Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

एक प्रतिबंध एंजाइम आधारित क्लोनिंग विधि का आकलन करने के लिए doi: 10.3791/51506 Published: August 31, 2014
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

मेजबान और एचआईवी -1 रोगजनन और रोग प्रगति तर्कसंगत वैक्सीन डिजाइन के लिए सर्वोपरि है कि प्रभावित वायरल विशेषताओं दोनों निर्धारण. सेलुलर प्रतिरक्षा प्रतिक्रिया एचआईवी -1 संक्रमण के लिए मानव प्रतिरक्षा प्रतिक्रिया के एक प्रमुख घटक है. साइटोटोक्सिक टी लिम्फोसाइटों (सीटीएल) तीव्र viremia की प्रारंभिक नियंत्रण के लिए जरूरी हैं, और मेजबान एक स्थिर राज्य (सेट बिंदु) वायरल लोड 1,2 स्थापित करने के लिए अनुमति देते हैं. इन प्रेरक कोशिकाओं की प्रायोगिक कमी वायरल नियंत्रण 3,4 के नुकसान में परिणाम है. इस के बावजूद, म्यूटेशन virally संक्रमित कोशिकाओं 5-9 की सीटीएल मान्यता पलट कि वायरल जीनोम के भीतर उठता बच.

कुछ एचएलए alleles कम वायरल लोड और बी * 57, बी * 27 और बी * 81 10-15 सहित धीमी रोग प्रगति के साथ संबद्ध किया गया है. एचएलए वर्ग मैं alleles के सुरक्षात्मक लाभ का एक हिस्सा वे इस तरह के झूठ के रूप में जीनोम के कार्यात्मक विवश क्षेत्रों को लक्षित है कि इस तथ्य को जिम्मेदार ठहराया जा सकता हैऔर इन विट्रो 16-21 में दोहराने के लिए वायरस की क्षमता कम होती है कि भागने म्यूटेशन के लिए चयन करें. सेलुलर प्रतिरक्षा प्रणाली से बच मैं एलील चयन एचएलए वर्ग के संदर्भ में वायरस के लिए फायदेमंद है, इन उत्परिवर्तनों का प्रभाव एक एचएलए बेमेल 22,23 व्यक्ति को ट्रांसमिशन पर मेजबान के लिए अंतर परिणाम हो सकते हैं. इसलिए, वायरल प्रतिकृति क्षमता पर प्रेषित एचएलए जुड़े भागने परिवर्तन के प्रभाव को समझने जल्दी एचआईवी -1 रोगजनन के बारे में हमारी समझ को आगे करने के लिए महत्वपूर्ण होगा.

बहुत प्रगति मैं 24-29 alleles विशिष्ट एचएलए वर्ग के साथ जुड़े व्यक्ति भागने म्यूटेशन की फिटनेस दोषों की पहचान और चिह्नित करने के लिए बनाया गया है, स्वाभाविक रूप से एचआईवी -1 वियोजन एचएलए जुड़े बहुरूपताओं की अनोखी और जटिल पैरों के निशान होने की संभावना एचएलए से उत्पन्न होने वाली है घटनेवाला अलग immunogenetic पृष्ठभूमि 30 की मध्यस्थता प्रतिरक्षा दबाव. एपी मेंछला विश्लेषण, GOEPFERT एट अल. 88 तीव्रता से संक्रमित Zambians से व्युत्पन्न प्रेषित चुप दृश्यों में एचएलए जुड़े म्यूटेशन का एक संग्रह सेट बिंदु वायरल लोड 31 में कमी के साथ जुड़े थे कि पता चला है. इस एचएलए बेमेल प्राप्तकर्ताओं को विशेष रूप से चुप में हानिकारक बच म्यूटेशनों के संचरण, एक नैदानिक ​​लाभ प्रदान करता है, और वायरल प्रतिकृति तनु के कारण हो सकता है कि सुझाव दिया. आगे चल रहा है, यह एक ऐसी प्रतिकृति क्षमता, और जल्दी प्रतिकृति बदले में एचआईवी -1 नैदानिक ​​मानकों और देर चरण को प्रभावित कर सकता है कि कैसे के रूप में संचारित वायरस की विशेषताओं को परिभाषित करने के लिए मिलकर काम कैसे जटिल चुप बहुरूपताओं के संयोजन प्राकृतिक रूप से उत्पन्न वियोजन के भीतर अध्ययन करने के लिए जरूरी है रोगजनन.

Brockman एट अल. प्रथम उप प्रकार सी और बी संक्रमण दोनों में जीर्ण अवस्था संक्रमण और वायरल लोड दौरान पृथक झूठ समर्थक दृश्यों की प्रतिकृति क्षमता के बीच एक कड़ी का प्रदर्शन32-35. इन अध्ययनों में प्रस्तुत प्रयोगात्मक दृष्टिकोण, लंबे समय से संक्रमित व्यक्तियों से व्युत्पन्न दृश्यों की इन विट्रो प्रतिकृति क्षमता की जांच के लिए हालांकि उपयुक्त, तीव्रता से संक्रमित व्यक्तियों मुश्किल उप प्रकार सी में एचआईवी -1 replicative क्षमता का अध्ययन करना है कि कई तकनीकी निरंतर और सीमाएं हैं. इस विधि लव से भाग में निकाली थी जो उप प्रकार बी NL4-3 provirus, में जनसंख्या आधारित पीसीआर प्रवर्धित दृश्यों के पुनर्संयोजन पर निर्भर करता है, एक प्रयोगशाला वायरस शेयर 36 रूपांतरित किया. वायरस पीढ़ी पीसीआर amplicons साथ एक यूके आधारित टी सेल लाइन 37 के सह अभिकर्मक द्वारा पूरा किया और delta- झूठ समर्थक NL4-3 डीएनए पचा गया था. इस विधि संभावित विवो में वायरल quasispecies के संबंध में बरामद वायरस शेयर की प्रकृति skewing, और इसलिए इन विट्रो में प्रतिकृति क्षमता का मापन फेरबदल, महीने के लिए सप्ताह की अवधि में वायरस के परिणाम की आवश्यकता है. इस विधि मैंलंबे समय से संक्रमित व्यक्तियों की एक बड़ी संख्या से कई अलग वायरल वेरिएंट क्लोनिंग इसे प्रभावी ढंग से उच्चतम replicative क्षमता के साथ वायरस के लिए चुनता है, जहां लंबे समय से संक्रमित व्यक्तियों का अध्ययन, और जहां के लिए अधिक उपयुक्त है संभव इसलिए काफी श्रम गहन और नहीं है. हालांकि, एक तीव्रता से संक्रमित व्यक्ति के भीतर, आम तौर पर 1-2 वेरिएंट मौजूद हैं, और इस प्रकार, इन विट्रो चयन के दबाव के माध्यम से बरामद वायरस शेयर की प्रकृति skewing के जोखिम को नष्ट करने के लिए इन विट्रो प्रतिकृति क्षमता का एक और अधिक सटीक आकलन के लिए अनुमति देता है. दूसरे, इस पद्धति का एक उपप्रकार बी व्युत्पन्न रीढ़ में उप प्रकार सी झूठ समर्थक दृश्यों पुनर्संयोजन आवश्यकता है, और विश्लेषण में रीढ़ असंगति पूर्वाग्रहों मिलवा सकता है. कारण इन सीमाओं के कारण, दृश्यों की बड़ी संख्या की शुरुआत की किसी भी संभावित पूर्वाग्रहों को दूर करने के क्रम में विश्लेषण किया जाना चाहिए.

यहाँ हम एक वैकल्पिक प्रयोगात्मक appro वर्णनउप प्रकार सी तीव्रता से संक्रमित व्यक्तियों से व्युत्पन्न दृश्यों के अध्ययन के लिए उपयुक्त ACH. हम उप प्रकार सी proviral रीढ़, MJ4 में एचआईवी -1 उप प्रकार सी संक्रमित व्यक्तियों की तीव्र संक्रमण समय बिंदुओं से व्युत्पन्न झूठ जीन शुरू करने का प्रतिबंध एंजाइम आधारित क्लोनिंग रणनीति का उपयोग करें. झूठ जीन क्लोन करने के लिए, जिसमें एक आम रीढ़ के रूप में MJ4 का उपयोग उप प्रकार सी व्युत्पन्न दृश्यों के विश्लेषण के लिए महत्वपूर्ण है. MJ4 कारण रीढ़ की हड्डी और झूठ जीन के बीच उप प्रकार असंगति को पूर्वाग्रह को पेश करने की संभावना कम होगी और इस प्रकार एक प्राथमिक अलग 38 से व्युत्पन्न, और है. Proviral 293T कोशिकाओं में सीधे ट्रांसफ़ेक्ट हो constructs, और क्लोन झूठ अनुक्रम के समान एक प्रतिरूप वायरस शेयर की वसूली के लिए के लिए इसके अलावा, एंजाइम आधारित प्रतिबंध क्लोनिंग का उपयोग करने के दृष्टिकोण की अनुमति देता है.

नीचे प्रस्तुत विधि व्युत्पन्न चुप-MJ4 उप प्रकार सी की प्रतिकृति क्षमता का आकलन करने के लिए एक उच्च throughput विधि हैकाइमेरिक वायरस. 293T कोशिकाओं में अभिकर्मक सीधा है और वायरस की वसूली केवल तीन दिन लगते हैं. इन विट्रो प्रतिकृति क्षमता. Brockman एट अल द्वारा बनाई गई एक ही CEM-CCR5 आधारित टी सेल लाइन पर 37 assayed, लेकिन सफल प्रतिकृति के लिए आवश्यक महत्वपूर्ण प्रोटोकॉल संशोधनों उपयोग कर रहा है उप प्रकार सी MJ4 काइमेरिक वायरस की. बल्कि PBMCs से एक उपयुक्त टी सेल लाइन का उपयोग उच्च परख reproducibility के साथ परीक्षण किया जा उप प्रकार सी MJ4-काइमेरिक वायरस की बड़ी संख्या के लिए अनुमति देता है. अंत में, सतह पर तैरनेवाला में वायरस की मात्रा का ठहराव के लिए एक radiolabeled रिवर्स ट्रांसक्रिपटेस परख का उपयोग व्यावसायिक रूप से उपलब्ध पी 24 एलिसा किट का उपयोग कर से अधिक लागत प्रभावी है. यह भी एक ही परख के भीतर दोनों खराब और अत्यधिक नकल वायरस का पता लगाने के लिए और वियोजन के बीच प्रतिकृति में सूक्ष्म अंतर का पता लगाने के लिए महत्वपूर्ण था, जो एक उच्च गतिशील रेंज, देता है.

अंत में, यहाँ प्रस्तुत विधि के लिए अनुमति दी गई हैएचआईवी -1 उप प्रकार सी से व्युत्पन्न झूठ दृश्यों की प्रतिकृति क्षमता का गहराई से अध्ययन तीव्रता से जाम्बिया से व्यक्तियों संक्रमित, और लिखित रूप में भी सी आबादी संक्रमित अन्य उप प्रकार का अध्ययन करने के लिए विस्तारित किया जा सकता है. अलग चुप आइसोलेट्स के बीच प्रतिकृति क्षमता में भिन्नता के एक उच्च डिग्री मनाया गया. इसके अलावा, हम एक तीन साल की अवधि में 39 से अधिक सीडी 4 + गिरावट प्रेषित चुप की प्रतिकृति क्षमता और सेट बिंदु वायरल लोड के बीच और साथ ही साथ एक सांख्यिकीय संघ को दिखाने के लिए सक्षम थे. इस तरह के परिणाम, ऐसी प्रतिकृति क्षमता के रूप में कैसे संचारित वायरल विशेषताओं का अध्ययन करने के महत्व पर प्रकाश डाला जल्दी संक्रमण के दौरान रोगजनन प्रभावित करने के लिए मेजबान प्रतिरक्षा प्रणाली के साथ बातचीत और प्रभावी टीके के उपायों के साथ ही उपचार के विकास के लिए अभिन्न हो जाएगा.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

संक्रमित से एचआईवी -1 गैग जीन की 1 प्रवर्धन, फ्रोजन प्लाज्मा

  1. एक निकासी किट का उपयोग एचआईवी -1 से संक्रमित प्लाज्मा thawed 140 μl से वायरल शाही सेना निकालें.
    1. जब संभव हो, तुरंत शाही सेना निकासी के रूप में unfrozen वायरल आरएनए सबसे अच्छा प्रवर्धन परिणाम पैदावार के बाद सीडीएनए संश्लेषण के लिए आगे बढ़ें. यदि संभव हो तो, पूर्व वायरल शाही सेना निकासी के लिए 4 डिग्री सेल्सियस पर पहले दौर डीएनए प्रवर्धन और दुकान के लिए पीसीआर मास्टर मिश्रण की स्थापना की.
  2. शाही सेना से सीडीएनए रिवर्स नक़ल और रिवर्स ट्रांसक्रिपटेस और एक एक कदम आरटी पीसीआर में एक थर्मास्टाइबल डीएनए पोलीमरेज़ का उपयोग पहले दौर डीएनए उत्पादों बढ़ाना.
    1. कमरे के तापमान पर -80 डिग्री सेल्सियस फ्रीजर (ठंड आवश्यक था) और संक्षिप्त पिघलना के बाहर आरएनए लो तो ठंड ब्लॉक में जगह है. मास्टर मिश्रण के 45 μl युक्त प्रत्येक पीसीआर ट्यूब को शाही सेना के 5 μl स्थानांतरण 50 μl के अंतिम मात्रा देने के लिए. तुरंत सेल्सियस फ्रीजर में -80 शाही सेना के नमूने शेष जगह है.
    2. एंजाइम है के बाद एकवांछित प्रतिक्रियाओं की संख्या के लिए प्रत्येक पतली दीवारों पीसीआर प्रवर्धन ट्यूब में पहले दौर पीसीआर मास्टर मिश्रण (तालिका 1 ए), विभाज्य 45 μl को dded. नमूने के बीच कम से कम पार संदूषण सुनिश्चित करने के लिए पट्टी के ढक्कन व्यक्ति टोपी के साथ पीसीआर ट्यूब का उपयोग करें और नहीं करने के लिए सुनिश्चित करें. तापमान संवेदनशील आरटी एंजाइम और शाही सेना टेम्पलेट की रक्षा के लिए एक ठंड ब्लॉक में पीसीआर ट्यूब रखें. नोट: नमूने पर्याप्त रूप से वायरल quasispecies नमूना के क्रम में तीन प्रतियों में चलाया जाना चाहिए. यह पीसीआर शुरू की misincorporation कम करने के लिए एक उच्च निष्ठा डीएनए पोलीमरेज़ एंजाइम के साथ एक उत्पाद का उपयोग करने के लिए भी महत्वपूर्ण है. सिफारिश उत्पाद के लिए अभिकर्मकों सूची देखें.
    3. शाही सेना टेम्पलेट सभी प्रतिक्रिया ट्यूबों में जोड़ा गया है के बाद, तालिका -1 बी में वर्णित cycler प्रोग्राम का उपयोग कर प्रवर्धन के लिए एक thermocycler पीसीआर ट्यूब हस्तांतरण. नोट: इस प्रवर्धन के उत्पाद पीसीआर नेस्ट एक दूसरे राउंड में इस्तेमाल किया जाएगा.
  3. प्रदर्शन करना एक नेस्ट एसईडीएनए टेम्पलेट के रूप में पहले दौर पीसीआर प्रवर्धन (1.2) की 1 μl का उपयोग cond दौर पीसीआर प्रवर्धन,.
    1. विभाज्य वांछित प्रतिक्रियाओं की संख्या के लिए प्रत्येक पतली दीवारों पीसीआर ट्यूब को दूसरे दौर पीसीआर मास्टर मिश्रण (तालिका 2 ए) के 49 μl. स्थानांतरण प्रत्येक प्रतिक्रिया ट्यूब को पहले दौर पीसीआर प्रवर्धन से 1 μl 50 μl के अंतिम मात्रा देने के लिए. नोट: यह दूसरा दौर प्रवर्धन के लिए के रूप में टेम्पलेट डीएनए की सेवा करेंगे. यह पीसीआर शुरू की misincorporation कम करने के लिए बहुत उच्च निष्ठा और प्रूफरीडिंग क्षमताओं के साथ एक डीएनए पोलीमरेज़ का उपयोग करने के लिए भी महत्वपूर्ण है. सिफारिश उत्पाद के लिए अभिकर्मकों सूची देखें.
    2. Thermocycler दूसरे दौर पीसीआर प्रतिक्रिया मिश्रण और टेबल 2 बी में वर्णित रन प्रोग्राम स्थानांतरण. नोट: कार्यक्रम के पूरा होने के बाद, इस प्रतिक्रिया के उत्पाद उत्पाद के उत्पादन की पुष्टि के लिए एक agarose जेल पर चलाया जाएगा.
  4. 5 & ​​# करने के लिए 5x लोडिंग डाई के 3 μl जोड़ें181, 50 μl दूसरे राउंड प्रतिक्रिया मात्रा के एल और बैंड हल कर रहे हैं जब तक एक यूवी फ्लोरोसेंट डीएनए दाग युक्त एक 1% agarose-tae जेल पर 120 वी पर चलाते हैं. एक नीले प्रकाश प्रकाशक पर 1.6 केबी बैंड कल्पना (चित्रा 1 ए देखें).
  5. एक डीएनए दाग युक्त एक 1% agarose-tae जेल पर शेष 45 μl प्रतिक्रिया मात्रा भागो, और एक स्वच्छ धार के साथ उपयुक्त बैंड आबकारी.
    1. , Nuclease मुक्त पानी में elute, एक जेल शुद्धि किट का उपयोग कर जेल टुकड़ा से डीएनए निकालने प्रति व्यक्ति तीन सकारात्मक प्रतिक्रियाओं गठबंधन, और बाद में उपयोग के लिए -20 डिग्री सेल्सियस पर उत्पाद फ्रीज.

आवश्यक प्रतिबंध साइटों के लागू होने से क्लोनिंग के लिए 2 तैयारी झूठ amplicons

  1. लंबे टर्मिनल दोहराएँ (लीटर) MJ4 प्लाज्मिड / 5 'UTR भाग बढ़ाना (3 टेबल देखें).
  2. शुद्ध 1.3 केबी पीसीआर प्रकाशक पर उत्पादों, आबकारी सकारात्मक amplicons, जेल कल्पना और के रूप में पहले फ्रीजवर्णित (1.4,1.5, चित्रा 1 बी देखें).
  3. "ब्याह ओवरलैप विस्तार" के माध्यम से MJ4 LTR- झूठ amplicons जुड़े बनाएँ पीसीआर (4 तालिका देखें).
  4. , आबकारी, कल्पना को शुद्ध, और 1.4,1.5 में के रूप में 3.2 केबी amplicons (चित्रा 1C देखें) फ्रीज.

MJ4, उपप्रकार सी, संक्रामक आणविक क्लोन में 3 क्लोनिंग प्रवर्धित झूठ जीन

  1. 1.5 MJ4 प्लाज्मिड के माइक्रोग्राम और 50 डिग्री सेल्सियस (तालिका 5A देखें) पर 1.5 घंटे के लिए BclI (मेथिलिकरण संवेदनशील) प्रतिबंध endonuclease के साथ शुद्ध LTR- झूठ पीसीआर उत्पाद के 1.5 माइक्रोग्राम डाइजेस्ट.
  2. पाचन प्रतिक्रिया के लिए NgoMIV की 1 μl जोड़ें और 1 घंटे के लिए 37 डिग्री सेल्सियस पर सेते हैं.
  3. पहले से जानकारी के रूप में क्लोनिंग के लिए संकेत बैंड प्रतिक्रियाओं को पचाने प्रतिबंध को 5x लोडिंग डाई जोड़ें और धीरे धीरे 100 वी कल्पना, उत्पाद शुल्क में 1-2 घंटे के लिए एक डीएनए जेल दाग युक्त एक 1% agarose-tae जेल पर कुल मात्रा Electrophorese, और शुद्धribed (चित्रा 2 देखें).
  4. वेक्टर अनुपात 1 सम्मिलित: 3 में शुद्ध LTR- झूठ डालने और MJ4 वेक्टर डीएनए का उपयोग बंधाव प्रतिक्रियाओं तैयार करें. 4 डिग्री सेल्सियस पर रातोंरात बंधाव प्रतिक्रियाओं सेते हैं (तालिका 5 ब देखें).
  5. बंधाव उत्पादों के साथ JM109 रासायनिक सक्षम बैक्टीरिया रूपांतरण और 100 माइक्रोग्राम / एमएल एम्पीसिलीन के साथ लेग अगर प्लेटों पर फैला है और 22 + घंटे के लिए 30 डिग्री सेल्सियस हो जाना.
    1. 15 मिनट के लिए JM109 बर्फ पर सक्षम कोशिकाओं पिघलना. बर्फ पर 1.5 मिलीलीटर microcentrifuge ट्यूब और सर्द लेबल.
    2. JM109 कोशिकाओं की विभाज्य 50-100 μl पूर्व ठंडा करने के लिए 1.5 मिलीलीटर microcentrifuge ट्यूबों. हल्के से मिश्रण करने के लिए ट्यूब flicking और तुरंत बर्फ की ओर लौटने, JM109 कोशिकाओं को बंधाव प्रतिक्रिया की 2.5-5 μl जोड़ें. 30 मिनट के लिए बर्फ पर बंधाव उत्पाद के साथ सक्षम कोशिकाओं को सेते हैं.
    3. हीट सदमे JM109 सक्षम कोशिकाओं और 45 सेकंड के लिए एक 42 डिग्री सेल्सियस गर्मी ब्लॉक में बंधाव प्रतिक्रिया युक्त और कम से कम 3 मिनट के लिए बर्फ पर लौटने के 1.5 मिलीलीटर microcentrifuge ट्यूबों.
    4. प्रत्येक microcentrifuge ट्यूब समाज मीडिया के 50 μl जोड़ें और एम्पीसिलीन की 100 माइक्रोग्राम / एमएल के साथ पूरक कमरे के तापमान लेग अगर प्लेटों पर संपूर्ण परिवर्तन प्रतिक्रिया थाली.
    5. एक 30 डिग्री सेल्सियस इनक्यूबेटर पर स्थानांतरण प्लेटें और कालोनियों स्पष्ट रूप से बनते हैं 20 घंटे के लिए, या जब तक छोड़ दें.
  6. पृथक कालोनियों उठाओ और 22 + घंटे के लिए 30 डिग्री सेल्सियस पर 100 माइक्रोग्राम / एमएल एम्पीसिलीन के साथ लेग के 4 मिलीलीटर में हो जाना.
  7. , 15 मिनट के लिए 3200 XG पर संस्कृतियों स्पिन शोरबा टपकना, और प्लास्मिड डीएनए निकाल सकते हैं.
  8. निष्ठा क्लोनिंग की पुष्टि करने के लिए, 2 घंटे के लिए 37 डिग्री सेल्सियस पर पचाने एक डबल में NgoMIV और HpaI प्रतिबंध एंजाइमों के साथ Miniprep डीएनए काटा. 1% agarose-tae जेल पर विश्लेषण (तालिका 5C देखें).
  9. अनुक्रम निम्नलिखित प्राइमरों का उपयोग कर प्रत्येक प्लाज्मिड की लीटर झूठ डालने क्षेत्र: GagInnerF1, GagF2, Rev1, Rev3, और GagR6 (तालिका 6) अनुक्रम पहचान की पुष्टि करने के लिए.
  10. जनसंख्या दृश्यों डेर साथ प्राप्त क्लोन दृश्यों की तुलना1.5.1 से प्रारंभिक शुद्ध amplicon से ived. नोट: यह अंत में किसी भी इन विट्रो प्रतिकृति phenotypes क्लोनिंग की प्रक्रिया के दौरान शुरू की रीढ़ त्रुटियों की वजह से नहीं कर रहे हैं कि यह सुनिश्चित करने के क्रम में दो स्वतंत्र क्लोन की प्रतिकृति क्षमता का आकलन करने के लिए महत्वपूर्ण है.

प्रतिकृति सक्षम चुप-MJ4 काइमेरिक वायरस के 4 जनरेशन और Titering

  1. प्रिंस एट अल 39 द्वारा वर्णित के रूप में FuGENE एच.डी. की: 1 के अनुपात एक 4 का उपयोग 293T कोशिकाओं में काइमेरिक MJ4 प्लाज्मिड Miniprep डीएनए के 1.5 माइक्रोग्राम transfecting द्वारा प्रतिकृति सक्षम वायरस उत्पन्न करता है.
  2. अल 39 से नीचे और प्रिंस एट में वर्णित के रूप में TZM बीएल कोशिकाओं पर अनुमापांक काटा वायरस शेयरों.
    1. प्लेट TZM बीएल कोशिकाओं अगले दिन पर एक 30-40% मिला हुआ सेल monolayer के क्रम में वायरस के संक्रमण से पहले 24 घंटे. यह आमतौर पर एक 24 अच्छी तरह से थाली में अच्छी तरह से प्रति 800 μl की कुल मात्रा में 5 एक्स 10 4 कोशिकाओं को जोड़ने के द्वारा प्राप्त किया जा सकता है.
    2. अच्छी तरह से करने के लिए कोशिकाओं को जोड़ने के बाद, धीरे कुशलता कोशिकाओं को वितरित करने के क्रम में टीम के लिए तो, आगे और पीछे की ओर 24 अच्छी तरह से थाली चाल है. ज़ुल्फ़ कभी - इस प्लेट के केंद्र में जमते कोशिकाओं में परिणाम होगा.
    3. अगले दिन, DMEM में 1% FBS तैयार; इस DEAE-dextran को कमजोर करने और वायरस के शेयरों को कमजोर करने के लिए इस्तेमाल किया जाएगा. शेयर DEAE-dextran 10 मिलीग्राम / एमएल या 125x, और 80 माइक्रोग्राम / एमएल या 1x वांछित है की एक अंतिम एकाग्रता है.
    4. वायरस शेयर बाहर ले कमरे के तापमान पर पिघलना करने के लिए एक प्रकार के बरतन पर -80 डिग्री सेल्सियस फ्रीजर और जगह से परीक्षण किया.
    5. एक multichannel विंदुक का प्रयोग, क्रमानुसार एक दौर तली टिशू कल्चर में वायरस शेयरों पतला ढक्कन के साथ 96 अच्छी तरह से थाली इलाज किया. यह एक 3 गुना कमजोर पड़ने प्रोटोकॉल है. कमजोर पड़ने योजना के लिए तालिका 7 देखें.
    6. सुनिश्चित करें कि सेल monolayer परेशान करने के लिए नहीं कर रही एक निर्वात चूषित्र का उपयोग वरीयता प्राप्त TZM बीएल 24 अच्छी तरह प्लेटें से मीडिया निकालें. केवल एक बार में एक 24 अच्छी तरह से थाली से मीडिया को दूर कोशिकाओं करना इतना है किबाहर सूखी नहीं.
    7. प्रत्येक अच्छी तरह से एक 1000 μl विंदुक का उपयोग करने के लिए DMEM मिश्रण में 1x DEAE-dextran + 1% FBS की 150 μl जोड़ें. इस monolayer बाधित रूप में दोहराने पिपेट का उपयोग न करें.
    8. उचित अच्छी तरह से करने के लिए प्रत्येक वायरस के कमजोर पड़ने के 150 μl जोड़ें. अच्छी तरह से केंद्र के लिए वायरस जोड़ें और समान रूप से सेल monolayer भर में वायरस को वितरित करने के लिए धीरे ज़ुल्फ़. 37 डिग्री सेल्सियस पर एक टिशू कल्चर इनक्यूबेटर में 2 घंटे और 5% सीओ 2 के लिए संक्रमित कोशिकाओं को सेते हैं.
    9. 2 घंटा ऊष्मायन के बाद, अच्छी तरह से प्रत्येक के लिए DMEM में 0.5 मिलीलीटर 10% FBS जोड़ने के लिए और एक अतिरिक्त 48 घंटे के लिए इनक्यूबेटर प्लेटें लौटें.
    10. 48 घंटे बाद, कोशिकाओं 100% मिला हुआ होना चाहिए. MJ4 एक प्रतिकृति सक्षम वायरस है, क्योंकि वहाँ कुछ कोशिका मृत्यु हो, लेकिन यह उम्मीद की जा रही है होगा.
    11. प्रत्येक से मीडिया में अच्छी तरह से निकालें और 400 μl / अच्छी तरह समाधान (नुस्खा के लिए टेबल 8A देखें) फिक्सिंग के जोड़. एक समय में केवल एक प्लेट फिक्स. एक 1000 μl विंदुक का उपयोग कर समाधान फिक्सिंग जोड़ें, और 5 मिनट पर के लिए बैठते हैंकमरे के तापमान.
    12. फिक्सिंग समाधान निकालें और सीए 2 + / 2 मिलीग्राम + साथ पीबीएस के साथ 3x धो लो. धीरे monolayer में खलल न डालें से बचने के लिए अच्छी तरह से की ओर करने के लिए पीबीएस जोड़ने के लिए एक धारा निकलना बोतल का उपयोग करें. तीसरे धोने के बाद, शोषक कागज पर थाली शुष्क दाग.
    13. 400 μl / अच्छी तरह से 24 अच्छी तरह से थाली के प्रत्येक अच्छी तरह से धुंधला समाधान (नुस्खा के लिए टेबल 8B देखें), और कम से कम 2 घंटे के लिए 37 डिग्री सेल्सियस पर सेते जोड़ें. अब ऊष्मायन बार स्वीकार्य हैं, लेकिन ऊष्मायन बार titering प्रयोगों के बीच लगातार रखा जाना चाहिए.
    14. धो 2 + / 2 मिलीग्राम + क्षमताओं के साथ पीबीएस के साथ 2x और संक्रमण के लिए स्कोर, या बाद में स्कोरिंग के लिए 4 डिग्री सेल्सियस पर पीबीएस और दुकान में जोड़ें. प्लेटों के रूप में लंबे समय monolayer हाइड्रेटेड रखा है, ऊपर से चार दिनों के लिए 4 डिग्री सेल्सियस पर रखा जा सकता है.
    15. संक्रमण के लिए स्कोर करने के लिए, quadrants में 24 अच्छी तरह से थाली के कुओं को विभाजित करने के लिए एक स्थायी मार्कर का उपयोग करें. एक बार में, 200X की कुल बढ़ाई उपयोग कर, देखने के क्षेत्र के भीतर सभी नीले कोशिकाओं की गणनाएक अच्छी तरह से चार quadrants में से प्रत्येक.
    16. निम्नानुसार μl प्रति संक्रामक इकाइयों की गणना: / (वायरस गयी μl) = आइयू / μl [(# नीले कोशिकाओं / 4) 67 x]. अच्छी तरह से प्रत्येक के लिए जोड़ा वायरस की μl में मात्रा के लिए टेबल 8C का संदर्भ लें. टूटने कई कुओं एक साथ; संख्या एक सटीक अनुमापन के लिए अपेक्षाकृत समान होना चाहिए.

इन विट्रो प्रतिकृति परख के लिए संस्कृति, मीडिया और GXR25 कोशिकाओं के प्रसार की 5 तैयारी

  1. GXR25 कोशिकाओं के प्रसार के लिए पूरा RPMI (cRPMI) तैयार करें. नोट: यह कम से कम 4 महीने पहले योजना बनाई प्रतिकृति प्रयोगों के लिए संस्कृति GXR25 कोशिकाओं को अत्यंत महत्वपूर्ण है (तालिका 9 देखें).
  2. स्प्लिट कोशिकाओं 01:10 दो बार प्रति सप्ताह करने और बनाए रखने सेल घनत्व 6 से 10 एक्स 5-02 अक्टूबर एक्स 1 के बीच कोशिकाओं / एमएल.

GXR25 (यूके-CCR5-GFP) में चुप-MJ4 काइमेरा के इन विट्रो प्रतिकृति में 6 प्रकोष्ठों

  1. मैं पहले दिनवे संक्रमण के दिन पर लघुगणक विकास में कर रहे हैं कि इतने nfection, एक एकाग्रता के लिए 5 से 10 एक्स 2-3 के बीच कोशिकाओं / एमएल कोशिकाओं को विभाजित.
  2. संक्रमण के दिन, सी फ्रीजर और पिघलना ° -80 से वायरस शेयरों को हटा दें. सूत्र का उपयोग, 0.05 के संक्रमण की बहुलता पर 5 एक्स 10 5 GXR25 कोशिकाओं को संक्रमित करने के क्रम में TZM बीएल सेल परख से आइयू / μl अनुमापांक के आधार पर प्रत्येक शेयर से आवश्यक वायरस की मात्रा की गणना:
    संक्रमण (μl) के लिए वायरस का आयतन = 1 μl / एक्स आइयू x 0.05 x 500,000
    नोट: यह है कि हम परीक्षण किया है कि वायरस के सभी के लिए एक लघुगणक विकास के चरण में यह परिणाम के रूप में हम 0.05 के MOI चुना है. यह वायरस परीक्षण किया जा करने के लिए लघुगणक वृद्धि पर कब्जा करने के इष्टतम MOI निर्धारित करने के लिए प्रारंभिक प्रयोगों का संचालन करने के लिए महत्वपूर्ण है.
  3. और एक वी के नीचे टिशू कल्चर के एक कुएं में जोड़ने (एक 0.05 MOI प्राप्त करने के लिए) 100 μl की मात्रा को cRPMI में वायरस पतला 96 अच्छी तरह से थाली इलाज किया. नोट: एक स्थिति दोनों शामिलप्रतिकृति प्रयोगों के प्रत्येक सेट में (MJ4 गुम्मट संक्रमित) और एक नकारात्मक (नकली संक्रमित कोशिकाओं) नियंत्रण कर लिया है. हर दूसरे स्तंभ कुओं के बीच पार संदूषण सीमित करने के लिए रिक्त है कि इस तरह की थाली सेट करें. यह प्रयोगात्मक प्रतिकृति की प्रतिकृति दर का एक उपाय है जो प्रतिकृति ढलानों, सामान्य करने के लिए बाद में एक मानक के रूप में इस्तेमाल किया जाएगा के रूप में सकारात्मक नियंत्रण, आवश्यक है.
  4. एक स्वचालित सेल काउंटर का उपयोग GXR25 कोशिकाओं की गणना. सभी संक्रमणों (5 एक्स 10 5 एक्स # संक्रमण) के लिए कुल जरूरत कोशिकाओं की संख्या की गणना. एक 50 मिलीलीटर शंक्वाकार ट्यूब और गोली कोशिकाओं अपकेंद्रित्र में आवश्यक मात्रा विभाज्य. जरूरत से हमेशा 25% अधिक संक्रमण के लिए गणना.
  5. 5 x 10 5 कोशिकाओं / 100 μl की एकाग्रता में cRPMI में महाप्राण ध्यान से मीडिया और resuspend.
  6. एक बाँझ गर्त में पिपेट कोशिकाओं और मिश्रण अच्छी तरह से. एक मल्टी चैनल पिपेट का प्रयोग, पतला वायरस युक्त 96 अच्छी तरह से थाली में से प्रत्येक कुएं में कोशिकाओं के 100 μl जोड़ें. Miएक्स अच्छी तरह से.
  7. प्रत्येक के लिए polybrene की 5 मिलीग्राम / एमएल (100x) समाधान के 2 μl अच्छी तरह से जोड़ें और अच्छी तरह से कोशिकाओं मिश्रण.
  8. 3 घंटे के लिए 5% सीओ 2 के साथ टिशू कल्चर इनक्यूबेटर में 37 डिग्री सेल्सियस पर सेते हैं.
  9. संक्रमित कोशिकाओं को धोने के लिए आदेश में, अपकेंद्रित्र 96 अच्छी तरह से वी के नीचे प्लेट गोली कोशिकाओं. तो ध्यान से मध्यम के 150 μl हटाने और सेल गोली परेशान बिना cRPMI की ताजा 150 μl के साथ बदलें. पर्याप्त कोशिकाओं को धोने के लिए (centrifugation सहित) 2 अधिक बार दोहराएँ.
  10. पिछले centrifugation और 150 μl cRPMI के बाद इसके अलावा, एक multichannel विंदुक के साथ सेल गोली resuspend और एक 24 अच्छी तरह से ऊतक के एक कुएं में cRPMI के प्रत्येक अच्छी तरह से स्वतंत्र रूप से 800 μl से पूरे सेल / वायरस मिश्रण (लगभग 200 μl) जोड़ संस्कृति की थाली.
  11. 37 डिग्री सेल्सियस पर 5% सीओ 2 टिशू कल्चर इनक्यूबेटर में प्लेस थाली.
  12. हर दो दिन, संस्कृति की सतह से सतह पर तैरनेवाला के 100 μl अच्छी तरह से हटाने और एक 96 अच्छी तरह से यू के लिए स्थानांतरण-bottom थाली और दुकान वायरस quantitation परख चल रहा जब तक डिग्री सेल्सियस -80 पर जमे हुए. नोट: 96 अच्छी तरह प्लेटें में supernatants की सावधानी व्यवस्था एक radiolabeled रिवर्स ट्रांसक्रिपटेस (आरटी) परख के माध्यम से विरिअन मात्रा का ठहराव के दौरान संस्कृति supernatants की मल्टी चैनल पिपेट हस्तांतरण के लिए अनुमति देगा. हर थाली आरटी परख readout में परस्पर थाली भिन्नता को सामान्य करने के क्रम में एक संक्रमण मानक से नमूने शामिल करना चाहिए.
  13. अच्छी तरह से resuspending कोशिकाओं द्वारा 2 और शेष मात्रा (450 μl) के आधे से हटाने:, विभाजन कोशिकाओं 1 प्रत्येक 100 μl नमूना हटाने के बाद. अच्छी तरह से प्रत्येक के लिए ताजा cRPMI के 550 μl जोड़कर मूल मात्रा (1 मिलीलीटर) पुनर्स्थापित.

सेल संस्कृति supernatants में रिवर्स ट्रांसक्रिपटेस के 7 विश्लेषण (आरटी)

प्रोटोकॉल Ostrowski एट अल 40 से रूपांतरित किया.

  1. रेडियोधर्मी सामग्री के साथ प्रयोग के लिए एक बीएसएल -3 सुविधा में जैविक सुरक्षा हुड सेट करें.
    1. हू में शोषक कागज रखेंचूषित्र के लिए विकास और की जगह चूषित्र रेडियोधर्मी उपयोग के लिए नामित. नोट: सभी रेडियोधर्मी कचरे को ठीक से सुरक्षा नियमों के अनुसार के साथ निपटाया जाना चाहिए.
  2. आरटी मास्टर मिश्रण के प्रत्येक 1 मिलीलीटर विभाज्य [33 पी α-] dTTP के 10 एमसीआई / एमएल और 1 एम dithiothreitol (डीटीटी) के 4 μl के 1-2 μl जोड़ें (तालिका 10 और Ostrowski एट अल. 40 देखें).
  3. ध्यान से एक बाँझ गर्त करने के लिए एक 1000 μl विंदुक और हस्तांतरण के साथ आरटी मास्टर मिश्रण, डीटीटी, और [33 पी α-] dTTP के प्रत्येक 1.5 मिलीलीटर microcentrifuge ट्यूब मिश्रण.
  4. लेबल आरटी के 25 μl 96 अच्छी तरह पतली दीवारों पीसीआर थाली के प्रत्येक कुएं में मिश्रण बांटना. नोट: एक सकारात्मक नियंत्रण (MJ4 गुम्मट संक्रमण) और नकारात्मक नियंत्रण (नकली संक्रमण) के लिए अंतरिक्ष शामिल हैं.
  5. आरटी मास्टर मिश्रण युक्त पीसीआर थाली करने के लिए प्रत्येक सतह पर तैरनेवाला के 5 μl जोड़ें.
  6. चिपकने वाला पन्नी कवर के साथ पीसीआर थाली सील और एक thermocycler में 37 डिग्री सेल्सियस पर 2 घंटे के लिए सेते हैं. सुरक्षा कारणों के लिए, रिनएसई पिपेट Amphyl साथ सुझाव और बाद में रेडियोधर्मी कचरे में से निपटारा किया जाएगा जो Amphyl अपशिष्ट युक्त छोटे कंटेनर में टिप्स, के निपटान के.
  7. ऊष्मायन के बाद, एक 200 μl मल्टी चैनल पिपेट का उपयोग पन्नी कवर में छोटे छेद करते हैं. नोट: पिपेट सुझावों कुएं में तरल स्पर्श करते हैं, तो अगले स्तंभ या पंक्ति में जाने से पहले सुझावों की जगह.
  8. मिक्स नमूने 5x और de-81 पेपर के लिए प्रत्येक नमूने के हस्तांतरण 5 μl. एयर 10 मिनट के लिए सूखी.
  9. धो दाग 1x एसएससी (सोडियम क्लोराइड, सोडियम साइट्रेट) के साथ 5x, और धोने के प्रति 5 मिनट में 90% इथेनॉल के साथ फिर 2x. शुष्क हवा की अनुमति दें.
    1. दाग को कवर, और 5 मिनट के लिए मंथन करने के लिए पर्याप्त धोने बफर (1x एसएससी या 90% EtOH) जोड़ने के लिए, इस तरह के एक सैंडविच भंडारण बॉक्स के रूप में एक अलग धोने कंटेनर में प्रत्येक धब्बा रखें.
    2. अलग कंटेनर और दोहराने में धोने बफर डालो. नोट: पहले 3 washes रेडियोधर्मी माना जाता है और ठीक से निपटाया जाना चाहिए. पिछले 2 washes नियमित रूप से निपटाया जा सकता है.
  10. एक बार सूखा, कारefully सरन में दाग लपेटो और कमरे के तापमान पर रातोंरात एक कसकर मोहरबंद कैसेट में एक phosphoscreen को बेनकाब लपेटो.
  11. एक phosphorimager साथ phosphoscreens विश्लेषण और रेडियोधर्मी देखिए यों.
  12. OptiQuant सॉफ्टवेयर का उपयोग कर प्रत्येक रेडियोधर्मी संकेत के चारों ओर एक चक्र ड्रा. प्रतिकृति घटता उत्पन्न करने के लिए डिजिटल लाइट यूनिट (DLU) मूल्यों ग्राफ.
  13. प्रतिकृति क्षमता स्कोर उत्पन्न करने के लिए, DLU मूल्यों लॉग 10 -transformed थे और ढलानों 2, 4, और 6 समय बिंदुओं दिन का उपयोग कर की गणना की गई. प्रतिकृति ढलानों तो क्रम उत्पन्न प्रतिकृति क्षमता स्कोर में गुम्मट MJ4 की ढलान से विभाजित कर रहे हैं. यह इंट्रा परख परिवर्तनशीलता को कम करने के लिए एक ही आरटी थाली से प्राप्त MJ4 गुम्मट मूल्यों पर आधारित सामान्य करने के लिए महत्वपूर्ण है.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ठीक से पूरी तरह कार्यात्मक, संक्रामक चुप-MJ4 काइमेरा कोडांतरण में सक्षम एक proviral प्लाज्मिड बनाता है जो इस प्रोटोकॉल, अमल करने के लिए, महान देखभाल उचित पीसीआर amplicons उत्पन्न करने के लिए लिया जाना चाहिए. पीसीआर उचित आकार झूठ amplicon उत्पन्न किया है निर्धारित करने के लिए महत्वपूर्ण है. उत्पाद चित्रा 1 ए में दर्शाया लगभग 1,700 बीपी amplicon की 100 आधार जोड़े (बीपी) के भीतर होना चाहिए. इस टुकड़ा की सटीक लंबाई अध्ययन के तहत झूठ जीन के आधार पर अलग अलग होंगे. अगला, MJ4 आणविक क्लोन के 5 'लंबे टर्मिनल दोहराने (लीटर) भाग प्रवर्धित और बाद क्लोनिंग के लिए उपयुक्त बनाने के क्रम में ढकोसला amplicon को spliced ​​किया जाना चाहिए. MJ4 लीटर amplicon लंबाई में 1,474 बीपी होना चाहिए. चित्रा 1 बी सही बैंड आकार संकेत कर रहे हैं जिसके लिए एक प्रतिनिधि जेल छवि को दर्शाता है. ब्याह ओवरलैप विस्तार पीसीआर 41 के बाद, संयुक्त LTR- झूठ उत्पादों होना चाहिएचित्रा 1C में दर्शाया के रूप में लंबाई में लगभग 3,200 बीपी,.

झूठ जीन आवश्यक NgoMIV प्रतिबंध साइट जिसमें MJ4 से 5 'लीटर, वेक्टर और झूठ डालने दोनों को संलयन से क्लोनिंग के लिए उपयुक्त बना दिया गया है एक बार NgoMIV और BclI प्रतिबंध एंजाइमों के साथ पचा और electrophoretic के बाद एक agarose जेल से excised किया जाना चाहिए जुदाई. यह उचित वेक्टर और डालने बैंड आबकारी करने के लिए आवश्यक है. एक प्रतिनिधि जेल चित्रा 2 में दिखाया गया है. प्रतिबंध साइटों के चरम छोर पर स्थित हैं LTR- झूठ डालने, लंबाई में लगभग 3,000 बीपी रहना चाहिए जबकि MJ4 प्लाज्मिड के वेक्टर भाग, लंबाई में लगभग 10,000 बीपी होना चाहिए amplicon. आकार में कोई उल्लेखनीय कमी अध्ययन के तहत झूठ जीन के भीतर एक अतिरिक्त कटौती साइट का संकेत होगा.

दो टुकड़े के ligation के बाद, जीवाणु परिवर्तन, एकएन डी प्लास्मिड डीएनए के अलगाव, झूठ बोलना-MJ4 काइमेरा एक डबल NgoMIV और HpaI प्रतिबंध एंजाइमों के साथ पचाने प्रदर्शन से उपयुक्त आकार के लिए जाँच की जानी चाहिए. पूर्ण लंबाई लगभग 8,700 और 4,300 बीपी के दो बैंड के साथ चित्रा 3 में दर्शाया है कि इसी तरह एक प्रतिबंध पैटर्न होना चाहिए बैक्टीरियल प्रतिकृति के दौरान किसी भी हटाए जाने की घटनाओं किए गए नहीं है कि झूठ बोलना-MJ4 काइमेरा.

पिछले दृष्टिकोण की तुलना में इस प्रोटोकॉल की एक महत्वपूर्ण अंतर, एचआईवी -1 उप प्रकार सी संक्रामक आणविक क्लोन, MJ4, बल्कि अधिक से अधिक आम प्रयोगशाला अनुकूलित NL4-3 वायरस का इस्तेमाल होता है. हालांकि, पिछले अनुभाग में वर्णित दृष्टिकोण pNL4-3 में उप प्रकार बी झूठ दृश्यों की क्लोनिंग के लिए संशोधित किया जा सकता है.

बाद के प्रयोगों में इस्तेमाल के लिए संक्रमण (MOI) की बहुलता के एक अनुकूलन परीक्षण वायरस के बहुमत के लघुगणक वृद्धि से पता चला है कि आदर्श MOI का चयन करने के क्रम में प्रदर्शन किया गया था.चित्रा 4 प्रतिनिधि प्रतिकृति MJ4 (चित्रा -4 ए) के लिए तीन अलग Mois (0.01, 0.05, और 0.25) से घटता है और साथ ही NL4.3 (4B चित्रा) के लिए दर्शाया गया है. NL4-3 नकल के लिए एक MOI उपयुक्त संभावना कुशल MJ4 प्रतिकृति का पता लगाने के लिए भी कम होगा MJ4, खाते में लेने के लिए महत्वपूर्ण है जो NL4-3, से GXR25 कोशिकाओं में बहुत कम कुशलता replicates. चित्रा -4 ए, 0.01 या 0.25 विरोध के रूप में 0.05 के MOI में देखा लघुगणक विकास MJ4 के लिए दिन 2-6 के बीच मनाया गया, क्योंकि, आदर्श विकल्प था. कम MOI, 0.01 के लिए, सुबह 6 DLU मूल्यों मुश्किल से detectable हैं, और हम MJ4 से कम दोहराया कि झूठ बोलना-MJ4 काइमेरिक वायरस की पीढ़ी प्रत्याशित. इसलिए इस MOI भी सबसे biologically महत्वपूर्ण हो सकता है जो अधिक तनु चुप-MJ4 काइमेरा, के विकास पर कब्जा नहीं होगा. वायरल प्रतिकृति का तेजी से कैनेटीक्स एक पर्याप्त amou मार डाला क्योंकि इसके अतिरिक्त, 0.25 के MOI, आदर्श नहीं थायहां तक ​​कि सुबह 4 यह द्वारा कोशिकाओं की NT पठार के लिए प्रतिकृति की अवस्था का कारण बनता है, और इस जैसे एक वक्र के आधार पर एक ढलान की गणना प्रतिकृति क्षमता को नजरअंदाज करेंगे. यहां तक ​​कि 0.01 के MOI में, NL4-3 के लिए उत्पन्न घटता के आधार पर उपलब्ध सेल लक्ष्य काफ़ी दिन 6 के बाद संक्रमण से समाप्त हो चुकी है. अंत में, 0.05 के MOI विविध चुप दृश्यों और नकल की डिग्री अलग था, जो सभी के लिए झूठ बोलना-MJ4 काइमेरिक वायरस की एक बड़ी पैनल के लिए इष्टतम हो पाया था.

तीव्र उप प्रकार सी चुप दृश्यों से ली गई 149 चुप-MJ4 काइमेरिक वायरस की कुल इस परख का उपयोग कर इन विट्रो नकल के लिए परीक्षण किया गया है. सामान्यीकृत आर.सी. मूल्यों जंगली प्रकार MJ4 से अधिक कुशलता से 100 से अधिक बार नकल कुछ वायरस के साथ 3.5 ओवर करने के लिए 0.01 से लेकर. 5 लाल रंग में दर्शाया जंगली प्रकार MJ4 साथ नौ प्रतिनिधि चुप-MJ4 काइमेरिक वायरस से प्रतिकृति घटता, पता चलता है, और प्रतिकृति सी की व्यापक रेंज को दर्शाता हैapacities मनाया. इस प्रकार, अकेले झूठ जीन के भीतर अनुक्रम विविधता काफी विट्रो में दोहराने के लिए वायरस की क्षमता को प्रभावित कर सकता. इस तीव्रता से संक्रमित Zambians से व्युत्पन्न चुप-MJ4 काइमेरिक वायरस का प्रतिनिधि है, वहीं अन्य उप प्रकार सी दृश्यों बड़े पैमाने पर परीक्षण नहीं किया गया है, और विभिन्न प्रतिकृति कैनेटीक्स प्रदर्शन कर सकते हैं. विभिन्न एचआईवी -1 अनिवार्य जरूरतों और झूठ आइसोलेट्स के बीच प्रतिकृति के स्तर में एक विस्तृत श्रृंखला हो सकती है क्योंकि इसलिए, महान देखभाल, एक विशेष अध्ययन के वायरस की विशिष्ट प्रतिकृति के अनुरूप करने के लिए MOI अनुकूलन करने के लिए लिया जाना चाहिए.

ऐसे MJ4 की प्रतिकृति का समर्थन करता है कि GXR25 सेल लाइन के रूप में एक टी सेल लाइन का उपयोग कर के लाभ में से एक, reproducibility के स्तर लक्ष्य के रूप में परिधीय रक्त कोशिकाओं mononuclear प्रेरित का उपयोग प्रतिकृति प्रयोगों के सापेक्ष मनाया जाता है. प्रारंभिक अनुकूलन प्रयोगों में, MJ4 जंगली प्रकार 8.7% की एक अंतर परख परिवर्तनशीलता का प्रदर्शन किया, और विभिन्न8.5% की प्रतिकृति में एक ही चुप-MJ4 काइमेरिक वायरस का प्रदर्शन परिवर्तनशीलता के NT क्लोन. अलग मास्टर घोला जा सकता है और phosphoscreen जोखिम परिमाण में थोड़ा भिन्न होते हैं कि DLU मूल्यों दे सकता है, इंट्रा परख परिवर्तनशीलता आगे प्रत्येक आरटी परख थाली में (हमारे मामले जंगली प्रकार MJ4 में) एक ही वायरस मानक चलाकर नियंत्रित किया जा सकता है. चित्रा 6 रेखांकन DLU मूल्यों आठ अलग आरटी प्लेटों में मात्रा निर्धारित है, उसी MJ4 संक्रमण से निकाली गई. Assays के बीच संकेत परिमाण में इन मामूली परिवर्तन से प्रेरित संभावित त्रुटि को कम करने में मदद कर सकते हैं सभी आरटी assays के लिए आम है कि एक वायरस के लिए सामान्य.

इंटर परख अस्थायित्व से भी परीक्षण किया गया था और अत्यधिक सहसंबद्ध थे अलग अलग दिनों पर दोहराया replicates. लगभग एक साल अलग प्रदर्शन किया दो स्वतंत्र प्रयोगों से 7 भूखंडों सामान्यीकृत आर सी स्कोर मूल्यों चित्रा. प्रमुख outliers की अनुपस्थिति (आर 2 = 0.873) के साथ संबंध के एक उच्च डिग्री betw मनाया गयादो स्वतंत्र प्रतिकृति een.

अत्यधिक सहसंबद्ध हालांकि, दो स्वतंत्र प्रयोगों के बीच प्रतिकृति कैनेटीक्स के समग्र परिमाण में कुछ परिवर्तनशीलता है. यह एक प्रयोग में इस्तेमाल किया GXR25 कोशिकाओं शेयरों के बीच पारित होने संख्या में अंतर के हिस्से में जिम्मेदार ठहराया जा सकता है. सामान्य में, 6 महीने से अधिक समय की अवधि के लिए passaged गया है कि GXR25 कोशिकाओं शेयरों चुप-MJ4 काइमेरा के अधिक कुशल प्रतिकृति का समर्थन करते हैं. इसलिए, यह एक एक महीने की समय सीमा के भीतर काइमेरा के समूहों के बीच प्रतिकृति क्षमता का आकलन करने के लिए सलाह दी जाती है. पिछले चरणों बारीकी से पीछा कर रहे हैं, इस परख के अध्ययन की एक विस्तृत श्रृंखला के लिए लागू कर रहे हैं जो बेहद मजबूत और प्रतिलिपि प्रस्तुत करने योग्य परिणामों, उत्पादन में सक्षम है.

चित्रा 1
चित्रा 1 प्रतिनिधि जेल imagपीसीआर उत्पादों की electrophoretic जुदाई चित्रण तों. सभी पीसीआर उत्पादों के लिए, प्रत्येक 50 μl प्रतिक्रिया के 5 μl 1X SYBR सुरक्षित डीएनए जेल दाग के साथ पूरक एक 1% agarose-tae जेल में भरी हुई, 5x लोडिंग डाई के 3 μl के साथ मिलाया गया था, और 45 मिनट के लिए 120 वी पर वैद्युतकणसंचलन द्वारा अलग. Promega 1 केबी डीएनए सीढ़ी (लेन 1) amplicon आकार. ए) झूठ जीन एक नेस्टेड पीसीआर दृष्टिकोण का उपयोग वायरल शाही सेना से परिलक्षित किया गया था लगभग करने के लिए इस्तेमाल किया गया था. सम्मिलन और विलोपन के कारण, झूठ amplicon लंबाई में 1,600-1,700 बीपी से भिन्न हो सकते हैं और 1,500 बीपी डीएनए सीढ़ी मार्कर से थोड़ा ऊपर दिखाई देता है. लेन 2-5 MJ4 के 5 'लीटर जंगली प्रकार MJ4 प्लाज्मिड से परिलक्षित और electrophoretic जुदाई के माध्यम से कल्पना की गई थी. बी) सफल धोखा जीन प्रवर्धन को दर्शाती है. लेन 2-5 1,500 बीपी डीएनए सीढ़ी मार्कर. सी) 5R नीचे थोड़ा दिखाई देता है, जो 1,474 बीपी लीटर उत्पाद, के सफल प्रवर्धन दर्शाती17; लीटर जंगली प्रकार MJ4 से ली गई है और रोगी प्लाज्मा से परिलक्षित झूठ जीन ब्याह ओवरलैप विस्तार पीसीआर के माध्यम से आपस में जुड़े हुए और electrophoretic जुदाई के माध्यम से दिखाए जा रहे हैं. लेन 2-5 दर्शाती सफलतापूर्वक आकार में लगभग 3,200 बीपी हैं कि amplicons जुड़े हुए हैं, और जो थोड़ा 3,000 बीपी डीएनए सीढ़ी मार्कर ऊपर दिखाई देते हैं.

चित्रा 2
प्रतिबंध के चित्रा 2 प्रतिनिधि जेल छवि चित्रण electrophoretic जुदाई MJ4 में रोगी झूठ जीन क्लोनिंग के लिए हज़म. जंगली प्रकार MJ4 प्लाज्मिड और LTR- झूठ संलयन उत्पादों 37 डिग्री पर 1 घंटे के लिए 50 डिग्री सेल्सियस और NgoMIV पर 1.5 घंटे के लिए BclI साथ पचा गया सी वेक्टर और डालने टुकड़े 1X SYBR सुरक्षित डीएनए जी के साथ पूरक एक 1% agarose-tae जेल पर electrophoretic जुदाई के माध्यम से कल्पना थेएल 2 घंटे के लिए 100 वी पर दाग और यूवी प्रेरित डीएनए की क्षति को कम करने के क्रम में एक नीले प्रकाश प्रकाशक का उपयोग. बाद क्लोनिंग के चरणों के लिए उपयुक्त वेक्टर और डालने टुकड़े पर लगभग 10,000 बीपी और क्रमशः 2,900 बीपी दिखाई देते हैं.

चित्रा 3
चित्रा शुद्ध चुप-MJ4 कल्पना प्लास्मिड डीएनए का प्रतिबंध हज़म के electrophoretic जुदाई चित्रण 3 प्रतिनिधि जेल छवि. शुद्ध चुप-MJ4 कल्पना प्लास्मिड डीएनए NgoMIV साथ डबल पचा था और HpaI प्रतिबंध 37 डिग्री सेल्सियस पर 2 घंटे के लिए एंजाइमों. प्रतिबंध हज़म 45 मिनट के लिए 120 वी पर 1X SYBR सुरक्षित डीएनए जेल दाग के साथ पूरक एक 1% agarose-tae जेल पर electrophoretic जुदाई के माध्यम से कल्पना थे. बड़े हटाए बिना प्लास्मिड लगभग 8,700 और 4,300 बीपी पर दो अलग बैंड को हल करेंगे.


MJ4 और NL4-3 की चित्रा 4 प्रतिकृति संक्रमण के विभिन्न multiplicities पर GXR25 सेल लाइन (MOI) में एचआईवी -1 के आइसोलेट्स. 5 गुना की MOI में वृद्धि के साथ विधि प्रोटोकॉल में वर्णित के रूप में 5 एक्स 10 5 GXR25 कोशिकाओं संक्रमित थे प्रत्येक वायरस शेयर. Supernatants दिन 2, 4, 6 पर एकत्र किए गए थे, और 8 के बाद संक्रमण और विरिअन उत्पादन एक radiolabeled रिवर्स ट्रांसक्रिपटेस परख के माध्यम से मात्रा निर्धारित किया गया था. संक्रमण तीन प्रतियों में चलाए जा रहे थे और त्रुटि सलाखों तीन प्रतिकृति के लिए मानक विचलन निरूपित. (ए) MJ4 (बी) NL4-3.

चित्रा 5
चित्रा अलग चुप-MJ4 काइमेरा के लिए प्रतिकृति के 5 प्रतिनिधि रेंज. 5 GXR25 कोशिकाओं 0.05 के MOI में जंगली प्रकार MJ4 या चुप-MJ4 काइमेरा से संक्रमित थे, supernatants के बाद संक्रमण दो दिन के अंतराल पर एकत्र किए गए थे, और विरिअन उत्पादन एक radiolabeled द्वारा मात्रा आर टी परख. विभिन्न उप प्रकार सी व्युत्पन्न झूठ जीन का निवेशन MJ4 की प्रतिकृति क्षमता पर एक नाटकीय प्रभाव हो सकता है. जंगली प्रकार MJ4 प्रतिकृति लाल रंग में चिह्नित है.

चित्रा 6
Radiolabeled रिवर्स ट्रांसक्रिपटेस (आरटी) मात्रा का ठहराव परख. में इंट्रा परख भिन्नता के 6 चित्रा तुलना ग्राफ आठ अलग आरटी परख में एक भी जंगली प्रकार MJ4 संक्रमण से एक ही supernatants की DLU मूल्यों की साजिश रचने के द्वारा निहित इंट्रा परख परिवर्तनशीलता दर्शाया गया है प्लेटें. घटता में बदलाव के संकेत परिमाण शर्त में मामूली परिवर्तन को दर्शाता हैबाद में एक ही थाली पर assayed चुप-MJ4 काइमेरा की ढलानों को सामान्य करने के लिए इस्तेमाल किया जा सकता है जो प्रत्येक आरटी थाली, पर एक मानक चलाकर लिए सुधारा जा सकता है जो समझना प्लेटें,.

चित्रा 7
चित्रा GXR25 सेल लाइन में समय के साथ प्रतिकृति परख की 7 reproducibility. एक ही चुप-MJ4 काइमेरिक वायरस दो स्वतंत्र प्रयोगों में GXR25 कोशिकाओं को संक्रमित करने के लिए इस्तेमाल किया गया एक साल के अलावा लगभग प्रदर्शन किया. प्रतिकृति स्कोर लॉग तब्दील DLU मूल्यों के ढलान की गणना और जंगली प्रकार MJ4 तक कि ढलान सामान्य से उत्पन्न थे. जंगली प्रकार MJ4 से अधिक कुशलता को दोहराने कि झूठ बोलना-MJ4 काइमेरा 1 से अधिक प्रतिकृति स्कोर है, और जंगली प्रकार MJ4 से कम कुशलता को दोहराने कि उन (दो स्वतंत्र माप जोरदार सहसंबद्ध होते हैं कम 1 से प्रतिकृति स्कोर हैआर 2 = 0.87, रेखीय प्रतिगमन) और अलग अलग समय पर और अलग मार्ग पर कोशिकाओं के साथ प्रदर्शन assays के reproducibility पर प्रकाश डाला.

ए)

अभिकर्मक 1x प्रतिक्रिया के लिए वॉल्यूम (μl)
2x प्रतिक्रिया मिश्रण (Invitrogen) 25
Nuclease मुक्त एच 2 17
आगे प्राइमर GOF (20 माइक्रोन एकाग्रता) 1
रिवर्स प्राइमर VifOR (20 माइक्रोन एकाग्रता) 1
सुपरस्क्रिप्ट III एक कदम एनजाइम मिक्स 1
शाही सेना टेम्पलेट 5
कुल मात्रा 50

बी)

चक्रों की संख्या समय (घंटा: मिनट: सेकंड) तापमान (डिग्री सेल्सियस)
1 01:00:00 50
1 02:00 94
10 00:15 94
00:30 56
05:00 68
40 00:15 94
00:30 56
05:00 5 सेकंड / चक्र 68
1 00:00 68
1 4
अंत

तालिका 1 ए) के मास्टर मिश्रण और बी) झूठ प्रवर्धन के लिए मजबूत> thermocycler शर्तों. * नोट: GOF प्राइमर अनुक्रम: 5'-ATTTGACTAGCGGAGGCTAGAA -3 '. VifOR प्राइमर अनुक्रम: 5'-TTCTACGGAGACTCCATGACCC -3 '.

ए)

अभिकर्मक 1x प्रतिक्रिया के लिए वॉल्यूम (μl)
Nuclease मुक्त एच 2 35.5
5x Phusion HF बफर 10
dNTPs (40 मिमी deoxynucleotides) 1
आगे प्राइमर GagInnerF1 (20 माइक्रोन एकाग्रता) 1
रिवर्स प्राइमर BclIDegRev2 (20 माइक्रोन एकाग्रता) 1
Phusion गर्म प्रारंभ द्वितीय पोलीमरेज़ 0.5
टेम्पलेट के रूप में पहले दौर पीसीआर 1
कुल मात्रा 50

बी)

चक्रों की संख्या समय (घंटा: मिनट: सेकंड) तापमान (डिग्री सेल्सियस)
1 00:30 98
29 00:10 98
00:30 53
01:00 72
1 10:00 72
1 4
अंत

तालिका 2 ए) मास्टर मिश्रण और बी) नेस्टेड दूसरे राउंड झूठ प्रवर्धन के लिए thermocycler शर्तों. * एनOTE: GagInnerF1 प्राइमर अनुक्रम: 5'-AGGCTAGAAGGAGAGAGATG -3 '. BclIDegRev2 प्राइमर अनुक्रम: 5'-AGTATTTGATCATAYTGYYTYACTTTR -3 '.

ए)

अभिकर्मक 1x प्रतिक्रिया के लिए वॉल्यूम (μl)
Nuclease मुक्त एच 2 35.5
5x Phusion HF बफर 10
dNTPs (40 मिमी deoxynucleotides) 1
आगे प्राइमर MJ4For1b (20 माइक्रोन एकाग्रता) 1
रिवर्स प्राइमर MJ4Rev (20 माइक्रोन एकाग्रता) 1
Phusion गर्म प्रारंभ द्वितीय पोलीमरेज़ 0.5
MJ4 प्लाज्मिड के रूप में टेम्पलेट (10 एनजी / उल) 1
कुल मात्रा 50

बी)

चक्रों की संख्या समय (घंटा: मिनट: सेकंड) तापमान (डिग्री सेल्सियस)
1 00:30 98
29 00:10 98
00:30 58
00:45 72
1 10:00 72
1 4
अंत

तालिका 3 ए) मास्टर मिश्रण और बी) 5 'MJ4 लीटर प्रवर्धन के लिए thermocycler शर्तों. * नोट: MJ4For1b प्राइमर अनुक्रम: 5'-CGAAATCGGCAAAATCCC -3 '. MJ4Rev प्राइमर अनुक्रम: 5 '-CCCATCTCTCTCCTTCTAGC -3 '.

ए)

अभिकर्मक 1x प्रतिक्रिया के लिए वॉल्यूम (μl)
Nuclease मुक्त एच 2 34.5
5x Phusion HF बफर 10
dNTPs (40 मिमी deoxynucleotides) 1
आगे प्राइमर MJ4For1b (20 माइक्रोन एकाग्रता) 1
रिवर्स प्राइमर BclIRev (20 माइक्रोन एकाग्रता) 1
MJ4 लीटर 1.3 केबी amplicon (जेल शुद्ध, ~ 50 एनजी) 1
Phusion गर्म प्रारंभ द्वितीय पोलीमरेज़ 0.5
चुप amplicon (जेल शुद्ध, ~ 100 एनजी) 1
कुल मात्रा 50

बी)

चक्रों की संख्या समय (घंटा: मिनट: सेकंड) तापमान (डिग्री सेल्सियस)
1 00:30 98
29 00:10 98
00:30 58
01:30 72
1 10:00 72
1 4
अंत

तालिका 4 ए) मास्टर मिश्रण और बी) ब्याह ओवरलैप विस्तार पीसीआर के लिए thermocycler शर्तों LTR- झूठ सम्मिलित उत्पन्न करने के लिए. * नोट: BclIRev प्राइमर अनुक्रम: 5'-TCTATAAGTATTTGATCATACTGTCTT -3 '

ए)

अभिकर्मक 1x प्रतिक्रिया के लिए वॉल्यूम (μl) ऊष्मायन समय (मानव संसाधन) ऊष्मायन तापमान (डिग्री सेल्सियस)
3 KB LTR- झूठ amplicon या MJ4 प्लाज्मिड के 1.5 माइक्रोग्राम 1.5 माइक्रोग्राम के लिए एक्स μl
चंचु CutSmart बफर (पहले चोंच बफर # 4) 2
BclI प्रतिबंध एंजाइम 1
Nuclease मुक्त एच 2 X
कुल मात्रा 19 1.5 50
NgoMIV प्रतिबंध एंजाइम 1
कुल मात्रा 20 1 37

बी)

अभिकर्मक 1x प्रतिक्रिया के लिए वॉल्यूम (μl) ऊष्मायन समय (मानव संसाधन) ऊष्मायन तापमान (डिग्री सेल्सियस)
50 एनजी कटौती MJ4 प्लाज्मिड वेक्टर 50 एनजी के लिए एक्स μl
45 एनजी कटौती LTR- झूठ डालें (3: 1 के अनुपात) 45 एनजी के लिए एक्स μl
रॉश 10x ligase बफर 2
रॉश टी -4 डीएनए ligase (5 यू / μl) 1
Nuclease मुक्त एच 2
कुल मात्रा 20 18 + (रातोंरात) 4

सी)

अभिकर्मक 1x प्रतिक्रिया के लिए वॉल्यूम (μl) ऊष्मायन समय (मानव संसाधन) ऊष्मायन तापमान (डिग्री सेल्सियस)
झूठ बोलना-MJ4 प्लाज्मिड के 450 एनजी 450 एनजी के लिए एक्स μl
चंचु CutSmart बफर (पहले चोंच बफर # 4) 2
NgoMIV प्रतिबंध एंजाइम 0.5
HpaI प्रतिबंध एंजाइम 0.5
Nuclease मुक्त एच 2X
कुल मात्रा 20 2 37

सारणी 5 ए) प्रतिबंध मास्टर मिश्रण और बी) चुप-MJ4 क्लोनिंग निष्ठा सुनिश्चित करने के लिए झूठ बोलना-MJ4 काइमेरिक provirus. सी) निदान प्रतिबंध डाइजेस्ट की पीढ़ी के लिए बंधाव प्रतिक्रिया पचाने.

प्राइमर का नाम Nucleotide अनुक्रम (5 '- 3')
GagInnerF1 AGGCTAGAAGGAGAGAGATG
GagF2 GGGACATCAAGCAGCCAT
For3 CTAGGAAAAAGGGCTGTTGGAAATG
GagR6 CTGTATCATCTGCTCCTG
Rev3 GACAGGGCTATACATTCTTACTAT
Rev1 AATTTTTCCAGCTCCCTGCTTGCCCA

झूठ बोलना-MJ4 काइमेरिक provirus के 5 'लीटर और झूठ अनुक्रम पहचान की पुष्टि करने के लिए आवश्यक अनुक्रमण प्राइमरों के 6 तालिका सूची.

खैर एक DMEM में 8 μl वायरस + 232 μl 1% FBS
खैर बी DMEM में अच्छी अ + 160 μl 1% FBS से 80 μl
खैर सी DMEM में अच्छी तरह से बी + 160 μl 1% FBS से 80 μl
खैर डी DMEM में अच्छी सी + 160 μl 1% FBS से 80 μl
खैर ई DMEM में अच्छी तरह से डी + 160 μl 1% FBS से 80 μl
खैर एफ DMEM में अच्छी तरह से ई + 160 μl 1% FBS से 80 μl

टेबल 7 कमजोर पड़ने योजना (3TZM बीएल कोशिकाओं पर संक्रामक वायरस titering के लिए) गुना.

ए)

अभिकर्मक वॉल्यूम
पीबीएस सीए 2 + या मिलीग्राम बिना 2 + 500 मिलीलीटर
Gluteraldehyde 4 मिलीलीटर
Formaldehyde 11 मिलीलीटर

* नोट: स्टोर 4 डिग्री सेल्सियस पर.

बी)

अभिकर्मक वॉल्यूम
पीबीएस सीए 2 + या मिलीग्राम बिना 2 + 4.75 मिलीग्राम
पोटेशियम ferricyanide (0.2 एम) 100 μl
पोटेशियम ferrocyanide (0.2 एम) 100 μl
मैग्नीशियम क्लोराइड (1 एम) 20 μl
एक्स लड़की (50 मिलीग्राम / एमएल) 40 μl

* नोट: ताजा करें और उपयोग करें जब तक प्रकाश से दूर की दुकान.


सी

मूल कमजोर पड़ने अच्छी तरह से एक बी सी डी एफ
वायरस (μl) की मात्रा 24 अच्छी तरह से थाली पंक्ति के कुओं में जोड़ा 5 1.6667 0.5556 0.1852 0.06173 0.02057

टेबल 8 ए) सी) संक्रामक इकाइयों / μl की गणना के लिए अच्छी तरह से प्रति गयी वायरस की मात्रा पर चुप-MJ4 काइमेरिक वायरस की titering के लिए मजबूत> धुंधला और बी) फिक्सिंग समाधान.

अभिकर्मक वॉल्यूम
भ्रूण गोजातीय सीरम (FBS), परिभाषित 55 मिलीलीटर
पेनिसिलिन, स्ट्रेप्टोमाइसिन, Glutamine (100x) 6 मिलीलीटर
HEPES बफर (1 एम) 6 मिलीलीटर

टेबल GXR25 कोशिकाओं के प्रसार के लिए पूरा RPMI मध्यम के लिए 9 पकाने की विधि.

अभिकर्मक वॉल्यूम (एमएल)
Nucleaseमुक्त एच 2 419.5
Tris सीएल, पीएच 7.8 (एम 1) 30
पोटेशियम क्लोराइड (1 एम) 37.5
मैग्नीशियम क्लोराइड (1 एम) 2.5
Nonidet पी 40 (10%) 5
EDTA (0.5 एम) 1.02
Polyadenylic एसिड, पोटेशियम नमक (2 मिलीग्राम / एमएल) 1.25
Oligo-DT प्राइमर (25 माइक्रोग्राम / एमएल) 3.25
कुल मात्रा 500

Radiolabeled रिवर्स ट्रांसक्रिपटेस परख मास्टर मिश्रण के लिए टेबल 10 पकाने की विधि. * नोट: स्टोर -20 डिग्री सेल्सियस पर 1 मिलीलीटर aliquots के रूप में.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

कारण लंबाई और इस प्रोटोकॉल के तकनीकी प्रकृति के काइमेरिक चुप-MJ4 plasmids के सफल निर्माण दोनों के लिए महत्वपूर्ण है और साथ ही वायरल प्रतिकृति क्षमता की मात्रा का ठहराव के लिए कर रहे हैं कि कई कदम उठाए हैं. इस प्रोटोकॉल में उल्लिखित MJ4 में विदेशी झूठ जीन की शुरूआत के लिए प्रतिबंध एंजाइम आधारित क्लोनिंग रणनीति पहले से इस्तेमाल किया पुनर्संयोजन आधारित तरीकों पर कई फायदे हैं हालांकि महत्वपूर्ण कदम ठीक पालन नहीं कर रहे हैं, प्रोटोकॉल तकनीकी रूप से चुनौतीपूर्ण हो सकता है.

सबसे पहले, यह डीसीएम और बांध डीएनए methylases कमी एक सक्षम बैक्टीरिया तनाव में उत्पन्न किया गया है कि MJ4 प्लास्मिड डीएनए का उपयोग करने के लिए जरूरी है. यह MJ4 रीढ़ में झूठ जीन क्लोन करने के लिए प्रयोग किया जाता है जो BclI प्रतिबंध endonuclease, के enzymatic गतिविधि के रूप में आवश्यक है बांध / डीसीएम मेथिलिकरण संवेदनशील है. JM110 और SCS110 (एक Enda नकारात्मक JM110 व्युत्पन्न) ई कोलाई उपभेदों एकunmethylated MJ4 प्लास्मिड डीएनए पैदा करने के लिए उपयुक्त हो. साथ ही, वेक्टर और डालने बैंड के छांटना के लिए, यह अत्यधिक एक नीले प्रकाश प्रकाशक दृश्य के लिए इस्तेमाल किया जा सिफारिश की है. यह यूवी तरंग दैर्ध्य पर निर्भर डीएनए की क्षति को कम करने और तेजी से क्लोनिंग दक्षता में वृद्धि होगी. एक नीले प्रकाश प्रकाशक उपलब्ध नहीं है, क्लोनिंग दक्षता SYBR सुरक्षित डीएनए जेल दाग के बजाय ethidium ब्रोमाइड के साथ डीएनए visualizing और यूवी जोखिम समय कम करके maximized जा सकता है.

अंत में, बड़े (> 10kb) और / या ऐसे MJ4 रूप रेट्रोवायरल plasmids के साथ आणविक क्लोनिंग परंपरागत कारणों की एक किस्म के लिए मुश्किल हो गया है. बड़े plasmids सक्षम जीवाणु उपभेदों 42 के परिवर्तन की क्षमता को कम करते हुए लंबे टर्मिनल दोहराने (लीटर) दृश्यों, रेट्रोवायरल जीनोम 43 के विलोपन के लिए अग्रणी बैक्टीरियल मेजबान के भीतर प्लास्मिड डीएनए की प्लाज्मिड और समझौता प्रतिकृति निष्ठा की स्थिरता को कम होते हैं जो रेट्रोवायरल सम्मिलित, ई का उपयोग करते समय इसके अतिरिक्त, MJ4 प्लाज्मिड की प्रतिकृति अधिक स्थिर है हमारे हाथ में DH5α तनाव खत्म कोलाई तनाव,. कारण प्लाज्मिड की अस्थिर प्रकृति के शुद्ध प्लाज्मिड उत्पादों को हमेशा प्रतिबंध एंजाइम पाचन द्वारा सही प्लाज्मिड आकार के लिए जाँच की जानी चाहिए; यहाँ, एक डबल 2 घंटे के लिए 37 डिग्री सेल्सियस पर NgoMIV और HpaI प्रतिबंध endonucleases के साथ पचा.

एक बार काइमेरिक चुप-MJ4 plasmids के सफल पीढ़ी पूरा किया गया है, वायरस 2 के अभिकर्मक के माध्यम से उत्पन्न होता हैएक संकेतक सेल लाइन, TZM बीएल कोशिकाओं, और प्रतिकृति क्षमता पर titered 93T कोशिकाओं, एक यूके आधारित टी सेल लाइन का उपयोग कर मापा जाता है. इन प्रतिकृति अध्ययन के लिए इस्तेमाल यूके आधारित GXR25 सेल लाइन एचआईवी -1 के CCR5 रेखा उपभेदों के प्रवेश और प्रतिकृति का समर्थन करने में सक्षम कुछ स्थापित टी सेल लाइनों में से एक है. यह मानव CCR5 37 के स्थिर अभिव्यक्ति की अनुमति के लिए रेट्रोवायरल पारगमन द्वारा हासिल किया गया है. इस सेल लाइन स्वाभाविक रूप से CXCR4 व्यक्त किया और इस तरह प्रयोगशाला अनुकूलित तनाव NL4-3 रूप CXCR4 रेखा एचआईवी -1, की प्रतिकृति का समर्थन करेंगे. हालांकि, क्रम में इस तरह के MJ4 के रूप में, GXR25 कोशिकाओं से पहले संक्रमण के लिए कोई कम से कम 4 महीने के लिए प्रचारित किया जाना चाहिए, CCR5 रेखा उपभेदों के कुशल प्रतिकृति का समर्थन करने के लिए. ठीक से passaged संस्कृतियों भी अप करने के लिए 1 वर्ष के लिए passaging के बाद प्रतिकृति का समर्थन कर सकते हैं. Passaging भर CCR5 रेखा प्रतिकृति की सावधानी से निगरानी सफल प्रयोगों के लिए आवश्यक है.

किसी भी तकनीक के साथ के रूप में, सीमाओं के समर्थक रहे हैंमाना जाना चाहिए कि tocol. कारण MJ4 प्लाज्मिड में प्रतिबंध साइटों के स्थान के रूप में अच्छी तरह से स्वाभाविक रूप से एचआईवी -1 वियोजन होने वाली में संरक्षित प्रतिबंध साइटों की उपलब्धता के लिए, 3 'बाहर का प्रतिबंध साइट, BclI, झूठ स्टॉप कोडोन से 137 nucleotides स्थित है. इस एक काइमेरिक प्रोटीज जीन उत्पन्न हालांकि, इस क्षेत्र में इस पलटन में संरक्षित 96.5% है, और हम मृत या दोषपूर्ण काइमेरिक वायरस के एक बहुतायत का पालन नहीं किया.

उप प्रकार सी व्युत्पन्न दृश्यों के साथ MJ4 उप प्रकार सी संक्रामक आणविक क्लोन का उपयोग कर के लाभ में से एक यह झूठ जीन और अलग उपप्रकार की रीढ़ वैक्टर के बीच suboptimal जीन बाँधना के जोखिम को कम कर देता है. वही उप प्रकार 31 के भीतर पाया, तब भी जब देश या क्षेत्र से एचआईवी -1 दृश्यों की क्लस्टरिंग द्वारा सबूत के रूप में हालांकि, भीतर क्लेड विविधता की एक निश्चित राशि मौजूद है. झूठ जीन der के बीच इस suboptimal बाँधना में योगदान कर सकता हैतीव्रता से संक्रमित Zambians और बोत्सवाना 38 से एक लंबे समय से संक्रमित व्यक्ति से निकाला गया था, जो MJ4 संक्रामक आणविक क्लोन रीढ़ से ived. हालांकि, विश्लेषण किया निर्माणों के बहुमत संक्रामक संतान वायरस का उत्पादन किया. के रूप में विभिन्न एचआईवी -1 उप प्रकार सी संक्रामक आणविक क्लोन अधिक व्यापक रूप से उपलब्ध हो जाते हैं, यह आगे की वजह से शुरू की एक न्यूनतम पूर्वाग्रह है कि यह सुनिश्चित करने के क्रम में अन्य अनिवार्य जरूरतों में इन एचआईवी -1 क्लेड सी झूठ जीन में क्लोनिंग द्वारा इस प्रणाली को मान्य करने के लिए महत्वपूर्ण होगा रीढ़ असंगतियां लिए.

GXR25 सेल लाइन विशेष रूप से की वजह से CXCR4 और CCR5 रेखा उपभेदों और उसके एचआईवी -1 inducible GFP संवाददाता 37 दोनों का समर्थन करने की क्षमता के लिए, एक अद्वितीय सेल लाइन है. हालांकि, कुछ सीमाओं मौजूद हैं और ध्यान से इस प्रोटोकॉल से अनुकूलित प्रयोगों के लिए इस सेल लाइन का उपयोग करने से पहले विचार किया जाना चाहिए. GXR25 सेल लाइन उप प्रकार सी या एक, CCR5 रेखा, पीआर के बहुमत के प्रवेश का समर्थन करने के लिए प्रकट नहीं होता हैimary हम परीक्षण किया है आइसोलेट्स. इसके अलावा, माता पिता यूके सेल लाइन जहाँ से GXR25 सेल लाइन दर्शाती 2 करने के लिए ऊपर cyclophilin एक के उच्च स्तर, निकाली थी Jurkat सेल लाइन 44 से अधिक अभिव्यक्ति 4 गुना. कारण cyclophilin एक के उच्च स्तर पर, प्रतिकृति दोष सामान्य रूप से cyclophilin एक बाँध को कैप्सिड की एक कम क्षमता के लिए जिम्मेदार ठहराया है जो विहित एचएलए बी * 57 जुड़े भागने उत्परिवर्तन, T242N, के साथ जुड़ा हुआ है, आसानी से इस विशेष सेल लाइन में नहीं पाया जा सकता 25. इस प्रकार यूके आधारित GXR25 सेल लाइन एचआईवी -1 कैप्सिड cyclophilin बाध्यकारी पाश में परिवर्तन के साथ जुड़े प्रतिकृति दोष के अध्ययन के लिए आदर्श नहीं है.

इस प्रोटोकॉल तीव्र समय बिंदुओं से व्युत्पन्न झूठ दृश्यों की प्रतिकृति क्षमता का विश्लेषण करने के लिए आदर्श है, जबकि अंत में, संशोधन लंबे समय से संक्रमित व्यक्तियों से व्युत्पन्न जीन झूठ की प्रतिकृति क्षमता का अध्ययन करने के क्रम में किया जाना चाहिए. इस प्रोटोकॉल AM शामिलवायरल विविधता सीमित है जब तीव्र समय बिंदुओं से जनसंख्या दृश्यों की plification (मंझला 45 दिनों के संक्रमण की तारीख अनुमान पोस्ट). प्रत्येक कल्पना से झूठ जीन तो अनुक्रम और निष्ठा क्लोनिंग सुनिश्चित करने के लिए प्रारंभिक आबादी पीसीआर amplicon की तुलना में है. कारण तीव्र समय बिंदुओं पर सीमित अनुक्रम विविधता, जनसंख्या पीसीआर उत्पादों से क्लोनिंग संभव है. हालांकि, अनुक्रम विविधता एक लंबे समय से संक्रमित व्यक्ति के वायरल quasispecies भीतर मौजूद है; इसलिए, सही ढंग से पुरानी quasispecies की प्रतिकृति क्षमता का आकलन करने के क्रम में, एकल जीनोम प्रवर्धन कई प्रतिनिधि वेरिएंट पर कब्जा करने के लिए नियोजित किया जाना चाहिए. इन वेरिएंट में से प्रत्येक तो इन विट्रो नकल के लिए assayed किया जाना चाहिए.

इस तकनीक मौजूदा तरीकों पर अपने फायदे से स्टेम जो कई व्यापक आवेदन किया है. इस प्रक्रिया में एक प्रतिरूप प्रतिकृति सक्षम प्लाज्मिड में परिणाम के बाद से, यह अतिरिक्त मीटर के लिए निर्माणों का उपयोग करने के लिए आसान हैवायरल प्रतिकृति को विशिष्ट अवशेषों के योगदान को स्पष्ट करने में मदद कर सकते हैं जो utagenesis पढ़ाई,. इसके अलावा, अनुदैर्ध्य समय बिंदुओं से झूठ जीन में क्लोनिंग से, एक समय के साथ वायरल प्रतिकृति क्षमता के विकास का आकलन कर सकते हैं और इन परिवर्तनों को एक एचआईवी -1 से संक्रमित व्यक्ति में रोगजनन कैसे प्रभावित कर सकता.

इस तकनीक को विभिन्न अनुप्रयोगों के लिए इसकी उपयोगिता का विस्तार करने के क्रम में संशोधित किया जा सकता है. अतिरिक्त एचआईवी -1 वायरल प्रोटीन वायरल प्रतिकृति या मेजबान प्रोटीन के साथ उनकी बातचीत पर उनके प्रभाव का आकलन करने के क्रम में MJ4 प्लाज्मिड में इंजीनियर हो सकता है. यह मूक न्यूक्लियोटाइड बदलाव की शुरूआत के माध्यम से जीनोम में वांछित क्षेत्रों में अतिरिक्त प्रतिबंध साइटों इंजीनियरिंग द्वारा पूरा किया जा सकता है. के रूप में कई सहायक प्रोटीन वैकल्पिक पढ़ने फ्रेम में इनकोड एचआईवी -1 जीनोम के 3 'आधे में उपन्यास प्रतिबंध साइटों, और एक में मूक परिवर्तन इंजीनियरिंग हालांकि, जब विशेष ध्यान रखा जाना चाहिएप्रोटीन एक और एमिनो एसिड प्रतिस्थापन के लिए ले जा सकता है. इस उदाहरण में, इस तरह के डुडले एट अल द्वारा चर्चा की उन के रूप में प्रतिबंध साइट स्वतंत्र क्लोनिंग तरीकों. 45 इस सीमा को पार कर सकता है. अलग आबादी से व्युत्पन्न वायरल दृश्यों प्रतिकृति क्षमता के अलग श्रेणियों के लिए हो सकता है, और MOI विकास के अपने लघुगणक चरण के भीतर वायरल आइसोलेट्स के बहुमत पर कब्जा करने के क्रम में अनुसार समायोजित किया जा सकता है. अंत में, GXR25 सेल लाइन stably एक लीटर संचालित है, जैसे-inducible प्रमोटर के तहत GFP साथ ट्रांसफ़ेक्ट किया गया है, और वायरल फैल यहाँ या वर्णित आरटी परख के लिए एक विकल्प के रूप में 37 प्रवाह cytometry के माध्यम से GFP सकारात्मक कोशिकाओं के एक समारोह के रूप में मापा जा सकता है एक पारंपरिक पी 24 एलिसा.

अंत में, इस प्रोटोकॉल उचित विरिअन गठन के लिए आवश्यक एक संरक्षित संरचनात्मक प्रोटीन encodes जो झूठ जीन, द्वारा प्रदत्त के रूप में एचआईवी -1 वायरल प्रतिकृति का आकलन करने के लिए एक कुशल और शक्तिशाली तकनीक प्रदान करता है, नवोदित, परिपक्वता, और disassembly 46-48. इसके अलावा, इस तकनीक का, इस प्रकार, mutagenesis के अध्ययन के लिए आदर्श है और जो एक प्रतिकृति सक्षम प्रतिरूप प्लाज्मिड उत्पन्न वायरल फिटनेस की विशिष्ट एमिनो एसिड निर्धारकों elucidating के लिए एक तरीका प्रदान करता है. जैसे कि इन अध्ययनों से प्रतिरक्षा संचालित वायरल विकास एचआईवी -1 से संक्रमित व्यक्तियों में रोगजनन और रोग प्रगति को प्रभावित करता है कि कैसे की समझ बढ़ाने के लिए जरूरी हैं.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
PCR Reagents
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagF2: 5' GGGACATCAAGCAGCCAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagR6: 5' CTGTATCATCTGCTCCTG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
CoolRack PCR 96 XT Biocision BCS-529
CoolRack M15 Biocision BCS-125
Nuclease free water Fisher SH30538FS Manufactured by Hyclone
QIAamp Viral RNA Mini Kit Qiagen 52906
Simport PCR 8 Strip Tubes, Blue (Flat Cap) Daigger EF3647BX
SuperScript III one-step RT-PCR system Life Technologies/Invitrogen 12574035
Phusion Hot-start II DNA polymerase Fisher F-549L
PCR Nucleotide Mix Roche 4638956001
Agarose, high gel strength Fisher 50-213-128
TAE 10X Life Technologies/Invitrogen AM9869
Promega 1 kb DNA ladder Fisher PRG5711 Manufactured by Promega
Sybr Safe DNA Gel Stain, 10,000x Life Technologies/Invitrogen S33102
Wizard SV Gel and PCR Clean-Up System Promega A9282
Razor blades, single-edged Fisher 12-640 Manufactured by Surgical Design
Thermocycler, PTC-200 MJ Research
Microbiology & Cloning Reagents
LB Agar, Miller Fisher BP1425-2
LB Broth, Lennox Fisher BP1427-2
Sterile 100 x 15 mm polystyrene Petri dishes Fisher 08-757-12
Ampicillin sodium salt Sigma-Aldrich A9518-5G
Falcon 14 ml Polypropylene round-bottom tubes BD Biosciences 352059
NgoMIV restriction endonuclease New England BioLabs R0564L
BclI restriction endonuclease New England BioLabs R0160L
HpaI restriction endonuclease New England BioLabs R0105L
T4 DNA Ligase, 5 U/μl Roche 10799009001
JM109 competent cells, >108 cfu/μg Promega L2001
PureYield plasmid miniprep system Promega A1222
Safe Imager 2.0 Blue Light Transilluminator Invitrogen G6600
Microfuge 18 centrifuge Beckman Coulter 367160
Cell Culture Reagents
Amphyl cleaner/disinfectant Fisher 22-030-394
Fugene HD, 1 ml VWR PAE2311 Manufactured by Promega
Hexadimethrine bromide (Polybrene) Sigma-Aldrich H9268-5G
Costar Plates, 6-well, flat Fisher 07-200-83 Manufactured by Corning Life
Costar Plates, 24-well, flat Fisher 07-200-84 Manufactured by Corning Life
Costar Plates, 96-well, round Fisher 07-200-95 Manufactured by Corning Life
Flasks, Corning filter top/canted neck, 75 cm2 Fisher 10-126-37
Flasks, Corning filter top/canted neck, 150 cm2 Fisher 10-126-34 Manufactured by Corning Life
Conical Tubes, 50 ml, blue cap Fisher 14-432-22 Manufactured by BD Biosciences
Conical Tubes, 15 ml, blue cap Fisher 14-959-70C Manufactured by BD Biosciences
Trypsin-EDTA Fisher MT25052CI Manufactured by Mediatech
RPMI, 500 ml Life Technologies/Invitrogen 11875-119
DMEM, 500 ml Life Technologies/Invitrogen 11965-118
Penicillin/Streptomycin/Glutamine, 100x Life Technologies/Invitrogen 10378-016
PBS with magnesium and calcium, 500 ml Life Technologies/Invitrogen 14040-133
PBS without magnesium and calcium Life Technologies/Invitrogen 20012-050
Sarstedt tubes, assorted colors Sarstedt 72.694.996
Reservoir Trays for Multichannel, 55 ml Fisher 13-681-501
DEAE-Dextran Fisher NC9691007
Corning 96 well clear V bottom tissue culture treated microplate Fisher 07-200-96 Manufactured by Corning Life
HEPES, 1 M Buffer Solution Life Technologies/Invitrogen 15630-080
FBS, Defined, 500 ml Fisher SH30070 03
X-gal VWR PAV3941 Manufactured by Promega
Glutaraldehyde, Grade II, 25% in H2O Sigma-Aldrich G6257-100ML
1 M Magnesium chloride solution Sigma-Aldrich M1028-100ML
Formaldehyde solution, for molecular biology, 36.5% Sigma-Aldrich F8775-500ML
Potassium hexacyanoferrate(II) trihydrate Sigma-Aldrich P9387-100G
Potassium hexacyanoferrate(III) Sigma-Aldrich P8131-100G
Allegra X15-R centrifuge Beckman Coulter 392932
TC10 automated cell counter Bio-Rad 1450001
VistaVision inverted microscope VWR
Reverse-Transcriptase Quantification Assay Reagents
dTTP, [α-33P]- 3000 Ci/mmol, 10 mCi/ml, 1 mCi Perkin-Elmer NEG605H001MC
1 M Tris-Cl, pH 8.0 Life Technologies/Invitrogen 15568025 Must be adjusted to pH 7.8 with KOH
2 M Potassium chloride (KCl) Life Technologies/Invitrogen AM9640G Adjust to 1 M solution
0.5 M EDTA Life Technologies/Invitrogen 15575-020
Nonidet P40 Roche 11333941103
Polyadenylic acid (Poly rA) potassium salt  Midland Reagent Co. P-3001
Oligo d(T) primer Life Technologies/Invitrogen 18418-012
Dithiothreitol (DTT) Sigma-Aldrich 43815-1G
SR, Super Resolution Phosphor Screen, Small Perkin-Elmer 7001485
Corning Costar Thermowell 96-well plate model (M) Polycarbonate Fisher 07-200-245 Manufactured by Corning Life
Corning 96-well Microplate Aluminum Sealing Tape, Nonsterile Fisher 07-200-684 Manufactured by Corning Life
DE-81 anion exchange paper Whatman 3658-915
Trisodium citrate dihydrate Sigma-Aldrich S1804-1KG
Sodium Chloride Fisher S671-3
Autoradiography cassette Fisher FB-CA-810
Cyclone storage phoshpor screen Packard

DOWNLOAD MATERIALS LIST

References

  1. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., Oldstone, M. B. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. Journal of virology. 68, 6103-6110 (1994).
  2. Koup, R. A., et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. Journal of virology. 68, 4650-4655 (1994).
  3. Jin, X., et al. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. The Journal of experimental medicine. 189, 991-998 (1999).
  4. Schmitz, J. E., et al. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science. 283, 857-860 (1999).
  5. Brumme, Z. L., et al. Marked epitope- and allele-specific differences in rates of mutation in human immunodeficiency type 1 (HIV-1) Gag, Pol, and Nef cytotoxic T-lymphocyte epitopes in acute/early HIV-1 infection. Journal of virology. 82, 9216-9227 (2008).
  6. Leslie, A. J., et al. HIV evolution: CTL escape mutation and reversion after transmission. Nature medicine. 10, 282-289 (2004).
  7. Phillips, R. E., et al. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature. 354, 453-459 (1991).
  8. Price, D. A., et al. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proceedings of the National Academy of Sciences of the United States of America. 94, 1890-1895 (1997).
  9. Goulder, P. J., et al. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nature. 3, 212-217 (1997).
  10. Tang, J., et al. Favorable and unfavorable HLA class I alleles and haplotypes in Zambians predominantly infected with clade C human immunodeficiency virus type 1. Journal of virology. 76, 8276-8284 (2002).
  11. Prentice, H. A., et al. HLA-B*57 versus HLA-B*81 in HIV-1 infection: slow and steady wins the race. Journal of virology. 87, 4043-4051 (2013).
  12. Migueles, S. A., et al. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proceedings of the National Academy of Sciences of the United States of America. 97, 2709-2714 (2000).
  13. Leslie, A., et al. Additive contribution of HLA class I alleles in the immune control of HIV-1 infection. Journal of virology. 84, 9879-9888 (2010).
  14. Kaslow, R. A., et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nature medicine. 2, 405-411 (1996).
  15. Altfeld, M., et al. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS. 17, 2581-2591 (2003).
  16. Kiepiela, P., et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nature medicine. 13, 46-53 (2007).
  17. Mothe, B., et al. Definition of the viral targets of protective HIV-1-specific T cell responses. Journal of translational medicine. 9, 208 (2011).
  18. Peyerl, F. W., Barouch, D. H., Letvin, N. L. Structural constraints on viral escape from HIV- and SIV-specific cytotoxic T-lymphocytes. Viral immunology. 17, 144-151 (2004).
  19. Rolland, M., et al. Broad and Gag-biased HIV-1 epitope repertoires are associated with lower viral loads. PloS one. 3, e1424 (2008).
  20. Wagner, R., et al. Molecular and functional analysis of a conserved CTL epitope in HIV-1 p24 recognized from a long-term nonprogressor: constraints on immune escape associated with targeting a sequence essential for viral replication. J Immunol. 162, 3727-3734 (1999).
  21. Wang, Y. E., et al. Protective HLA class I alleles that restrict acute-phase CD8+ T-cell responses are associated with viral escape mutations located in highly conserved regions of human immunodeficiency virus type 1. Journal of virology. 83, 1845-1855 (2009).
  22. Chopera, D. R., et al. Transmission of HIV-1 CTL escape variants provides HLA-mismatched recipients with a survival advantage. PLoS pathogens. 4, e1000033 (2008).
  23. Crawford, H., et al. Evolution of HLA-B*5703 HIV-1 escape mutations in HLA-B*5703-positive individuals and their transmission recipients. The Journal of experimental medicine. 206, 909-921 (2009).
  24. Boutwell, C. L., et al. Frequent and variable cytotoxic-T-lymphocyte escape-associated fitness costs in the human immunodeficiency virus type 1 subtype B Gag proteins. Journal of virology. 87, 3952-3965 (2013).
  25. Brockman, M. A., et al. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. Journal of virology. 81, 12608-12618 (2007).
  26. Crawford, H., et al. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. Journal of virology. 81, 8346-8351 (2007).
  27. Martinez-Picado, J., et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. Journal of virology. 80, 3617-3623 (2006).
  28. Schneidewind, A., et al. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. Journal of virology. 81, 12382-12393 (2007).
  29. Wright, J. K., et al. Impact of HLA-B*81-associated mutations in HIV-1 Gag on viral replication capacity. Journal of virology. 86, 3193-3199 (2012).
  30. Kawashima, Y., et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature. 458, 641-645 (2009).
  31. Goepfert, P. A., et al. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. The Journal of experimental medicine. 205, 1009-1017 (2008).
  32. Brockman, M. A., et al. Early selection in Gag by protective HLA alleles contributes to reduced HIV-1 replication capacity that may be largely compensated for in chronic infection. Journal of virology. 84, 11937-11949 (2010).
  33. Huang, K. H., et al. Progression to AIDS in South Africa is associated with both reverting and compensatory viral mutations. PloS one. 6, e19018 (2011).
  34. Wright, J. K., et al. Gag-protease-mediated replication capacity in HIV-1 subtype C chronic infection: associations with HLA type and clinical parameters. Journal of virology. 84, 10820-10831 (2010).
  35. Wright, J. K., et al. Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype. C. Journal of virology. 85, 3996-4006 (2011).
  36. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of virology. 59, 284-291 (1986).
  37. Brockman, M. A., Tanzi, G. O., Walker, B. D., Allen, T. M. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. Journal of virology. 131, 134-142 (2006).
  38. Ndung'u, T., Renjifo, B., Essex, M. Construction and analysis of an infectious human Immunodeficiency virus type 1 subtype C molecular clone. Journal of virology. 75, 4964-4972 (2001).
  39. Prince, J. L., et al. Role of transmitted Gag CTL polymorphisms in defining replicative capacity and early HIV-1 pathogenesis. PLoS pathogens. 8, e1003041 (2012).
  40. Ostrowski, M. A., Chun, T. W., Cheseboro, B., Stanley, S. K., Tremblay, M., et al. Detection assays for HIV proteins. Current protocols in immunology / edited by John E. Coligan ... [et al.]. 12, (Unit 12 15), Forthcoming.
  41. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, 61-68 (1989).
  42. Inoue, H., Nojima, H., Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene. 96, 23-28 (1990).
  43. Bichara, M., Pinet, I., Schumacher, S., Fuchs, R. P. Mechanisms of dinucleotide repeat instability in Escherichia coli. Genetics. 154, 533-542 (2000).
  44. Ackerson, B., Rey, O., Canon, J., Krogstad, P. Cells with high cyclophilin A content support replication of human immunodeficiency virus type 1 Gag mutants with decreased ability to incorporate cyclophilin A. Journal of virology. 72, 303-308 (1998).
  45. Dudley, D. M., et al. A novel yeast-based recombination method to clone and propagate diverse HIV-1 isolates. BioTechniques. 46, 458-467 (2009).
  46. Ganser-Pornillos, B. K., von Schwedler, U. K., Stray, K. M., Aiken, C., Sundquist, W. I. Assembly properties of the human immunodeficiency virus type 1 CA protein. Journal of virology. 78, 2545-2552 (2004).
  47. Forshey, B. M., von Schwedler, U., Sundquist, W. I., Aiken, C. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. Journal of virology. 76, 5667-5677 (2002).
  48. Gottlinger, H. G., Dorfman, T., Sodroski, J. G., Haseltine, W. A. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proceedings of the National Academy of Sciences of the United States of America. 88, 3195-3199 (1991).
एक प्रतिबंध एंजाइम आधारित क्लोनिंग विधि का आकलन करने के लिए<em&gt; इन विट्रो</em&gt; एचआईवी -1 उपप्रकार सी चुप-MJ4 काइमेरिक वायरस की प्रतिकृति क्षमता
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).More

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter