproductibilité du dosage de réplication au cours du temps dans la lignée cellulaire GXR25. Ces mêmes virus chimériques Gag-MJ4 ont été utilisés pour infecter des cellules GXR25 dans deux expériences indépendantes réalisées à environ un an d'intervalle. scores de réplication ont été générés par le calcul de la pente de valeurs DLU log-transformées et normaliser cette pente de type sauvage MJ4. Chimères gag-MJ4 qui reproduisent de manière plus efficace que le type sauvage MJ4 avoir réplication scores supérieurs à 1, et ceux qui reproduisent moins efficacement que le type sauvage MJ4 des scores de réplication inférieur à 1, les deux mesures indépendantes sont fortement corrélées (R 2 = 0,87, régression linéaire) et mettre en évidence la reproductibilité des essais effectués à des moments différents et avec des cellules à différents passages.

A)

Réactif Volume pour la réaction de 1x (pl)
2x réaction Mix (Invitrogen) 25
Sans nucléase H 2 O 17
L'amorce GOF (20 uM concentration) 1
Amorce inverse Vifor (20 concentration de M) 1
SuperScript III en une seule étape Enzyme Mix 1
matrice d'ARN 5
Le volume total 50

B)

Nombre de cycles Durée (h: min: sec) Température (° C)
1 01:00:00 50
1 02:00 94
10 00:15 94
00:30 56
05:00 68
40 00:15 94
00:30 56
05:00 + 5 sec / cycle de 68
1 12:00 68
1 4
Fin

Tableau 1 A) et B mélange maître) gag amplification. * Note: séquence GOF primaire: 5'-ATTTGACTAGCGGAGGCTAGAA-3 '. Vifor séquence de l'amorce 5'-TTCTACGGAGACTCCATGACCC-3 '.

A)

Réactif Volume pour la réaction de 1x (pl)
Sans nucléase H 2 O 35,5
5x Phusion HF tampon 10
dNTP (40 mM), des désoxynucléotides 1
Amorce avant GagInnerF1 (20 concentration de M) 1
Amorce antisens BclIDegRev2 (20 uM de concentration) 1
Phusion Hot Start II Polymerase 0,5
Premier tour PCR comme modèle 1
Le volume total 50

B)

Nombre de cycles Durée (h: min: sec) Température (° C)
1 00:30 98
29 00:10 98
00:30 53
01:00 72
1 10:00 72
1 4
Fin

Tableau 2 A) et B mélange maître) conditions du thermocycleur pour imbriquée second tour amplification de gag. * Note: GagInnerF1 séquence de l'amorce 5'-AGGCTAGAAGGAGAGAGATG-3 '. BclIDegRev2 séquence de l'amorce 5'-AGTATTTGATCATAYTGYYTYACTTTR-3 '.

A)

Réactif Volume pour la réaction de 1x (pl)
Sans nucléase H 2 O 35,5
5x Phusion HF tampon 10
dNTP (40 mM), des désoxynucléotides 1
Amorce avant MJ4For1b (20 concentration de M) 1
Amorce antisens MJ4Rev (20 uM de concentration) 1
Phusion Hot Start II Polymerase 0,5
MJ4 plasmide comme matrice (10 ng / ul) 1
Le volume total 50

B)

Nombre de cycles Durée (h: min: sec) Température (° C)
1 00:30 98
29 00:10 98
00:30 58
00:45 72
1 10:00 72
1 4
Fin

Tableau 3 A) et B mélange maître) conditions du thermocycleur pour 5 'LTR MJ4 amplification. * Note: séquence MJ4For1b primaire: 5'-CGAAATCGGCAAAATCCC-3 '. MJ4Rev séquence de l'amorce: 5 '-CCCATCTCTCTCCTTCTAGC-3 '.

A)

Réactif Volume pour la réaction de 1x (pl)
Sans nucléase H 2 O 34,5
5x Phusion HF tampon 10
dNTP (40 mM), des désoxynucléotides 1
Amorce avant MJ4For1b (20 concentration de M) 1
Amorce antisens BclIRev (20 uM de concentration) 1
MJ4 LTR 1,3 kb amplicon (Gel purifiée, ~ 50 ng) 1
Phusion Hot Start II Polymerase 0,5
Amplicon Gag (Gel purifié, ~ 100 ng) 1
Le volume total 50

B)

Nombre de cycles Durée (h: min: sec) Température (° C)
1 00:30 98
29 00:10 98
00:30 58
01:30 72
1 10:00 72
1 4
Fin

Tableau 4 A) et B mélange maître) conditions du thermocycleur pour épissure chevauchement-extension PCR pour générer des inserts gag LTR-. * Note: séquence BclIRev primaire: 5'-TCTATAAGTATTTGATCATACTGTCTT-3 '

A)

Réactif Volume pour la réaction de 1x (pl) Le temps d'incubation (hr) L'incubation Température (° C)
1,5 ug de 3 kb LTR- gag amplicon ou MJ4 plasmide x ul de 1,5 ug
CutSmart tampon ONE (anciennement tampon NEB n ° 4) 2
L'enzyme de restriction Bell 1
Sans nucléase H 2 O x
Le volume total 19 1.5 50
NgoMIV enzyme de restriction 1
Le volume total 20 1 37

B)

Réactif Volume pour la réaction de 1x (pl) Le temps d'incubation (hr) L'incubation Température (° C)
50 ng MJ4 vecteur plasmidique x ul de 50 ng
45 ng LTR- gag insert (3: 1) x pi pendant 45 ng
Un tampon de ligase 10X Roche 2
Roche T4 ADN ligase (5 U / pl) 1
Sans nucléase H 2 O
Le volume total 20 18 ans et plus (la nuit) 4

C)

Réactif Volume pour la réaction de 1x (pl) Le temps d'incubation (hr) L'incubation Température (° C)
450 ng de plasmide Gag-MJ4 x 450 ng de pi
CutSmart tampon ONE (anciennement tampon NEB n ° 4) 2
NgoMIV enzyme de restriction 0,5
L'enzyme de restriction Hpal 0,5
Sans nucléase H 2 O x
Le volume total 20 2 37

Tableau 5 A) Restriction digérer master mix et B) la réaction de ligature pour la production de provirus chimérique Gag-MJ4. C) restriction de diagnostic condensé d'assurer Gag-MJ4 fidélité clonage.

Nom Primer Séquence de nucléotides (5 '- 3')
GagInnerF1 AGGCTAGAAGGAGAGAGATG
GagF2 GGGACATCAAGCAGCCAT
FOR3 CTAGGAAAAAGGGCTGTTGGAAATG
GagR6 CTGTATCATCTGCTCCTG
Rev3 GACAGGGCTATACATTCTTACTAT
Rev1 AATTTTTCCAGCTCCCTGCTTGCCCA

Tableau 6 Liste des amorces nécessaires pour confirmer LTR 5 'et la séquence gag identité de Gag-MJ4 provirus chimérique séquençage.

Eh bien A Virus de 8 pi + 232 pi de 1% de FBS dans du DMEM
Eh bien B 80 pi de bien A + 160 pi 1% de FBS dans du DMEM
Eh bien C 80 pi de bien B + 160 pi 1% de FBS dans du DMEM
Bien D 80 pi de bien C + 160 pi 1% de FBS dans du DMEM
Eh bien E 80 pi de bien D + 160 pi 1% de FBS dans du DMEM
Eh bien F 80 pi de bien E + 160 pi 1% de FBS dans du DMEM

Tableau 7 système de dilution (3fois) pour le titrage des virus infectieux sur les cellules TZM-bl.

A)

Réactif Volume
PBS sans Ca2 + ou Mg2 + 500 ml
Glutéraldéhyde 4 ml
Formaldéhyde 11 ml

* Note: Conserver à 4 ° C.

B)

Réactif Volume
PBS sans Ca2 + ou Mg2 + 4,75 ml
ferricyanure de potassium (0,2 M) 100 pl
ferrocyanure de potassium (0,2 M) 100 pl
Le chlorure de magnésium (1 M) 20 pl
X-gal (50 mg / ml) 40 pl

* Remarque: frais et stocker abri de la lumière jusqu'à utilisation.


C.

Dilution bien d'origine A B C E Fa
Volume de virus (ul) ajouté dans les puits d'une plaque rangée 24 et 5 1.6667 0,5556 0,1852 0,06173 0,02057

Tableau 8 A) B) des solutions de fixation pour le titrage des virus chimériques Gag-MJ4 sur la lignée de cellules d'indicateur TZM-bl. c) le volume de virus ajouté dans chaque puits pour le calcul des unités infectieuses / ul.

Réactif Volume
Sérum fœtal bovin (FBS), défini 55 ml
Pénicilline, streptomycine, glutamine (100x) 6 ml
Tampon HEPES (1 M) 6 ml

Tableau 9 Recette pour un milieu RPMI complet pour la propagation des cellules GXR25.

Réactif Volume (ml)
NucléaseH 2 O exempt 419,5
Tris-Cl, pH 7,8 (1 M) 30
Le chlorure de potassium (1 M) 37,5
Le chlorure de magnésium (1 M) 2.5
Nonidet P-40 (10%) 5
EDTA (0,5 M) 1.02
Acide polyadénylique, sel de potassium (2 mg / ml) 1,25
Oligo-dT (25 ug / ml) 3,25
Le volume total 500

Tableau 10 Recette pour radiomarqué de la transcriptase inverse maître de dosage mélange. * Note: magasin comme aliquots de 1 ml à -20 ° C.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En raison de la longueur et de la nature technique de ce protocole, il ya plusieurs étapes qui sont essentielles à la fois pour la construction réussie de chimères plasmides Gag-MJ4 ainsi que pour la quantification de la capacité de réplication virale. Bien que la stratégie de clonage basé sur des enzymes de restriction pour l'introduction de gènes gag étranger dans MJ4 décrite dans le présent protocole a de nombreux avantages par rapport aux méthodes basées sur la recombinaison utilisées précédemment, le protocole peut être techniquement difficile si les étapes critiques ne sont pas suivies avec précision.

Tout d'abord, il est absolument essentiel d'utiliser l'ADN plasmidique MJ4 qui a été généré dans une souche bactérienne compétente manque DCM et barrages méthylases d'ADN. Cela est nécessaire car l'activité enzymatique de l'endonucléase de restriction BclI, qui est utilisé pour cloner les gènes gag dans le squelette du MJ4, est barrage / sensible à la méthylation dcm. Le JM110 et SCS110 (un négatif dérivé de JM110 de endA) E. souches coli unre apte à générer l'ADN plasmidique MJ4 non méthylé. En outre, pour l'excision de bandes de vecteur et insert, il est fortement recommandé d'utiliser un éclairage à lumière bleue est utilisée pour la visualisation. Cela permettra de réduire les rayons UV de longueur d'onde de l'ADN-dépendante et augmenter considérablement l'efficacité de clonage. Si un éclairage à lumière bleue n'est pas disponible, l'efficacité de clonage peut être maximisée en visualisant l'ADN avec l'ADN SYBR Safe gel tache à la place du bromure d'éthidium et en minimisant le temps d'exposition aux UV.

Enfin, le clonage moléculaire de grande taille (> 10 kb) et / ou de plasmides rétroviraux tels que MJ4 a toujours été difficile pour diverses raisons. Pour les plasmides réduire efficacité de transformation de souches bactériennes compétentes 42 tandis que les inserts rétroviraux, qui contiennent de longue répétition terminale (LTR) des séquences, à réduire la stabilité du plasmide et compromis fidélité de la réplication de l'ADN du plasmide dans l'hôte bactérienne conduisant à des délétions du génome rétroviral 43 de E. souche de E. coli sur la souche DH5a, dans nos mains. En raison de la nature instable du plasmide, le plasmide produits purifiés doivent être testés quant à la taille du plasmide correct par digestion par enzyme de restriction; ici, une double digestion par les endonucléases de restriction NgoMIV et Hpal à 37 ° C pendant 2 heures.

Une fois réussie génération de plasmides chimères Gag-MJ4 a été accompli, le virus est générée par transfection de 293T cellules, titrés sur une ligne de l'indicateur de la cellule, les cellules TZM-bl, et la capacité de réplication est mesurée en utilisant une lignée de cellules T à base de CEM. La lignée cellulaire CEM-GXR25 à base utilisé pour ces études de réplication est l'un des rares lignées de cellules T capables de supporter établi entrée et la replication de souches à tropisme CCR5 de VIH-1. Ceci a été réalisé par transduction rétrovirale pour permettre l'expression de CCR5 humain stable 37. Cette lignée cellulaire exprime naturellement CXCR4 et supporte la réplication de tropisme CXCR4 du VIH-1, telles que la souche de laboratoire adapté NL4-3. Toutefois, afin de soutenir la réplication efficace de souches à tropisme CCR5, tel que MJ4, les cellules doivent être GXR25 propagées pendant au moins 4 mois avant l'infection. Bien cultures plusieurs passages peuvent soutenir la réplication même après repiquage jusqu'à 1 an. Une surveillance attentive de la réplication à tropisme CCR5 tout au long de passages est essentiel pour des expériences réussies.

Comme toute technique, il ya des limites à la proprotocole qui doit être considéré. En raison de l'emplacement des sites de restriction dans le plasmide MJ4 ainsi que la disponibilité de sites de restriction conservés à l'état naturel isolats VIH-1, un site de restriction distal 3 ', Bell, est situé 137 nucléotides du codon d'arrêt de gag. Bien que cela génère un gène de la protéase chimère, cette région est de 96,5% conservée dans cette cohorte, et nous n'avons pas observé une abondance de virus chimériques morts ou défectueux.

L'un des avantages de l'utilisation du sous-type C MJ4 clone moléculaire infectieux de sous-type C des séquences dérivées est que cela réduit le risque de couplage de gène sous-optimal entre les gènes gag et des vecteurs de squelette de différents sous-types. Cependant, une certaine quantité de la diversité au sein-clade existe comme le montre la concentration des séquences du VIH-1 par pays ou d'une région, même si trouve dans le même sous-type 31. Cela pourrait contribuer à la liaison optimale entre les gènes gag derIved de Zambiens infection aiguë et l'épine dorsale de clone moléculaire infectieux MJ4, qui a été dérivée à partir d'un individu infecté de manière chronique du Botswana 38. Cependant, la majorité des constructions analysés produite virus de descendance infectieux. Aussi différents VIH-1 sous-type C clones infectieux moléculaires deviennent plus largement disponibles, il sera important de valider davantage ce système par clonage dans ces gènes gag du VIH-1 clade C dans d'autres squelettes afin de veiller à ce que il ya un biais minimal introduit en raison les incompatibilités de squelette.

La lignée cellulaire GXR25 est une ligne unique de cellules, en particulier en raison de sa capacité à soutenir à la fois CXCR4 et des souches à tropisme CCR5 et son VIH-1 GFP inductible reporter 37. Toutefois, certaines limitations existent et doivent être examinés attentivement avant d'utiliser cette lignée cellulaire pour des expériences adaptées à partir de ce protocole. La lignée cellulaire GXR25 ne semble pas soutenir l'entrée de la majorité des sous-type C ou A, à tropisme CCR5, primary isole nous avons testé. En outre, la lignée cellulaire CEM mère à partir de laquelle la lignée cellulaire GXR25 a été dérivé des expositions des niveaux élevés de la cyclophiline A, jusqu'à 2 à 4 fois plus élevé que l'expression de la lignée cellulaire Jurkat 44. En raison de niveaux élevés de la cyclophiline A, le défaut de réplication normalement associée à la canonique HLA-B * 57 associé évasion mutation, T242N, qui est attribué à une diminution de la capacité de capside de lier la cyclophiline A, ne peuvent pas être facilement détecté dans cette lignée cellulaire particulier 25. Ainsi, la lignée cellulaire GXR25 base de CEM n'est pas idéal pour l'étude des défauts de réplication associées à des mutations dans la capside du VIH-1 boucle liant à la cyclophiline.

Enfin, bien que ce protocole est idéale pour l'analyse de la capacité de réplication de séquences gag provenant de points de temps de courte durée, les modifications doivent être faites dans le but d'étudier la capacité de réplication de gènes gag provenant d'individus infectés de manière chronique. Ce protocole implique l'amplification des séquences de la population à partir de points de temps de courte durée (médian de 45 jours après la date de l'infection estimé) lorsque la diversité virale est limitée. Le gène gag de chaque chimère est ensuite séquencé et comparé à l'amplicon PCR de la population initiale pour assurer la fidélité de clonage. En raison de la diversité de séquence limitée à des moments aigus, le clonage des produits de PCR de la population est possible. Cependant, la diversité de séquence existe dans la quasi-espèce virale d'une personne infectée chroniquement; Par conséquent, afin d'évaluer avec précision la capacité de réplication de la quasi-espèce chroniques, l'amplification du génome unique doit être utilisée pour capturer plusieurs variantes représentatives. Chacune de ces variantes doivent être ensuite analysé pour la réplication in vitro.

Cette technique a plusieurs applications plus larges, qui se dégagent de ses avantages par rapport aux méthodes existantes. Comme ce processus se traduit par un plasmide à réplication compétente clonale, il est simple à utiliser pour les constructions m supplémentairesétudes de utagenesis, qui peuvent aider à élucider les contributions des résidus spécifiques à la réplication virale. En outre, par le clonage des gènes gag de points dans le temps longitudinales, on peut évaluer l'évolution de la capacité de réplication virale au fil du temps et comment ces changements peuvent affecter la pathogenèse chez un individu infecté par le VIH-1.

Cette technique peut être modifiée afin d'élargir son utilité pour des applications différentes. VIH-1 protéines virales supplémentaires peuvent être conçus dans le plasmide MJ4 afin d'évaluer leurs effets sur la réplication virale ou leurs interactions avec les protéines de l'hôte. Ceci peut être accompli par l'ingénierie des sites de restriction supplémentaires régions désirées dans le génome par l'introduction de modifications de nucleotides silencieux. Cependant, une attention particulière doit être prise lors de la conception de nouveaux sites de restriction dans la moitié 3 'du génome VIH-1 que de nombreuses protéines accessoires sont encodés dans des cadres de lecture alternatifs, et des changements silencieux dans unprotéine pourrait conduire à des substitutions d'acides aminés dans un autre. Dans ce cas, le site de restriction méthodes de clonage indépendants tels que ceux décrits par Dudley et al. Peuvent 45 surmonter cette limitation. Les séquences virales provenant de différentes populations peuvent avoir différentes gammes de capacités de réplication, et la MOI peut être ajusté en conséquence afin de capturer la majorité des isolats viraux dans leur phase de croissance logarithmique. Enfin, la lignée cellulaire GXR25 a été transfectée de manière stable avec la GFP sous une LTR à moteur, le promoteur Tat-inductible, et de la propagation virale peut être mesurée comme une fonction de cellules GFP-positives par cytométrie de flux 37 comme une alternative à l'essai de RT décrit ici ou un p24 ELISA classique.

En conclusion, ce protocole prévoit une technique efficace et puissant pour évaluer le VIH-1 réplication virale telle que conférée par le gène gag, qui code pour une protéine de structure conservée nécessaire à la formation du virion bon, Bourgeonnement, la maturation et le démontage 46-48. En outre, cette technique engendre un plasmide à réplication clonale compétente, ce qui est idéal pour des études de mutagenèse et, par conséquent, fournit un procédé pour élucider les déterminants d'acides aminés spécifiques de la capacité réplicative du virus. De telles études sont indispensables pour améliorer la compréhension de la façon dont l'évolution virale immunitaire axée affecte pathogenèse et la progression de la maladie du VIH-1 individus infectés.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
PCR Reagents
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagF2: 5' GGGACATCAAGCAGCCAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagR6: 5' CTGTATCATCTGCTCCTG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
CoolRack PCR 96 XT Biocision BCS-529
CoolRack M15 Biocision BCS-125
Nuclease free water Fisher SH30538FS Manufactured by Hyclone
QIAamp Viral RNA Mini Kit Qiagen 52906
Simport PCR 8 Strip Tubes, Blue (Flat Cap) Daigger EF3647BX
SuperScript III one-step RT-PCR system Life Technologies/Invitrogen 12574035
Phusion Hot-start II DNA polymerase Fisher F-549L
PCR Nucleotide Mix Roche 4638956001
Agarose, high gel strength Fisher 50-213-128
TAE 10X Life Technologies/Invitrogen AM9869
Promega 1 kb DNA ladder Fisher PRG5711 Manufactured by Promega
Sybr Safe DNA Gel Stain, 10,000x Life Technologies/Invitrogen S33102
Wizard SV Gel and PCR Clean-Up System Promega A9282
Razor blades, single-edged Fisher 12-640 Manufactured by Surgical Design
Thermocycler, PTC-200 MJ Research
Microbiology & Cloning Reagents
LB Agar, Miller Fisher BP1425-2
LB Broth, Lennox Fisher BP1427-2
Sterile 100 x 15 mm polystyrene Petri dishes Fisher 08-757-12
Ampicillin sodium salt Sigma-Aldrich A9518-5G
Falcon 14 ml Polypropylene round-bottom tubes BD Biosciences 352059
NgoMIV restriction endonuclease New England BioLabs R0564L
BclI restriction endonuclease New England BioLabs R0160L
HpaI restriction endonuclease New England BioLabs R0105L
T4 DNA Ligase, 5 U/μl Roche 10799009001
JM109 competent cells, >108 cfu/μg Promega L2001
PureYield plasmid miniprep system Promega A1222
Safe Imager 2.0 Blue Light Transilluminator Invitrogen G6600
Microfuge 18 centrifuge Beckman Coulter 367160
Cell Culture Reagents
Amphyl cleaner/disinfectant Fisher 22-030-394
Fugene HD, 1 ml VWR PAE2311 Manufactured by Promega
Hexadimethrine bromide (Polybrene) Sigma-Aldrich H9268-5G
Costar Plates, 6-well, flat Fisher 07-200-83 Manufactured by Corning Life
Costar Plates, 24-well, flat Fisher 07-200-84 Manufactured by Corning Life
Costar Plates, 96-well, round Fisher 07-200-95 Manufactured by Corning Life
Flasks, Corning filter top/canted neck, 75 cm2 Fisher 10-126-37
Flasks, Corning filter top/canted neck, 150 cm2 Fisher 10-126-34 Manufactured by Corning Life
Conical Tubes, 50 ml, blue cap Fisher 14-432-22 Manufactured by BD Biosciences
Conical Tubes, 15 ml, blue cap Fisher 14-959-70C Manufactured by BD Biosciences
Trypsin-EDTA Fisher MT25052CI Manufactured by Mediatech
RPMI, 500 ml Life Technologies/Invitrogen 11875-119
DMEM, 500 ml Life Technologies/Invitrogen 11965-118
Penicillin/Streptomycin/Glutamine, 100x Life Technologies/Invitrogen 10378-016
PBS with magnesium and calcium, 500 ml Life Technologies/Invitrogen 14040-133
PBS without magnesium and calcium Life Technologies/Invitrogen 20012-050
Sarstedt tubes, assorted colors Sarstedt 72.694.996
Reservoir Trays for Multichannel, 55 ml Fisher 13-681-501
DEAE-Dextran Fisher NC9691007
Corning 96 well clear V bottom tissue culture treated microplate Fisher 07-200-96 Manufactured by Corning Life
HEPES, 1 M Buffer Solution Life Technologies/Invitrogen 15630-080
FBS, Defined, 500 ml Fisher SH30070 03
X-gal VWR PAV3941 Manufactured by Promega
Glutaraldehyde, Grade II, 25% in H2O Sigma-Aldrich G6257-100ML
1 M Magnesium chloride solution Sigma-Aldrich M1028-100ML
Formaldehyde solution, for molecular biology, 36.5% Sigma-Aldrich F8775-500ML
Potassium hexacyanoferrate(II) trihydrate Sigma-Aldrich P9387-100G
Potassium hexacyanoferrate(III) Sigma-Aldrich P8131-100G
Allegra X15-R centrifuge Beckman Coulter 392932
TC10 automated cell counter Bio-Rad 1450001
VistaVision inverted microscope VWR
Reverse-Transcriptase Quantification Assay Reagents
dTTP, [α-33P]- 3000 Ci/mmol, 10 mCi/ml, 1 mCi Perkin-Elmer NEG605H001MC
1 M Tris-Cl, pH 8.0 Life Technologies/Invitrogen 15568025 Must be adjusted to pH 7.8 with KOH
2 M Potassium chloride (KCl) Life Technologies/Invitrogen AM9640G Adjust to 1 M solution
0.5 M EDTA Life Technologies/Invitrogen 15575-020
Nonidet P40 Roche 11333941103
Polyadenylic acid (Poly rA) potassium salt  Midland Reagent Co. P-3001
Oligo d(T) primer Life Technologies/Invitrogen 18418-012
Dithiothreitol (DTT) Sigma-Aldrich 43815-1G
SR, Super Resolution Phosphor Screen, Small Perkin-Elmer 7001485
Corning Costar Thermowell 96-well plate model (M) Polycarbonate Fisher 07-200-245 Manufactured by Corning Life
Corning 96-well Microplate Aluminum Sealing Tape, Nonsterile Fisher 07-200-684 Manufactured by Corning Life
DE-81 anion exchange paper Whatman 3658-915
Trisodium citrate dihydrate Sigma-Aldrich S1804-1KG
Sodium Chloride Fisher S671-3
Autoradiography cassette Fisher FB-CA-810
Cyclone storage phoshpor screen Packard

DOWNLOAD MATERIALS LIST

References

  1. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., Oldstone, M. B. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. Journal of virology. 68, 6103-6110 (1994).
  2. Koup, R. A., et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. Journal of virology. 68, 4650-4655 (1994).
  3. Jin, X., et al. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. The Journal of experimental medicine. 189, 991-998 (1999).
  4. Schmitz, J. E., et al. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science. 283, 857-860 (1999).
  5. Brumme, Z. L., et al. Marked epitope- and allele-specific differences in rates of mutation in human immunodeficiency type 1 (HIV-1) Gag, Pol, and Nef cytotoxic T-lymphocyte epitopes in acute/early HIV-1 infection. Journal of virology. 82, 9216-9227 (2008).
  6. Leslie, A. J., et al. HIV evolution: CTL escape mutation and reversion after transmission. Nature medicine. 10, 282-289 (2004).
  7. Phillips, R. E., et al. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature. 354, 453-459 (1991).
  8. Price, D. A., et al. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proceedings of the National Academy of Sciences of the United States of America. 94, 1890-1895 (1997).
  9. Goulder, P. J., et al. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nature. 3, 212-217 (1997).
  10. Tang, J., et al. Favorable and unfavorable HLA class I alleles and haplotypes in Zambians predominantly infected with clade C human immunodeficiency virus type 1. Journal of virology. 76, 8276-8284 (2002).
  11. Prentice, H. A., et al. HLA-B*57 versus HLA-B*81 in HIV-1 infection: slow and steady wins the race. Journal of virology. 87, 4043-4051 (2013).
  12. Migueles, S. A., et al. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proceedings of the National Academy of Sciences of the United States of America. 97, 2709-2714 (2000).
  13. Leslie, A., et al. Additive contribution of HLA class I alleles in the immune control of HIV-1 infection. Journal of virology. 84, 9879-9888 (2010).
  14. Kaslow, R. A., et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nature medicine. 2, 405-411 (1996).
  15. Altfeld, M., et al. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS. 17, 2581-2591 (2003).
  16. Kiepiela, P., et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nature medicine. 13, 46-53 (2007).
  17. Mothe, B., et al. Definition of the viral targets of protective HIV-1-specific T cell responses. Journal of translational medicine. 9, 208 (2011).
  18. Peyerl, F. W., Barouch, D. H., Letvin, N. L. Structural constraints on viral escape from HIV- and SIV-specific cytotoxic T-lymphocytes. Viral immunology. 17, 144-151 (2004).
  19. Rolland, M., et al. Broad and Gag-biased HIV-1 epitope repertoires are associated with lower viral loads. PloS one. 3, e1424 (2008).
  20. Wagner, R., et al. Molecular and functional analysis of a conserved CTL epitope in HIV-1 p24 recognized from a long-term nonprogressor: constraints on immune escape associated with targeting a sequence essential for viral replication. J Immunol. 162, 3727-3734 (1999).
  21. Wang, Y. E., et al. Protective HLA class I alleles that restrict acute-phase CD8+ T-cell responses are associated with viral escape mutations located in highly conserved regions of human immunodeficiency virus type 1. Journal of virology. 83, 1845-1855 (2009).
  22. Chopera, D. R., et al. Transmission of HIV-1 CTL escape variants provides HLA-mismatched recipients with a survival advantage. PLoS pathogens. 4, e1000033 (2008).
  23. Crawford, H., et al. Evolution of HLA-B*5703 HIV-1 escape mutations in HLA-B*5703-positive individuals and their transmission recipients. The Journal of experimental medicine. 206, 909-921 (2009).
  24. Boutwell, C. L., et al. Frequent and variable cytotoxic-T-lymphocyte escape-associated fitness costs in the human immunodeficiency virus type 1 subtype B Gag proteins. Journal of virology. 87, 3952-3965 (2013).
  25. Brockman, M. A., et al. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. Journal of virology. 81, 12608-12618 (2007).
  26. Crawford, H., et al. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. Journal of virology. 81, 8346-8351 (2007).
  27. Martinez-Picado, J., et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. Journal of virology. 80, 3617-3623 (2006).
  28. Schneidewind, A., et al. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. Journal of virology. 81, 12382-12393 (2007).
  29. Wright, J. K., et al. Impact of HLA-B*81-associated mutations in HIV-1 Gag on viral replication capacity. Journal of virology. 86, 3193-3199 (2012).
  30. Kawashima, Y., et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature. 458, 641-645 (2009).
  31. Goepfert, P. A., et al. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. The Journal of experimental medicine. 205, 1009-1017 (2008).
  32. Brockman, M. A., et al. Early selection in Gag by protective HLA alleles contributes to reduced HIV-1 replication capacity that may be largely compensated for in chronic infection. Journal of virology. 84, 11937-11949 (2010).
  33. Huang, K. H., et al. Progression to AIDS in South Africa is associated with both reverting and compensatory viral mutations. PloS one. 6, e19018 (2011).
  34. Wright, J. K., et al. Gag-protease-mediated replication capacity in HIV-1 subtype C chronic infection: associations with HLA type and clinical parameters. Journal of virology. 84, 10820-10831 (2010).
  35. Wright, J. K., et al. Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype. C. Journal of virology. 85, 3996-4006 (2011).
  36. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of virology. 59, 284-291 (1986).
  37. Brockman, M. A., Tanzi, G. O., Walker, B. D., Allen, T. M. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. Journal of virology. 131, 134-142 (2006).
  38. Ndung'u, T., Renjifo, B., Essex, M. Construction and analysis of an infectious human Immunodeficiency virus type 1 subtype C molecular clone. Journal of virology. 75, 4964-4972 (2001).
  39. Prince, J. L., et al. Role of transmitted Gag CTL polymorphisms in defining replicative capacity and early HIV-1 pathogenesis. PLoS pathogens. 8, e1003041 (2012).
  40. Ostrowski, M. A., Chun, T. W., Cheseboro, B., Stanley, S. K., Tremblay, M., et al. Detection assays for HIV proteins. Current protocols in immunology / edited by John E. Coligan ... [et al.]. 12, (Unit 12 15), Forthcoming.
  41. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, 61-68 (1989).
  42. Inoue, H., Nojima, H., Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene. 96, 23-28 (1990).
  43. Bichara, M., Pinet, I., Schumacher, S., Fuchs, R. P. Mechanisms of dinucleotide repeat instability in Escherichia coli. Genetics. 154, 533-542 (2000).
  44. Ackerson, B., Rey, O., Canon, J., Krogstad, P. Cells with high cyclophilin A content support replication of human immunodeficiency virus type 1 Gag mutants with decreased ability to incorporate cyclophilin A. Journal of virology. 72, 303-308 (1998).
  45. Dudley, D. M., et al. A novel yeast-based recombination method to clone and propagate diverse HIV-1 isolates. BioTechniques. 46, 458-467 (2009).
  46. Ganser-Pornillos, B. K., von Schwedler, U. K., Stray, K. M., Aiken, C., Sundquist, W. I. Assembly properties of the human immunodeficiency virus type 1 CA protein. Journal of virology. 78, 2545-2552 (2004).
  47. Forshey, B. M., von Schwedler, U., Sundquist, W. I., Aiken, C. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. Journal of virology. 76, 5667-5677 (2002).
  48. Gottlinger, H. G., Dorfman, T., Sodroski, J. G., Haseltine, W. A. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proceedings of the National Academy of Sciences of the United States of America. 88, 3195-3199 (1991).
Une enzyme de restriction basée sur le clonage méthode pour évaluer la<em&gt; In vitro</em&gt; Capacité de réplication du VIH-1 sous-type C Gag-MJ4 chimériques virus
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).More

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter