Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Un enzima di restrizione metodo basato clonazione per valutare l' doi: 10.3791/51506 Published: August 31, 2014
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Determinare l'host e le caratteristiche virali che influenzano HIV-1 patogenesi e nella progressione della malattia è fondamentale per la progettazione razionale di vaccini. La risposta immunitaria cellulare è un componente chiave della risposta immunitaria umana HIV-1. Linfociti T citotossici (CTL) sono necessari per il controllo iniziale della viremia acuta, e permettono l'host di stabilire uno stato di equilibrio (set point) carica virale 1,2. Deplezione sperimentale di queste cellule effettrici si traduce in perdita di controllo virale 3,4. Nonostante questo, sfuggono le mutazioni sorgono all'interno del genoma virale che sovvertire CTL riconoscimento delle cellule infettate da virus 5-9.

Alcuni alleli HLA sono stati associati con una carica virale inferiore e la progressione della malattia più lenta tra cui B * 57, B * 27 e B * 81 10-15. Parte del beneficio protettivo di alleli HLA di classe I può essere attribuito al fatto che esse mirano regioni funzionalmente vincolati del genoma come Gage selezionare per le mutazioni di fuga che riducono la capacità del virus di replicarsi in vitro 16-21. Sebbene fuga dal sistema immunitario cellulare è vantaggioso per il virus nel contesto della classe I allele HLA selezione, l'effetto di queste mutazioni può avere conseguenze differenziali per l'host dopo la trasmissione a un HLA-non corrispondenti individuale 22,23. Pertanto, la comprensione degli effetti delle mutazioni trasmesse fuga HLA-associato sulla capacità di replicazione virale sarà importante per migliorare la nostra comprensione dei primi HIV-1 patogenesi.

Sebbene siano stati compiuti molti progressi per identificare e caratterizzare i difetti di fitness di mutazioni di fuga individuali associati con particolare HLA di classe I alleli 24-29, naturalmente HIV-1 isolati sono impronte uniche e complesse di polimorfismi HLA-associato, probabilmente derivanti dalla HLA pressione immunitaria mediata di diversa provenienza immunogenetici 30. In apanalisi revious, Goepfert et al. ha dimostrato che un accumulo di mutazioni HLA-associati nelle sequenze Gag trasmessi derivate da 88 Zambians infezione acuta era associato ad una riduzione della carica virale set point 31. Questo suggerisce che la trasmissione di mutazioni deleterie di fuga, in particolare in Gag, ai destinatari HLA-non corrispondenti fornisce un beneficio clinico, e può essere dovuto ad attenuare la replicazione virale. Andando avanti, è imperativo studiare come complesso combinazioni di polimorfismi Gag all'interno isolati naturali lavorano in concerto per definire le caratteristiche del virus trasmesso come la capacità di replicazione, e come la replicazione precoce potrebbe a sua volta influenzare HIV-1 parametri clinici e di fase tardo- patogenesi.

Brockman et al. Prima dimostrato un legame tra la capacità di replicazione di sequenze gag-pro isolato durante l'infezione fase cronica e la carica virale sia nel sottotipo C e le infezioni B32-35. L'approccio sperimentale presentato in questi studi, anche se adeguato per esaminare la capacità di replicazione in vitro di sequenze derivate da individui cronicamente infetti, ha diversi avvertimenti tecnici e limitazioni che rendere lo studio di HIV-1 capacità replicativa nel sottotipo C individui con infezione acuta difficile. Questo metodo si basa sulla ricombinazione di base di popolazione sequenze PCR-amplificate nel sottotipo B NL4-3 provirus, che è stato derivato in parte da LAV, un laboratorio adattato virus magazzino 36. Generazione di virus è stato realizzato da co-trasfezione di una base-CEM linea di cellule T 37 con ampliconi della PCR e digerito delta- NL4-3 DNA gag-pro. Questo metodo richiede l'escrescenza di virus in un periodo di settimane o mesi, potenzialmente alterando la natura del virus magazzino recuperati rispetto ai quasispecie virale in vivo, e quindi alterare la misurazione della capacità di replicazione in vitro. Questo metodo is più appropriato per studiare gli individui cronicamente infette, dove seleziona efficacemente per virus con la più alta capacità replicativa, e dove clonazione numerose varianti virali differenti da un gran numero di individui cronicamente infette è piuttosto intenso lavoro e quindi non fattibile. Tuttavia, all'interno di un individuo infetto acutamente, ci sono generalmente 01:59 varianti presenti, ed eliminando così il rischio di inclinazione della natura del virus magazzino recuperato, attraverso pressioni della selezione in vitro, consente una valutazione più accurata della capacità di replicazione in vitro. In secondo luogo, questo metodo richiede ricombinazione sottotipo C sequenze gag-pro in un sottotipo B dorsale derivato, e potrebbe introdurre distorsioni backbone incompatibilità nell'analisi. A causa di queste limitazioni, un gran numero di sequenze devono essere analizzati al fine di superare eventuali distorsioni introdotte potenziali.

Qui si descrive un appro sperimentale alternativaach appropriata per studiare le sequenze derivate dal sottotipo C individui con infezione acuta. Usiamo una strategia di clonazione basata enzima di restrizione per introdurre il gene gag derivato dal acuti momenti di infezione da HIV-1 sottotipo C individui infetti nella spina dorsale provirale sottotipo C, MJ4. L'uso di MJ4 come una spina dorsale comune in cui clonare i geni gag è cruciale per l'analisi di sottotipo C sequenze derivate. MJ4 è derivato da un isolato primario 38, e quindi sarebbe meno probabilità di introdurre bias dovuto al sottotipo incompatibilità tra la spina dorsale e il gene gag. Inoltre, l'approccio di clonazione mediante restrizione basata enzima permette la provirale costruisce essere trasfettate direttamente nelle cellule 293T, e per il recupero di un virus magazzino clonale identica alla sequenza di gag clonata.

Il metodo presentato qui di seguito è un metodo ad alta produttività per la valutazione della capacità di replicazione del sottotipo C derivato Gag-MJ4virus chimerici. Trasfezione in cellule 293T è semplice e il recupero di virus richiede solo tre giorni. In vitro la capacità di replica viene analizzato sulla stessa base linea di T-cellule CEM-CCR5 creato da Brockman et al. 37, ma con importanti modifiche di protocollo necessario per la replica di successo di sottotipo C MJ4 virus chimerici. L'utilizzo di una linea di T-cella appropriata piuttosto che PBMC permette un gran numero di sottotipo C virus MJ4-chimerico per essere testati con alto dosaggio riproducibilità. Infine, utilizzando un radiomarcato test trascrittasi inversa per la quantificazione del virus nel surnatante è più conveniente rispetto all'utilizzo di kit ELISA disponibile in commercio P24. Inoltre, dà una gamma dinamica superiore, che era importante per rilevare i virus male e altamente replicare all'interno dello stesso test e per la rilevazione di sottili differenze nella replica tra gli isolati.

In conclusione, il metodo qui presentato ha permessolo studio approfondito della capacità di replicazione di sequenze gag derivati ​​da HIV-1 sottotipo C acutamente infettato individui dallo Zambia, e come scritto, potrebbe anche essere esteso a studiare altri sottotipo C popolazioni infettato. È stato osservato un alto grado di variazione capacità di replica tra i diversi isolati Gag. Inoltre, siamo stati in grado di dimostrare un'associazione statistica tra la capacità di replicazione del Gag trasmessi e set point carica virale così come con CD4 + declino nel corso di un periodo di tre anni 39. Tali risultati sottolineano l'importanza di studiare le caratteristiche virali come trasmesso, come la capacità di replica, interagiscono con il sistema immunitario ospite di influenzare patogenesi durante l'infezione precoce e saranno parte integrante per lo sviluppo di interventi di vaccini efficaci e trattamento.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1 Amplificazione del virus HIV-1 gag Gene da infetti, Frozen Plasma

  1. Estrarre l'RNA virale da 140 microlitri scongelati HIV-1 nel plasma infetto utilizzando un kit di estrazione.
    1. Quando possibile, procedere immediatamente alla sintesi del DNA dopo estrazione dell'RNA come RNA virale scongelato produce i migliori risultati di amplificazione. Se possibile, impostare PCR master mix per il primo turno di amplificazione del DNA e conservare a 4 ° C prima dell'estrazione dell'RNA virale.
  2. Reverse-trascrivere cDNA da RNA e amplificare al primo round prodotti DNA utilizzando trascrittasi inversa e una DNA polimerasi termostabile in un one-step RT-PCR.
    1. Prendere RNA di -80 ° C congelatore (se il congelamento fosse necessario) e brevemente scongelare a temperatura ambiente, poi posto nel blocco freddo. Trasferire 5 ml di RNA per ogni tubo di PCR contenente 45 ml di master mix per dare un volume finale di 50 ml. Porre immediatamente restanti campioni di RNA in -80 ° C freezer.
    2. Dopo enzima è unadded al primo turno PCR Master Mix (Tabella 1A), aliquota 45 microlitri in ciascun tubo di amplificazione PCR a parete sottile per il numero di reazioni desiderate. Assicurarsi di utilizzare provette PCR con i singoli tappi e non togliere i tappi per garantire il minimo la contaminazione incrociata tra i campioni. Mettere provette PCR in un blocco freddo per proteggere la RT enzima e RNA template sensibile alla temperatura. Nota: I campioni devono essere eseguiti in triplice copia, al fine di adeguatamente assaggiare le quasispecie virali. E 'anche importante utilizzare un prodotto con una elevata fedeltà enzima DNA polimerasi per minimizzare misincorporation PCR-introdotta. Si prega di fare riferimento alla lista reagenti per il prodotto consigliato.
    3. Dopo il modello di RNA è stato aggiunto a tutte le provette di reazione, trasferimento provette per PCR a un termociclatore per l'amplificazione utilizzando il programma cycler descritto nella Tabella 1B. Nota: Il prodotto di questa amplificazione sarà utilizzato in un secondo turno nested PCR.
  3. Eseguire un nidificato second tutto l'amplificazione PCR, utilizzando 1 ml del primo turno di amplificazione PCR (1.2) come modello di DNA.
    1. Aliquota 49 ml di secondo turno master mix di PCR (Tabella 2A) a ciascuna provetta PCR a parete sottile per il numero di reazioni desiderate. Trasferire 1 ml del primo turno amplificazione PCR per ciascun tubo di reazione per dare un volume finale di 50 ml. Nota: Questo servirà DNA come modello per l'amplificazione secondo turno. E 'anche importante utilizzare una DNA polimerasi con capacità molto alta fedeltà e revisione al fine di minimizzare misincorporation PCR-introdotta. Si prega di fare riferimento alla lista reagenti per il prodotto consigliato.
    2. Trasferimento secondo turno Miscela di reazione PCR per termociclatore ed eseguire il programma descritto nella Tabella 2B. Nota: Dopo il completamento del programma, i prodotti di questa reazione vengono eseguiti su un gel di agarosio per confermare la produzione del prodotto.
  4. Aggiungere 3 ml di 5x loading dye a 5 & #181, l del 50 microlitri volume di reazione secondo turno e correre a 120 V su un gel di agarosio-TAE 1% contenente una macchia di DNA fluorescente agli UV fino a quando le bande sono risolti. Visualizza 1.6 kb bande su un illuminatore luce blu (vedi Figura 1A).
  5. Eseguire il restante volume di reazione di 45 microlitri su un gel di agarosio-TAE 1% contenente una macchia di DNA, e asportare le bande appropriate con una lama di rasoio pulito.
    1. Estrarre DNA dalla fetta gel utilizzando un kit di purificazione gel, eluire in acqua priva di nucleasi, unire tre reazioni positive per ogni individuo, e congelare prodotto a -20 ° C per un uso successivo.

2. Preparazione ampliconi gag per la clonazione di Introduzione dei siti di restrizione necessari

  1. Amplificano la Ripetizione lungo Terminal (LTR) / 5 'UTR parte del plasmide MJ4 (vedi Tabella 3).
  2. Visualizza 1.3 kb PCR prodotti illuminatore, accise ampliconi positivi, gel purificare e congelare come precedentementedescritto (1.4,1.5; vedi Figura 1B).
  3. Crea fuso MJ4 LTR- ampliconi gag via "splice-overlap-estensione" PCR (vedi tabella 4).
  4. Visualizzare, accise, purificare, e congelare gli ampliconi 3.2 kb come in 1.4,1.5 (vedi Figura 1C).

3. Clonazione Amplified gag geni nel MJ4, sottotipo C, infettiva Clone molecolare

  1. Digest 1.5 mg di MJ4 plasmide e 1,5 mg di prodotto purificato LTR- gag PCR con il BclI (metilazione sensibili) endonucleasi di restrizione per 1,5 ore a 50 ° C (vedi Tabella 5A).
  2. Aggiungere 1 ml di NgoMIV alla reazione di digestione e incubare a 37 ° C per 1 ora.
  3. Aggiungere carico 5x dye a restrizioni digerire reazioni e lentamente il volume totale elettroforesi su gel di agarosio-TAE 1% contenente una macchia gel DNA per 1-2 ore a 100 V. Visualize, accise, e purificare bande indicate per la clonazione come precedentemente discribed (vedi Figura 2).
  4. Preparare le reazioni legatura usando purificata LTR- inserto gag e MJ4 vettore DNA a 3: 1 inserto rapporto vettore. Incubare le reazioni legatura notte a 4 ° C (vedi Tabella 5B).
  5. Trasforma JM109 batteri chimicamente competenti con prodotti legatura e la diffusione su piastre di agar LB con 100 mg / ml di ampicillina e crescere a 30 ° C per 22 + ore.
    1. Scongelare JM109 cellule competenti in ghiaccio per 15 min. Etichettare provette da 1,5 ml microcentrifuga e freddo su ghiaccio.
    2. Aliquota 50-100 ml di cellule JM109 di pre-refrigerata 1,5 ml provette da microcentrifuga. Aggiungi 2,5-5 ml di reazione legatura a JM109 cellule, sfogliando il tubo leggermente per mescolare e subito tornare in ghiaccio. Incubare le cellule competenti prodotto legatura in ghiaccio per 30 min.
    3. Shock termico 1,5 ml provette da microcentrifuga contenenti cellule competenti JM109 e reazione legatura in un blocco di calore 42 ° C per 45 secondi e riprendere il ghiaccio per almeno 3 min.
    4. Aggiungere 50 ml di mezzi SOC a ciascuna provetta e piastra tutta reazione di trasformazione sulla temperatura ambiente LB-agar piastre integrate con 100 mg / ml di ampicillina.
    5. Piastre di trasferimento ad un 30 ° C incubatore e lasciare per 20 ore, o fino a quando le colonie sono chiaramente formate.
  6. Scegli colonie isolate e crescere in 4 ml di LB con 100 mg / ml di ampicillina a 30 ° C per 22 + ore.
  7. Spin down culture a 3.200 xg per 15 minuti, versare il brodo fuori, ed estrarre DNA plasmidico.
  8. Per confermare la clonazione fedeltà, tagliare il DNA miniprep con NgoMIV e HPAI enzimi di restrizione in un doppio digerire a 37 ° C per 2 ore. Analizzare il 1% gel-TAE (vedi Tabella 5C).
  9. Sequenza regione inserto LTR-gag di ogni plasmide utilizzando i seguenti primers: GagInnerF1, GagF2, Rev1, Rev3, e GagR6 (Tabella 6) per confermare l'identità di sequenza.
  10. Confronta le sequenze clonate ottenuti con la popolazione di sequenze derived dal amplicone purificato iniziale 1.5.1. Nota: E 'importante valutare in ultima analisi, la capacità di replica di due cloni indipendenti al fine di garantire che qualsiasi fenotipi di replica in vitro non sono dovuti a errori di backbone introdotti durante il processo di clonazione.

4 Generazione e titolazione di replica competenti Gag-MJ4 chimerici virus

  1. Generare la replicazione del virus competente trasfettando 1.5 mg del chimerico MJ4 plasmide miniprep DNA in cellule 293T con un rapporto 4: 1 di Fugene HD come descritto dal Principe et al 39.
  2. Titolo raccolte le riserve di virus sulle cellule TZM-bl come descritto di seguito e in Prince et al 39.
    1. Piatto TZM-bl cellule 24 ore prima dell'infezione con il virus in modo da avere un monostrato di cellule confluenti 30-40% il giorno successivo. In genere, può essere ottenuto aggiungendo 5 x 10 4 cellule in un volume totale di 800 microlitri per pozzetto in una piastra da 24 pozzetti.
    2. Dopo aver aggiunto le cellule al pozzo, spostare delicatamente la piastra di 24 pozzetti in avanti e indietro, poi un lato all'altro in modo da distribuire in modo efficiente le cellule. Mai turbinio - questo si tradurrà in cellule accumulano nel centro della piastra.
    3. Il giorno seguente, preparare 1% FBS in DMEM; questo verrà utilizzato per diluire DEAE-Destrano e per diluire le scorte di virus. Archivio DEAE-Destrano è di 10 mg / ml o 125x, e una concentrazione finale di è desiderato 80 mcg / ml o 1x.
    4. Togliere virus magazzino da testare da -80 ° C freezer e posto su agitatore per scongelare a temperatura ambiente.
    5. Usando una pipetta multicanale, in serie diluire le riserve di virus in una cultura a fondo tondo tessuto trattato piastra da 96 pozzetti con coperchio. Si tratta di un protocollo di diluizione 3 volte. Vedere la Tabella 7 per il sistema di diluizione.
    6. Rimuovere i supporti da piastre da 24 pozzetti TZM-bl seminate utilizzando un aspiratore a vuoto facendo attenzione a non disturbare monostrato cellulare. Rimuovere il supporto solo da una piastra a 24 pozzetti alla volta in modo che le cellule fannoNon asciugare.
    7. Aggiungere 150 ml di 1x DEAE-Destrano + 1% FBS in DMEM miscela in ogni pozzetto usando una pipetta di 1.000 ml. Non utilizzare ripetere pipetta come questo sconvolge il monostrato.
    8. Aggiungere 150 ml di ogni diluizione virus per il bene appropriato. Aggiungi virus al centro del pozzo e miscelare delicatamente per distribuire uniformemente il virus attraverso il monostrato cellulare. Incubare le cellule infette per 2 ore in un incubatore di coltura tissutale a 37 ° C e 5% di CO 2.
    9. Dopo l'incubazione 2 ore, aggiungere 0,5 ml di 10% FBS in DMEM a ciascun bene e tornare piastre ad incubatore per un supplemento di 48 ore.
    10. Dopo 48 ore, le cellule dovrebbero essere al 100% confluenti. Perché MJ4 è un virus competente replica, ci sarà qualche morte cellulare, ma questo è da aspettarselo.
    11. Rimuovere i supporti di ogni bene e aggiungere 400 ml / pozzetto di soluzione di fissaggio (vedi Tabella 8A per ricetta). Fissare un solo piatto per volta. Aggiungi il fissaggio soluzione con una pipetta 1000 ml, e lasciate riposare per 5 minuti atemperatura ambiente.
    12. Rimuovere la soluzione di fissaggio e lavare 3 volte con PBS con Ca 2 + / Mg 2 +. Utilizzare uno spruzzatore per aggiungere delicatamente PBS al lato del bene per evitare di interrompere il monostrato. Dopo il terzo lavaggio, asciugare piatto asciugare su carta assorbente.
    13. Aggiungere 400 ml / pozzetto di soluzione colorante (vedi Tabella 8B per la ricetta) in ciascun pozzetto della piastra a 24 pozzetti e incubare a 37 ° C per almeno 2 ore. Tempi di incubazione più lunghi sono accettabili, ma i tempi di incubazione dovrebbero essere mantenuti coerenti tra esperimenti titolazione.
    14. Lavare 2x con PBS con Ca 2 + / Mg 2 + e il punteggio per l'infezione, o aggiungere PBS e conservare a 4 ° C per il punteggio più tardi. Le piastre possono essere conservati a 4 ° C fino a quattro giorni, finché il monostrato viene mantenuta idratata.
    15. A segnare per l'infezione, utilizzare un pennarello indelebile per dividere pozzetti della piastra da 24 pozzetti in quadranti. Contare tutte le cellule blu all'interno di un campo di vista, utilizzando un ingrandimento totale di 200X, una volta inciascuno dei quattro quadranti di un pozzo.
    16. Calcola unità infettive per ml come segue: [(# cellule blu / 4) x 67] / (ml virus aggiunto) = IU / ml. Fare riferimento alla Tabella 8C per il volume in ml di virus aggiunto a ciascun pozzetto. Media diversi pozzi insieme; i numeri dovrebbero essere relativamente simile per una titolazione accurata.

5 Preparazione di cultura media e propagazione di cellule in vitro per GXR25 replica Assay

  1. Preparare completo RPMI (cRPMI) per la propagazione delle cellule GXR25. NOTA: E 'estremamente importante per le cellule cultura GXR25 almeno 4 mesi prima esperimenti di replica previste (vedi Tabella 9).
  2. Cellule Split 01:10 due volte a settimana e mantenere la densità delle cellule fra 1 x 10 5 a 2 x 10 6 cellule / ml.

6. In replica vitro di Gag-MJ4 Chimere in GXR25 (CEM-CCR5-GFP) Celle

  1. Il giorno prima l'infection, dividere cellule ad una concentrazione tra 2-3 x 10 5 cellule / ml in modo che siano in crescita logaritmica del giorno dell'infezione.
  2. Il giorno di infezione, rimuovere le riserve di virus da -80 ° C freezer e scongelare. Calcolare il volume di virus necessaria ciascuno stock sulla base della UI / ml titolo di dosaggio cella TZM-bl per infettare 5 x 10 5 cellule GXR25 ad una molteplicità di infezione di 0,05, con la formula:
    Volume di virus per l'infezione (ml) = 1 ml / X UI x 0.05 x 500.000
    NOTA: Abbiamo scelto una MOI di 0,05 come questo si traduce in una fase di crescita logaritmica per tutti i virus che abbiamo testato. È importante condurre esperimenti iniziali per determinare l'ottimale MOI per catturare la crescita logaritmica per il virus da testare.
  3. Diluire virus in cRPMI ad un volume di 100 microlitri (per ottenere un MOI 0,05) e inserirlo in un pozzetto di una coltura tissutale V-Fine trattati piastra da 96 pozzetti. Nota: Includere sia positive (MJ4 WT infetto) e negativo (cellule infettate finto) controllo in ogni serie di esperimenti di replica. Impostare la piastra tale che ogni altra colonna è vuota per limitare la contaminazione incrociata tra i pozzetti. Il controllo positivo è indispensabile, come sarà utilizzato in seguito come standard per normalizzare le piste di replica, che sono una misura del tasso di replicazione di repliche sperimentali.
  4. Contare le celle GXR25 utilizzando un contatore automatico di cellule. Calcolare il numero di cellule necessarie in totale per tutte le infezioni (5 x 10 5 x # infezioni). Aliquota il volume richiesto in un tubo da 50 ml e centrifugare a pellet di cellule. Calcolare Sempre per il 25% le infezioni più del necessario.
  5. Supporti Aspirare accuratamente e risospendere in cRPMI una concentrazione di 5 x 10 5 cellule / 100 microlitri.
  6. Cellule Pipettare in un trogolo sterile e mescolare accuratamente. Usando una pipetta multicanale, aggiungere 100 ml di cellule in ciascun pozzetto della piastra a 96 pozzetti contenenti il ​​virus diluito. Mix accuratamente.
  7. Aggiungere 2 ml di soluzione 5 mg / ml (100x) di polibrene in ogni pozzetto e mescolare accuratamente cellule.
  8. Incubare a 37 ° C nel tessuto cultura incubatore con il 5% di CO 2 per 3 ore.
  9. Per lavare le cellule infette, centrifuga 96 pozzetti piastra V-bottom a pellet di cellule. Quindi rimuovere con cautela 150 ml di medium e sostituirlo con fresche 150 ml di cRPMI senza disturbare il pellet di cellule. Ripetere altre 2 volte (compresa la centrifugazione) per lavare sufficientemente cellule.
  10. Dopo l'ultima centrifugazione e l'aggiunta di 150 ml cRPMI, risospendere il pellet cellulare con una pipetta multicanale e aggiungere la miscela di cellule / virus (circa 200 ml) da ciascun pozzetto indipendente a 800 ml di cRPMI in un pozzo di un tessuto 24 pozzetti piastra di coltura.
  11. Posizionare la piastra in 5% di CO 2 tessuto cultura incubatore a 37 ° C.
  12. Ogni due giorni, togliere 100 ml di surnatante dalla superficie della cultura bene e trasferire ad un ben-96 Upiastra -bottom e conservare congelati a -80 ° C fino al corretto funzionamento virus test quantificazione. NOTA: Disposizione accurata dei surnatanti in piastre a 96 pozzetti consentirà per il multi-canale di trasferimento pipetta di surnatanti di coltura durante virione quantificazione tramite un test radioattivo trascrittasi inversa (RT). Ogni piastra deve contenere campioni provenienti da uno standard di infezione al fine di normalizzare la variazione inter-piastra nel test di lettura RT.
  13. Dopo aver rimosso ogni campione 100 microlitri, celle divise 1: 2 da cellule accuratamente risospendere e rimuovendo la metà del volume residuo (450 microlitri). Ripristina volume originale (1 ml) con l'aggiunta di 550 ml di fresca cRPMI in ciascun pozzetto.

7 Analisi della trascrittasi inversa (RT) in coltura cellulare surnatanti

Protocollo adattato da Ostrowski et al 40.

  1. Impostare cappa di sicurezza biologica in una struttura BSL-3 per l'uso con materiali radioattivi.
    1. Posizionare la carta assorbente in hood e sostituire aspirazione per aspiratore designata per l'uso radioattivo. Nota: Tutti i rifiuti radioattivi devono essere correttamente smaltiti con conformità alle norme di sicurezza.
  2. Aggiungere 1-2 ml di 10 mCi / ml di [α- 33 P] dTTP e 4 ml di 1 M ditiotreitolo (DTT) per ogni 1 ml aliquota di RT master mix (vedi Tabella 10 e Ostrowski et al. 40).
  3. Mescolare accuratamente ogni provetta da 1,5 ml microcentrifuga di RT master mix, DTT, e [α- 33 P] dTTP con una pipetta 1.000 microlitri e trasferimento in un trogolo sterile.
  4. Versare 25 ml di etichetta RT mescolano in ciascun pozzetto di 96 pozzetti a parete sottile piastra PCR. Nota: Includere lo spazio per un controllo positivo (MJ4 infezione WT) e il controllo negativo (infezione Mock).
  5. Aggiungere 5 ml di ogni supernatante alla piastra PCR contenente la master mix RT.
  6. Sigillare piastra PCR con copertura foglio adesivo e incubare per 2 ore a 37 ° C in un termociclatore. Per motivi di sicurezza, rinSE puntali per pipette con Amphyl e smaltire punte in piccolo contenitore contenenti rifiuti Amphyl, che sarà poi essere smaltiti nei rifiuti radioattivi.
  7. Dopo l'incubazione, fare piccoli fori nella pellicola di copertura con un 200 microlitri pipetta multicanale. Nota: Se i puntali delle pipette toccano liquido in bene, sostituire suggerimenti prima di passare alla colonna successiva o riga.
  8. Mix campioni 5x e trasferimento 5 ml di ciascun campione sulla carta DE-81. Asciugare 10 min.
  9. Macchie Lavare 5x con 1x SSC (cloruro di sodio, citrato di sodio), e poi 2x con il 90% di etanolo a 5 minuti a lavaggio. Lasciare asciugare all'aria.
    1. Mettete ogni macchia in un contenitore lavaggio separato, come ad esempio una scatola di immagazzinaggio panino, aggiungere il tampone di lavaggio abbastanza (1x SSC o il 90% EtOH) per coprire macchia, e agitare per 5 minuti.
    2. Eliminare il tampone di lavaggio nel contenitore e ripetere separato. Nota: I primi 3 lavaggi sono considerati radioattivi e devono essere smaltite correttamente. Gli ultimi 2 lavaggi possono essere smaltiti regolarmente.
  10. Una volta asciutto, autoefully avvolgere macchia a Saran avvolgere ed esporre ad un phosphoscreen in un cassetto ben chiuso durante la notte a temperatura ambiente.
  11. Analizzare phosphoscreens con phosphorimager e quantificare trascrizioni radioattivi.
  12. Disegnare un cerchio attorno ad ogni segnale radioattivo utilizzando il software OptiQuant. Rappresentare graficamente i valori di Unità Digital Light (DLU) per generare le curve di replica.
  13. Al fine di generare punteggi di capacità di replica, i valori DLU erano log 10 -transformed e piste sono state calcolate utilizzando il giorno 2, 4, e 6 punti di tempo. Replica piste sono poi divisi per il pendio di WT MJ4 nei punteggi di capacità di replica ordine generare. E 'importante per normalizzare base ai valori MJ4 WT ottenuti dalla stessa piastra RT per ridurre la variabilità intra-saggio.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Per eseguire correttamente questo protocollo, che crea un plasmide provirale in grado di assemblare completamente funzionale, infettive chimere Gag-MJ4, grande cura deve essere presa per generare le opportune ampliconi della PCR. Determinare se la PCR ha generato all'amplicon bavaglio di dimensioni appropriate è fondamentale. I prodotti dovrebbero essere meno di 100 paia di basi (bp) del amplicone circa 1.700 bp rappresentato nella figura 1A. La lunghezza esatta di questo frammento varierà a seconda del gene gag sotto studio. Successivamente, la porzione 5 'ripetizione terminale lunga (LTR) del clone molecolare MJ4 deve essere amplificato e impiombato all'amplicon gag al fine di renderlo adatto successiva clonazione. Il ampliconi MJ4 LTR dovrebbe essere 1.474 bp di lunghezza. Figura 1B mostra un'immagine rappresentativa del gel per i quali sono indicati i formati di banda corrette. Dopo la giunzione-sovrapposizione-extension PCR 41, prodotti gag LTR- combinati dovrebbero esserecirca 3.200 bp di lunghezza, come illustrato nella Figura 1C.

Una volta che il gene gag è stato reso adatto per clonazione per fusione al 5 'LTR da MJ4, che contiene il sito necessario NgoMIV restrizione, sia vettoriali e inserto gag deve essere digerito con NgoMIV e BclI enzimi di restrizione e asportato da un gel di agarosio dopo elettroforesi separazione. E 'indispensabile per asportare le appropriate bande vettoriali e inserti. Un gel rappresentativo è mostrato in Figura 2. La porzione vettore del plasmide MJ4 dovrebbe essere di circa 10.000 bp di lunghezza, mentre la LTR- inserto gag dovrebbe rimanere a circa 3.000 bp di lunghezza, come i siti di restrizione sono situati alle estremità di all'amplicon. Qualsiasi riduzione significativa delle dimensioni indicherà un taglio ulteriore sito all'interno del gene gag in fase di studio.

Dopo legatura dei due frammenti, trasformazione batterica, unand isolamento del DNA plasmidico, le chimere Gag-MJ4 deve essere controllato per dimensioni adeguate eseguendo un doppio digest con NgoMIV e HPAI enzimi di restrizione. Figura intera chimere Gag-MJ4 che non sono sostenute eventi soppressione durante la replicazione batterica dovrebbe avere un profilo di restrizione simile a quello illustrato nella figura 3, con due bande di circa 8.700 e 4.300 bp.

Un'importante distinzione di questo protocollo rispetto agli approcci precedenti, è l'uso del clone molecolare di HIV-1 sottotipo C infettiva, MJ4, piuttosto che il virus NL4-3-laboratorio adattato più comune. Tuttavia, gli approcci descritti nella sezione precedente possono essere modificate per la clonazione di sequenze sottotipo B gag in pNL4-3.

L'ottimizzazione della molteplicità di infezione (MOI) da utilizzare in successivi esperimenti è stata eseguita al fine di selezionare il MOI ideale che ha mostrato una crescita logaritmica della maggioranza dei virus testati.La Figura 4 illustra le curve rappresentative replica da tre differenti MOI (0,01, 0,05 e 0,25) per MJ4 (Figura 4A) nonché per NL4.3 (Figura 4B). MJ4 replica molto meno efficiente in cellule GXR25 che NL4-3, che è importante prendere in considerazione, come un adeguato MOI per la replica NL4-3 sarebbe probabilmente troppo basso per rilevare la replica MJ4 efficiente. Come si vede nella figura 4A, una MOI di 0,05 rispetto a 0,01 o 0,25, è stata la scelta ideale, perché la crescita logaritmica è stata osservata tra 2-6 giorni per MJ4. Per il MOI più basso, 0.01, giorno 6 valori DLU sono appena rilevabili, e abbiamo anticipato la generazione di Gag-MJ4 virus chimerici che replicava inferiore MJ4. Quindi questo MOI non cogliere la crescita dei più attenuati chimere Gag-MJ4, che possono anche essere biologicamente più critica. Inoltre, una MOI di 0,25 non era ideale, perché la rapida cinetica di replicazione virale ucciso un amou sostanzialent di cellule, anche di giorno 4 Questo fa sì che la curva di replica ad un plateau, e calcolando un pendio sulla base di una curva come questo porterebbe a sottovalutare la capacità di replica. Sulla base di curve generate per NL4-3, anche a una MOI di 0,01, target cellulari disponibili sono stati esauriti notevolmente di giorno 6 dopo l'infezione. In conclusione, una MOI di 0,05 è risultato ottimale per un grande pannello di Gag-MJ4 virus chimerici, i quali avevano diverse sequenze Gag e vari gradi di replica.

Un totale di 149 Gag-MJ4 virus chimerici derivati ​​dal sottotipo acuta sequenze C Gag sono stati testati per la replica in vitro utilizzando questo test. I valori normalizzati RC variavano da 0,01 a oltre 3,5 con alcuni virus che replicano più di 100 volte più efficiente rispetto wild-type MJ4. Figura 5 mostra le curve di replica di nove rappresentative virus chimerici Gag-MJ4, con wild-type MJ4 raffigurati in rosso, e dimostra l'ampia gamma di replica capacities osservati. Così, la diversità di sequenza nel gene gag solo può influire drasticamente la capacità del virus di replicare in vitro. Mentre questo è rappresentativo di Gag-MJ4 virus chimerici derivati ​​da Zambia infezione acuta, altre sequenze sottotipo C non sono stati ampiamente testati, e possono presentare diverse cinetiche di replica. Pertanto, grande cura deve essere presa per ottimizzare il MOI per soddisfare la replica specifico dei virus di uno studio particolare, perché non ci può essere una vasta gamma dei livelli di replica tra differenti di HIV-1 backbone e Gag isolati.

Uno dei vantaggi di utilizzare una linea di cellule T, come la linea cellulare GXR25, che supporta la replica di MJ4, è il livello di riproducibilità osservato rispetto agli esperimenti di replica utilizzando stimolato cellule mononucleate del sangue periferico come bersagli. In esperimenti di ottimizzazione iniziali, MJ4 wild type esibito una variabilità intra-saggio del 8,7%, e different cloni della stessa Gag-MJ4 virus chimerico esposto variabilità nella replicazione del 8,5%. Poiché diversi master mix e delle esposizioni phosphoscreen possono dare valori DLU che differiscono leggermente in grandezza, la variabilità intra-assay può essere ulteriormente controllata eseguendo lo stesso standard virus (nel nostro caso wild-type MJ4) in ogni piatto test RT. Figura 6 grafici del valori DLU derivano dalla stessa infezione MJ4, quantificato in otto diverse piastre RT. Normalizzare ad un virus che è comune a tutti i saggi RT può contribuire ad attenuare il potenziale errore indotto da questi lievi cambiamenti nella grandezza del segnale tra saggi.

Inter-dosaggio variabile è stato anche testato e replica ripetuto in giorni diversi sono stati altamente correlati. Figura 7 grafici i valori punteggio RC normalizzati da due esperimenti indipendenti effettuati circa un anno di distanza. Un alto grado di correlazione con l'assenza di importanti valori anomali (R 2 = 0,873) è stata osservata between le due repliche indipendenti.

Sebbene altamente correlati, vi è una certa variabilità nella grandezza globale di cinetica di replica tra i due esperimenti indipendenti. Questo può essere attribuito in parte alla differenza di numeri di passaggio tra le cellule GXR25 supporti utilizzati in ciascun esperimento. In generale, GXR25 cellule scorte che sono stato posto per un periodo di tempo superiore a 6 mesi tendono a supportare la replica più efficiente delle chimere Gag-MJ4. Pertanto, si consiglia di valutare la capacità di replica tra gruppi di chimere in un arco di tempo di un mese. Quando i passaggi precedenti sono seguiti da vicino, questo test è in grado di produrre risultati molto robusti e riproducibili, che sono applicabili a una vasta gamma di studi.

Figura 1
Figura 1 Rappresentante gel images raffiguranti separazione elettroforetica dei prodotti di PCR. Per tutti i prodotti di PCR, 5 ml di ogni reazione di 50 microlitri è stato mescolato con 3 ml di 5x loading dye, caricato in un 1% di agarosio-TAE gel integrato con 1X SYBR-safe macchia gel del DNA, e separati mediante elettroforesi a 120 V per 45 minuti. Il Promega 1 kb DNA ladder (corsia 1) è stato utilizzato per approssimare le dimensioni ampliconi. A) Il gene gag è stato amplificato da RNA virale con un approccio nested PCR. A causa di inserimenti e cancellazioni, all'amplicon bavaglio può variare da 1.600-1.700 bp in lunghezza e appare leggermente sopra il marcatore DNA ladder 1.500 bp. Lanes 2-5 raffigurano successo amplificazione del gene gag. B) Il 5 'LTR di MJ4 è stato amplificato dalla wild-type MJ4 plasmide e visualizzato tramite separazione elettroforetica. Lanes 2-5 raffigurano successo l'amplificazione del prodotto LTR 1.474 bp, che appare leggermente inferiore al 1500 bp marcatore scala del DNA. C) Il 5R17; LTR derivato da wild-type MJ4 e il gene gag amplificato dal plasma del paziente sono fusi insieme con giunzione-overlap-extension PCR e visualizzato tramite separazione elettroforetica. Lanes 2-5 raffigurano fuso con successo ampliconi che sono circa 3.200 bp in termini di dimensioni, e che appaiono leggermente sopra il marcatore DNA ladder 3.000 bp.

Figura 2
Figura 2 immagine gel Rappresentante raffigurante separazione elettroforetica di restrizione digerisce per la clonazione di geni gag paziente in MJ4. Wild-tipo MJ4 plasmide e LTR- gag prodotti di fusione sono stati digeriti con BclI per 1,5 ore a 50 ° C e NgoMIV per 1 ora a 37 ° C. Inserto vettoriali e frammenti sono stati visualizzati tramite separazione elettroforetica su un 1% di agarosio-TAE gel integrato con 1X SYBR-safe DNA gel macchia a 100 V per 2 ore e con un illuminatore luce blu al fine di ridurre i danni al DNA indotto dai raggi UV. I frammenti vettoriali e inserti adatti per le successive fasi di clonazione appaiono circa 10.000 bp e 2900 bp rispettivamente.

Figura 3
Figura 3: immagine del gel Rappresentante raffigurante separazione elettroforetica di digest restrizione di purificato Gag-MJ4 chimera DNA plasmidico. Purificato Gag-MJ4 chimera plasmide DNA è stato digerito con doppio NgoMIV e la restrizione HPAI enzimi per 2 ore a 37 ° C. Digest di restrizione sono stati visualizzati tramite separazione elettroforetica su un 1% di agarosio-TAE gel integrato con 1X macchia gel DNA SYBR-safe a 120 V per 45 min. I plasmidi senza grandi delezioni risolveranno a due bande distinte di circa 8.700 e 4.300 bp.


Figura 4 La replica di MJ4 e NL4-3 isolati di HIV-1 nella linea cellulare GXR25 a diverse molteplicità di infezione (MOI). 5 x 10 5 GXR25 cellule sono state infettate come descritto nel protocollo di metodo con 5-fold aumento MOI di ciascuno stock di virus. I surnatanti sono stati raccolti nei giorni 2, 4, 6, e l'infezione e virione produzione 8 post è stato quantificato tramite un test radioattivo trascrittasi inversa. Le infezioni sono state eseguite in triplicato e le barre di errore indicano la deviazione standard per le tre repliche. (A) MJ4 (B) NL4-3.

Figura 5
Figura 5 gamma Rappresentante di replica per diverse chimere Gag-MJ4. 5 GXR25 cellule sono state infettate con il wild-type MJ4 o Gag-MJ4 chimere ad una MOI di 0,05, surnatanti sono stati raccolti a intervalli di due giorni post-infezione, e la produzione virione quantificati da un radiomarcato RT test. Inserimento di vari sottotipo C geni gag derivata può avere un impatto drammatico sulla capacità di replica di MJ4. MJ4 replica wild-type è indicato in rosso.

Figura 6
Figura 6 Confronto di variazione intra-assay nella trascrittasi inversa radiomarcata (RT) test di quantificazione. Il grafico raffigura intrinseca variabilità intra-assay tracciando i valori DLU degli stessi surnatanti da una singola infezione MJ4 wild-type in otto diversi test RT piastre. La variazione in curva riflette le lievi variazioni di scommessa segnale grandezzapiastre di Ween, che possono essere corretti per eseguendo una norma su ogni piatto RT, che può essere successivamente utilizzato per normalizzare le pendici del chimere Gag-MJ4 testati sulla stessa piastra.

Figura 7
Figura 7 riproducibilità del dosaggio di replica nel corso del tempo nella linea cellulare GXR25. Gli stessi virus chimerici Gag-MJ4 sono stati usati per infettare le cellule GXR25 in due esperimenti indipendenti eseguiti circa un anno di distanza. Punteggi di replica sono stati generati calcolando la pendenza dei valori DLU log-trasformati e normalizzando che degradano a wild-type MJ4. Chimere Gag-MJ4 che replicano più efficiente rispetto wild-type MJ4 avere punteggi di replica maggiori di 1, e quelli che replicano meno efficiente rispetto wild-type MJ4 avere punteggi di replica meno di 1 Le due misure indipendenti sono fortemente correlati (R 2 = 0.87, regressione lineare) ed evidenziare la riproducibilità dei test eseguiti in tempi diversi e con le cellule a diversi passaggi.

A)

Reagente Volume di reazione 1x (ml)
2x miscela di reazione (Invitrogen) 25
Priva di nucleasi H 2 O 17
Forward Primer GOF (20 mM concentrazione) 1
Primer Reverse Vifor (20 concentrazione mM) 1
SuperScript III One-step Enzyme Mix 1
Modello di RNA 5
Volume totale 50

B)

Numero di cicli Tempo (h: min: sec) Temperatura (° C)
1 01:00:00 50
1 02:00 94
10 00:15 94
00:30 56
05:00 68
40 00:15 94
00:30 56
05:00 + 5 sec / ciclo 68
1 00:00 68
1 4
Fine

Tabella 1 A) e B mix Master) gag di amplificazione. * Nota: sequenza GOF Primer: 5'-ATTTGACTAGCGGAGGCTAGAA-3 '. Vifor sequenza di primer: 5'-TTCTACGGAGACTCCATGACCC-3 '.

A)

Reagente Volume di reazione 1x (ml)
Priva di nucleasi H 2 O 35.5
5x Phusion HF Buffer 10
dNTP (deossinucleotidi 40 mm) 1
Primer Forward GagInnerF1 (20 concentrazione mM) 1
Primer Reverse BclIDegRev2 (20 concentrazione mM) 1
Phusion Hot Start II Polymerase 0.5
Primo turno-PCR come modello 1
Volume totale 50

B)

Numero di cicli Tempo (h: min: sec) Temperatura (° C)
1 00:30 98
29 00:10 98
00:30 53
01:00 72
1 10:00 72
1 4
Fine

Tabella 2 A) e B mix Master) condizioni Thermocycler per nested secondo turno di amplificazione bavaglio. * Nota: GagInnerF1 sequenza di primer: 5'-AGGCTAGAAGGAGAGAGATG-3 '. BclIDegRev2 sequenza di primer: 5'-AGTATTTGATCATAYTGYYTYACTTTR-3 '.

A)

Reagente Volume di reazione 1x (ml)
Priva di nucleasi H 2 O 35.5
5x Phusion HF Buffer 10
dNTP (deossinucleotidi 40 mm) 1
Primer Forward MJ4For1b (20 concentrazione mM) 1
Primer Reverse MJ4Rev (20 concentrazione mM) 1
Phusion Hot Start II Polymerase 0.5
MJ4 plasmide come modello (10 ng / ul) 1
Volume totale 50

B)

Numero di cicli Tempo (h: min: sec) Temperatura (° C)
1 00:30 98
29 00:10 98
00:30 58
00:45 72
1 10:00 72
1 4
Fine

Tabella 3 A) e B mix Master) condizioni Thermocycler per 5 'MJ4 LTR di amplificazione. * Nota: sequenza MJ4For1b Primer: 5'-CGAAATCGGCAAAATCCC-3 '. MJ4Rev sequenza Primer: 5 '-CCCATCTCTCTCCTTCTAGC-3 '.

A)

Reagente Volume di reazione 1x (ml)
Priva di nucleasi H 2 O 34.5
5x Phusion HF Buffer 10
dNTP (deossinucleotidi 40 mm) 1
Primer Forward MJ4For1b (20 concentrazione mM) 1
Primer Reverse BclIRev (20 concentrazione mM) 1
MJ4 LTR 1.3 kb ampliconi (gel purificato, ~ 50 ng) 1
Phusion Hot Start II Polymerase 0.5
Ampliconi Gag (gel purificato, ~ 100 ng) 1
Volume totale 50

B)

Numero di cicli Tempo (h: min: sec) Temperatura (° C)
1 00:30 98
29 00:10 98
00:30 58
01:30 72
1 10:00 72
1 4
Fine

Tabella 4 A) e B mix Master) condizioni Thermocycler per splice-overlap-extension PCR per generare inserti gag LTR-. * Nota: sequenza BclIRev Primer: 5'-TCTATAAGTATTTGATCATACTGTCTT-3 '

A)

Reagente Volume di reazione 1x (ml) Incubazione (hr) Incubazione Temperatura (° C)
1,5 mg di 3 kb LTR- gag ampliconi o MJ4 plasmide x ml per 1,5 mcg
NEB CutSmart Buffer (precedentemente ONA Buffer # 4) 2
BclI enzima di restrizione 1
Priva di nucleasi H 2 O x
Volume totale 19 1.5 50
NgoMIV enzima di restrizione 1
Volume totale 20 1 37

B)

Reagente Volume di reazione 1x (ml) Incubazione (hr) Incubazione Temperatura (° C)
50 ng taglio MJ4 vettore plasmidico x ml per 50 ng
45 ng taglio LTR- inserto gag (rapporto 3: 1) x ml per 45 ng
Tampone di ligasi Roche 10x 2
T4 DNA ligasi Roche (5 U / ml) 1
Priva di nucleasi H 2 O
Volume totale 20 18 + (durante la notte) 4

C)

Reagente Volume di reazione 1x (ml) Incubazione (hr) Incubazione Temperatura (° C)
450 ng di Gag-MJ4 plasmide x ml per 450 ng
NEB CutSmart Buffer (precedentemente ONA Buffer # 4) 2
NgoMIV enzima di restrizione 0.5
HPAI enzima di restrizione 0.5
Priva di nucleasi H 2 O x
Volume totale 20 2 37

Tabella 5 A) Limitazione digerire master mix e B) la reazione legatura per la generazione di Gag-MJ4 provirus chimerico. C) limitazione diagnostica digest per garantire Gag-MJ4 clonazione fedeltà.

Nome Primer Sequenza nucleotidica (5 '- 3')
GagInnerF1 AGGCTAGAAGGAGAGAGATG
GagF2 GGGACATCAAGCAGCCAT
For3 CTAGGAAAAAGGGCTGTTGGAAATG
GagR6 CTGTATCATCTGCTCCTG
Rev3 GACAGGGCTATACATTCTTACTAT
Rev1 AATTTTTCCAGCTCCCTGCTTGCCCA

Tabella 6 Elenco dei primer di sequenziamento necessari per confermare 5 'LTR e la sequenza gag identità di Gag-MJ4 provirus chimerico.

Beh A 8 virus ml + 232 ml 1% FBS in DMEM
Beh B 80 microlitri di Be A + 160 ml 1% FBS in DMEM
Beh C 80 microlitri di Well B + 160 ml 1% FBS in DMEM
Beh D 80 microlitri di Be C + 160 ml 1% FBS in DMEM
Bene E 80 microlitri di Ben D + 160 ml 1% FBS in DMEM
Beh F 80 microlitri di Bene E + 160 ml 1% FBS in DMEM

Tabella 7 schema di diluizione (3volte) per la titolazione di virus infettivi sulle cellule TZM-bl.

A)

Reagente Volume
PBS senza Ca 2 + e Mg 2 + 500 ml
Glutaraldeide 4 ml
Formaldeide 11 ml

* Nota: Conservare a 4 ° C.

B)

Reagente Volume
PBS senza Ca 2 + e Mg 2 + 4,75 ml
Ferricianuro di potassio (0.2 M) 100 ml
Ferrocianuro di potassio (0.2 M) 100 ml
Cloruro di magnesio (1 M) 20 microlitri
X-gal (50 mg / ml) 40 microlitri

* Nota: Fare fresco e conservare al riparo dalla luce fino al momento dell'uso.


C.

Ben diluizione originale La B C D E F
Volume di virus (microlitri) aggiunto ai pozzetti di una riga 24-pozzetti 5 1,6667 0,5556 0,1852 0,06173 0,02057

Tabella 8 A) B) soluzioni di fissaggio per la titolazione dei virus chimerici Gag-MJ4 sulla linea cellulare spia TZM-bl. C) Il volume di virus aggiunto per pozzetto per calcolare le unità infettive / ml.

Reagente Volume
Siero fetale bovino (FBS), definito 55 ml
Penicillina, streptomicina, glutammina (100x) 6 ml
Tampone HEPES (1 M) 6 ml

Tabella 9 Ricetta per mezzo completo RPMI per la propagazione delle cellule GXR25.

Reagente Volume (ml)
NucleaseH 2 O -free 419,5
Tris-Cl, pH 7.8 (1 M) 30
Cloruro di potassio (1 M) 37.5
Cloruro di magnesio (1 M) 2.5
Nonidet P-40 (10%) 5
EDTA (0,5 M) 1.02
Acido Polyadenylic, sale di potassio (2 mg / ml) 1.25
Oligo-dT Primer (25 mg / ml) 3.25
Volume totale 500

Tabella 10 Ricetta per radiomarcato reverse trascrittasi Assay Mix master. * Nota: Conservare in 1 ml aliquote a -20 ° C.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A causa della lunghezza e la natura tecnica di questo protocollo, ci sono diversi passaggi che sono fondamentali sia per la costruzione di successo di plasmidi chimerici Gag-MJ4 nonché per la quantificazione della capacità di replicazione virale. Anche se la strategia di clonazione basata enzima di restrizione per l'introduzione di geni gag estera in MJ4 descritto in questo protocollo ha numerosi vantaggi rispetto ai metodi basati ricombinazione utilizzati in precedenza, il protocollo può essere tecnicamente difficile se passi critici non vengono seguite con precisione.

In primo luogo, è assolutamente indispensabile utilizzare MJ4 DNA plasmidico che è stato generato in un ceppo batterico competente mancano DCM ed diga metilasi DNA. Ciò è necessario in quanto l'attività enzimatica della endonucleasi di restrizione BclI, che viene utilizzato per clonare geni gag nella spina dorsale MJ4, è diga / DCM metilazione sensibile. Il JM110 e SCS110 (un Enda negativo derivato JM110) E. coli ceppi unre adatto per la generazione di DNA non metilato MJ4 plasmide. Inoltre, per l'asportazione di bande vettoriali e inserti, è altamente raccomandato che un illuminatore luce blu da utilizzare per la visualizzazione. Ciò consentirà di ridurre il danno al DNA di lunghezza d'onda UV-dipendente e aumentare drasticamente l'efficienza di clonazione. Se un illuminatore luce blu non è disponibile, la clonazione efficienza può essere massimizzata visualizzando DNA con il DNA Sicuro SYBR macchia gel invece di bromuro di etidio e riducendo al minimo il tempo di esposizione ai raggi UV.

Infine, la clonazione molecolare con grande (> 10kb) e / o plasmidi retrovirali, come MJ4 è sempre stato difficile per una serie di motivi. Grandi plasmidi riducono l'efficienza di trasformazione di ceppi batterici competenti 42, mentre gli inserti retrovirali, che contengono lunga terminal repeat (LTR) sequenze, ridurre la stabilità del plasmide e il compromesso replica fedeltà del DNA plasmide all'interno dell'ospite batterico che conduce al delezioni del genoma retrovirale 43 E. coli sopra il ceppo DH5α, nelle nostre mani. A causa della natura instabile del plasmide, prodotti plasmidi purificati devono sempre essere controllati per la corretta dimensione del plasmide da enzimi di restrizione; qui, una doppia digest con i NgoMIV e HPAI enzimi di restrizione a 37 ° C per 2 ore.

Una volta riuscita generazione di plasmidi chimerici Gag-MJ4 è stato compiuto, il virus viene generato tramite trasfezione di 293T cellule, titolato su una linea indicatore di cellule, le cellule TZM-bl, e la capacità di replica viene misurata utilizzando una linea cellulare T-based CEM. La linea cellulare GXR25 basato CEM utilizzato per questi studi di replica è una delle poche linee di cellule T istituito in grado di supportare l'ingresso e la replicazione di ceppi CCR5-tropico di HIV-1. Questo è stato ottenuto trasduzione retrovirale per consentire l'espressione stabile di CCR5 umano 37. Questa linea cellulare esprime naturalmente CXCR4 e sosterrà la replica di CXCR4-tropico HIV-1, come il ceppo adattato in laboratorio NL4-3. Tuttavia, al fine di sostenere la replicazione efficiente di ceppi CCR5-tropico, come MJ4, le cellule GXR25 devono essere propagate per non meno di 4 mesi prima dell'infezione. Correttamente culture passaggi possono supportare la replica anche dopo passaging per fino a 1 anno. Attento monitoraggio della replicazione CCR5-tropico in tutta passaging è essenziale per gli esperimenti di successo.

Come con qualsiasi tecnica, ci sono delle limitazioni al proprotocollo che deve essere considerato. Grazie alla posizione dei siti di restrizione del plasmide MJ4, nonché la disponibilità di siti di restrizione conservati in naturalmente HIV-1 isolati, sito di restrizione distale del 3 ', BclI, si trova a 137 nucleotidi dalla fermata bavaglio codone. Anche se questo genera un gene chimerico proteasi, questa regione è 96,5% conservata in questa coorte, e non abbiamo osservato una grande varietà di virus chimerici morti o difettosi.

Uno dei vantaggi di utilizzare il MJ4 sottotipo C clone molecolare infettivo con sottotipo C sequenze derivate è che riduce il rischio di accoppiamento gene non ottimale tra i geni gag e vettori backbone di diversi sottotipi. Tuttavia, una certa quantità di diversità all'interno-clade esiste come dimostra il raggruppamento di HIV-1 sequenze per paese o regione, anche quando ha trovato all'interno dello stesso sottotipo 31. Questo potrebbe contribuire ad accoppiamento ottimale tra i geni gag derived da Zambians con infezione acuta e contagiosa la spina dorsale clone molecolare MJ4, che è stato derivato da un individuo cronicamente infettati dal Botswana 38. Tuttavia, la maggior parte dei costrutti analizzati prodotta virus progenie infettante. Come diverso HIV-1 sottotipo C cloni molecolari infettivi diventano più ampiamente disponibile, sarà importante per validare ulteriormente questo sistema clonazione in questi geni gag di HIV-1 clade C in altre dorsali, al fine di garantire che vi sia una distorsione minima introdotta a causa di incompatibilità spina dorsale.

La linea cellulare GXR25 è una linea cellulare unico, in particolare per la sua capacità di supportare sia CXCR4 e ceppi CCR5-tropico e la sua HIV-1 GFP inducibile giornalista 37. Tuttavia, esistono alcune limitazioni e devono essere attentamente considerati prima di utilizzare questa linea cellulare per esperimenti adattati da questo protocollo. La linea cellulare GXR25 non sembra supportare l'immissione di una maggioranza di sottotipo C o A, CCR5-tropico, primary isola abbiamo testato. Inoltre, la linea cellulare CEM genitore da cui la linea cellulare GXR25 è stato derivato mostre alti livelli di cyclophilin A, fino a 2 a 4 volte superiore di espressione rispetto alla linea cellulare Jurkat 44. A causa di alti livelli di cyclophilin A, il difetto replica normalmente associata con la canonica HLA-B * 57 associato fuga mutazione, T242N, che viene attribuito ad una diminuzione della capacità di capside di legare cyclophilin A, non può essere facilmente individuata in questa particolare linea cellulare 25. Così la linea cellulare GXR25 basato CEM non è l'ideale per studiare i difetti di replica associati a mutazioni del virus HIV-1 capside loop-cyclophilin vincolante.

Infine, anche se questo protocollo è l'ideale per analizzare la capacità di replicazione di sequenze gag derivate da momenti acuti, le modifiche devono essere effettuate al fine di studiare la capacità di replica di imbavagliare geni derivati ​​da individui con infezione cronica. Questo protocollo prevede l'amAmplificazione di sequenze di popolazione da momenti acuti (mediana 45 giorni Inseriti di infezione stimato) quando la diversità virale è limitata. Il gene gag da ogni chimera viene sequenziato e confrontato con la popolazione iniziale PCR amplicone per garantire la clonazione di fedeltà. A causa della diversità sequenza limitata in momenti acuti, la clonazione da popolazione di PCR prodotti è possibile. Tuttavia, la diversità sequenza esiste all'interno delle quasispecie virali di un individuo cronicamente infetto; Pertanto, al fine di valutare con precisione la capacità di replicazione delle quasispecie croniche, singolo amplificazione del genoma deve essere impiegato per catturare diverse varianti rappresentativi. Ognuna di queste varianti devono poi essere analizzati per la replicazione in vitro.

Questa tecnica ha diverse applicazioni più ampie, che derivano dai suoi vantaggi rispetto ai metodi esistenti. Poiché questo processo si traduce in un clonale replica plasmide competente, è semplice da usare costrutti per ulteriori mstudi utagenesis, che possono contribuire a chiarire i contributi di residui specifici per la replicazione virale. Inoltre, clonando in geni gag da punti di tempo longitudinali, si può valutare l'evoluzione della capacità di replicazione virale nel corso del tempo e di come questi cambiamenti possono influenzare la patogenesi in un HIV-1 individuo infetto.

Questa tecnica può essere modificato al fine di ampliare la sua utilità per diverse applicazioni. Ulteriori HIV-1 proteine ​​virali possono essere progettati nel plasmide MJ4 al fine di valutare gli effetti sulla replicazione virale e le loro interazioni con proteine ​​dell'ospite. Questo può essere ottenuto progettando restrizioni ulteriori siti in regioni desiderati nel genoma attraverso l'introduzione di variazioni nucleotidiche silenti. Tuttavia, particolare attenzione dovrà essere posta nel ingegneria siti di restrizione romanzo nel 'metà del genoma di HIV-1, come molte proteine ​​accessorie sono codificati in cornici di lettura alternati 3, e cambiamenti silenziosi in unproteine ​​potrebbe portare a sostituzioni di aminoacidi in un altro. In questo caso, il sito di restrizione metodi di clonazione indipendenti, come quelli discussi da Dudley et al. 45 può superare questo limite. Sequenze virali derivate da popolazioni diverse possono avere diversi livelli di capacità di replica, e il MOI possono essere adeguati di conseguenza al fine di catturare la maggior parte degli isolati virali all'interno della loro fase logaritmica di crescita. Infine, la linea cellulare GXR25 è stato stabilmente trasfettate con GFP sotto un LTR-driven, promotore Tat-inducibile, e la diffusione virale può essere misurata in funzione di cellule GFP positive mediante citometria a flusso 37 come alternativa al test RT qui o descritti un p24 tradizionale ELISA.

In conclusione, questo protocollo prevede una tecnica efficace e potente per la valutazione della replicazione dell'HIV-1 virale conferita dal gene gag, che codifica per una proteina strutturale conservata necessario per la corretta formazione del virione, Erba, maturazione e smontaggio 46-48. Inoltre, questa tecnica genera una replica competente plasmide clonale, che è ideale per studi di mutagenesi e, quindi, fornisce un metodo per analizzare le determinanti specifici aminoacidi di fitness virale. Studi come questi sono indispensabili per migliorare la comprensione di come l'evoluzione virale immunitario-driven colpisce patogenesi e progressione della malattia da HIV-1 in individui infettati.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
PCR Reagents
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagF2: 5' GGGACATCAAGCAGCCAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagR6: 5' CTGTATCATCTGCTCCTG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
CoolRack PCR 96 XT Biocision BCS-529
CoolRack M15 Biocision BCS-125
Nuclease free water Fisher SH30538FS Manufactured by Hyclone
QIAamp Viral RNA Mini Kit Qiagen 52906
Simport PCR 8 Strip Tubes, Blue (Flat Cap) Daigger EF3647BX
SuperScript III one-step RT-PCR system Life Technologies/Invitrogen 12574035
Phusion Hot-start II DNA polymerase Fisher F-549L
PCR Nucleotide Mix Roche 4638956001
Agarose, high gel strength Fisher 50-213-128
TAE 10X Life Technologies/Invitrogen AM9869
Promega 1 kb DNA ladder Fisher PRG5711 Manufactured by Promega
Sybr Safe DNA Gel Stain, 10,000x Life Technologies/Invitrogen S33102
Wizard SV Gel and PCR Clean-Up System Promega A9282
Razor blades, single-edged Fisher 12-640 Manufactured by Surgical Design
Thermocycler, PTC-200 MJ Research
Microbiology & Cloning Reagents
LB Agar, Miller Fisher BP1425-2
LB Broth, Lennox Fisher BP1427-2
Sterile 100 x 15 mm polystyrene Petri dishes Fisher 08-757-12
Ampicillin sodium salt Sigma-Aldrich A9518-5G
Falcon 14 ml Polypropylene round-bottom tubes BD Biosciences 352059
NgoMIV restriction endonuclease New England BioLabs R0564L
BclI restriction endonuclease New England BioLabs R0160L
HpaI restriction endonuclease New England BioLabs R0105L
T4 DNA Ligase, 5 U/μl Roche 10799009001
JM109 competent cells, >108 cfu/μg Promega L2001
PureYield plasmid miniprep system Promega A1222
Safe Imager 2.0 Blue Light Transilluminator Invitrogen G6600
Microfuge 18 centrifuge Beckman Coulter 367160
Cell Culture Reagents
Amphyl cleaner/disinfectant Fisher 22-030-394
Fugene HD, 1 ml VWR PAE2311 Manufactured by Promega
Hexadimethrine bromide (Polybrene) Sigma-Aldrich H9268-5G
Costar Plates, 6-well, flat Fisher 07-200-83 Manufactured by Corning Life
Costar Plates, 24-well, flat Fisher 07-200-84 Manufactured by Corning Life
Costar Plates, 96-well, round Fisher 07-200-95 Manufactured by Corning Life
Flasks, Corning filter top/canted neck, 75 cm2 Fisher 10-126-37
Flasks, Corning filter top/canted neck, 150 cm2 Fisher 10-126-34 Manufactured by Corning Life
Conical Tubes, 50 ml, blue cap Fisher 14-432-22 Manufactured by BD Biosciences
Conical Tubes, 15 ml, blue cap Fisher 14-959-70C Manufactured by BD Biosciences
Trypsin-EDTA Fisher MT25052CI Manufactured by Mediatech
RPMI, 500 ml Life Technologies/Invitrogen 11875-119
DMEM, 500 ml Life Technologies/Invitrogen 11965-118
Penicillin/Streptomycin/Glutamine, 100x Life Technologies/Invitrogen 10378-016
PBS with magnesium and calcium, 500 ml Life Technologies/Invitrogen 14040-133
PBS without magnesium and calcium Life Technologies/Invitrogen 20012-050
Sarstedt tubes, assorted colors Sarstedt 72.694.996
Reservoir Trays for Multichannel, 55 ml Fisher 13-681-501
DEAE-Dextran Fisher NC9691007
Corning 96 well clear V bottom tissue culture treated microplate Fisher 07-200-96 Manufactured by Corning Life
HEPES, 1 M Buffer Solution Life Technologies/Invitrogen 15630-080
FBS, Defined, 500 ml Fisher SH30070 03
X-gal VWR PAV3941 Manufactured by Promega
Glutaraldehyde, Grade II, 25% in H2O Sigma-Aldrich G6257-100ML
1 M Magnesium chloride solution Sigma-Aldrich M1028-100ML
Formaldehyde solution, for molecular biology, 36.5% Sigma-Aldrich F8775-500ML
Potassium hexacyanoferrate(II) trihydrate Sigma-Aldrich P9387-100G
Potassium hexacyanoferrate(III) Sigma-Aldrich P8131-100G
Allegra X15-R centrifuge Beckman Coulter 392932
TC10 automated cell counter Bio-Rad 1450001
VistaVision inverted microscope VWR
Reverse-Transcriptase Quantification Assay Reagents
dTTP, [α-33P]- 3000 Ci/mmol, 10 mCi/ml, 1 mCi Perkin-Elmer NEG605H001MC
1 M Tris-Cl, pH 8.0 Life Technologies/Invitrogen 15568025 Must be adjusted to pH 7.8 with KOH
2 M Potassium chloride (KCl) Life Technologies/Invitrogen AM9640G Adjust to 1 M solution
0.5 M EDTA Life Technologies/Invitrogen 15575-020
Nonidet P40 Roche 11333941103
Polyadenylic acid (Poly rA) potassium salt  Midland Reagent Co. P-3001
Oligo d(T) primer Life Technologies/Invitrogen 18418-012
Dithiothreitol (DTT) Sigma-Aldrich 43815-1G
SR, Super Resolution Phosphor Screen, Small Perkin-Elmer 7001485
Corning Costar Thermowell 96-well plate model (M) Polycarbonate Fisher 07-200-245 Manufactured by Corning Life
Corning 96-well Microplate Aluminum Sealing Tape, Nonsterile Fisher 07-200-684 Manufactured by Corning Life
DE-81 anion exchange paper Whatman 3658-915
Trisodium citrate dihydrate Sigma-Aldrich S1804-1KG
Sodium Chloride Fisher S671-3
Autoradiography cassette Fisher FB-CA-810
Cyclone storage phoshpor screen Packard

DOWNLOAD MATERIALS LIST

References

  1. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., Oldstone, M. B. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. Journal of virology. 68, 6103-6110 (1994).
  2. Koup, R. A., et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. Journal of virology. 68, 4650-4655 (1994).
  3. Jin, X., et al. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. The Journal of experimental medicine. 189, 991-998 (1999).
  4. Schmitz, J. E., et al. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science. 283, 857-860 (1999).
  5. Brumme, Z. L., et al. Marked epitope- and allele-specific differences in rates of mutation in human immunodeficiency type 1 (HIV-1) Gag, Pol, and Nef cytotoxic T-lymphocyte epitopes in acute/early HIV-1 infection. Journal of virology. 82, 9216-9227 (2008).
  6. Leslie, A. J., et al. HIV evolution: CTL escape mutation and reversion after transmission. Nature medicine. 10, 282-289 (2004).
  7. Phillips, R. E., et al. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature. 354, 453-459 (1991).
  8. Price, D. A., et al. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proceedings of the National Academy of Sciences of the United States of America. 94, 1890-1895 (1997).
  9. Goulder, P. J., et al. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nature. 3, 212-217 (1997).
  10. Tang, J., et al. Favorable and unfavorable HLA class I alleles and haplotypes in Zambians predominantly infected with clade C human immunodeficiency virus type 1. Journal of virology. 76, 8276-8284 (2002).
  11. Prentice, H. A., et al. HLA-B*57 versus HLA-B*81 in HIV-1 infection: slow and steady wins the race. Journal of virology. 87, 4043-4051 (2013).
  12. Migueles, S. A., et al. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proceedings of the National Academy of Sciences of the United States of America. 97, 2709-2714 (2000).
  13. Leslie, A., et al. Additive contribution of HLA class I alleles in the immune control of HIV-1 infection. Journal of virology. 84, 9879-9888 (2010).
  14. Kaslow, R. A., et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nature medicine. 2, 405-411 (1996).
  15. Altfeld, M., et al. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS. 17, 2581-2591 (2003).
  16. Kiepiela, P., et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nature medicine. 13, 46-53 (2007).
  17. Mothe, B., et al. Definition of the viral targets of protective HIV-1-specific T cell responses. Journal of translational medicine. 9, 208 (2011).
  18. Peyerl, F. W., Barouch, D. H., Letvin, N. L. Structural constraints on viral escape from HIV- and SIV-specific cytotoxic T-lymphocytes. Viral immunology. 17, 144-151 (2004).
  19. Rolland, M., et al. Broad and Gag-biased HIV-1 epitope repertoires are associated with lower viral loads. PloS one. 3, e1424 (2008).
  20. Wagner, R., et al. Molecular and functional analysis of a conserved CTL epitope in HIV-1 p24 recognized from a long-term nonprogressor: constraints on immune escape associated with targeting a sequence essential for viral replication. J Immunol. 162, 3727-3734 (1999).
  21. Wang, Y. E., et al. Protective HLA class I alleles that restrict acute-phase CD8+ T-cell responses are associated with viral escape mutations located in highly conserved regions of human immunodeficiency virus type 1. Journal of virology. 83, 1845-1855 (2009).
  22. Chopera, D. R., et al. Transmission of HIV-1 CTL escape variants provides HLA-mismatched recipients with a survival advantage. PLoS pathogens. 4, e1000033 (2008).
  23. Crawford, H., et al. Evolution of HLA-B*5703 HIV-1 escape mutations in HLA-B*5703-positive individuals and their transmission recipients. The Journal of experimental medicine. 206, 909-921 (2009).
  24. Boutwell, C. L., et al. Frequent and variable cytotoxic-T-lymphocyte escape-associated fitness costs in the human immunodeficiency virus type 1 subtype B Gag proteins. Journal of virology. 87, 3952-3965 (2013).
  25. Brockman, M. A., et al. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. Journal of virology. 81, 12608-12618 (2007).
  26. Crawford, H., et al. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. Journal of virology. 81, 8346-8351 (2007).
  27. Martinez-Picado, J., et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. Journal of virology. 80, 3617-3623 (2006).
  28. Schneidewind, A., et al. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. Journal of virology. 81, 12382-12393 (2007).
  29. Wright, J. K., et al. Impact of HLA-B*81-associated mutations in HIV-1 Gag on viral replication capacity. Journal of virology. 86, 3193-3199 (2012).
  30. Kawashima, Y., et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature. 458, 641-645 (2009).
  31. Goepfert, P. A., et al. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. The Journal of experimental medicine. 205, 1009-1017 (2008).
  32. Brockman, M. A., et al. Early selection in Gag by protective HLA alleles contributes to reduced HIV-1 replication capacity that may be largely compensated for in chronic infection. Journal of virology. 84, 11937-11949 (2010).
  33. Huang, K. H., et al. Progression to AIDS in South Africa is associated with both reverting and compensatory viral mutations. PloS one. 6, e19018 (2011).
  34. Wright, J. K., et al. Gag-protease-mediated replication capacity in HIV-1 subtype C chronic infection: associations with HLA type and clinical parameters. Journal of virology. 84, 10820-10831 (2010).
  35. Wright, J. K., et al. Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype. C. Journal of virology. 85, 3996-4006 (2011).
  36. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of virology. 59, 284-291 (1986).
  37. Brockman, M. A., Tanzi, G. O., Walker, B. D., Allen, T. M. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. Journal of virology. 131, 134-142 (2006).
  38. Ndung'u, T., Renjifo, B., Essex, M. Construction and analysis of an infectious human Immunodeficiency virus type 1 subtype C molecular clone. Journal of virology. 75, 4964-4972 (2001).
  39. Prince, J. L., et al. Role of transmitted Gag CTL polymorphisms in defining replicative capacity and early HIV-1 pathogenesis. PLoS pathogens. 8, e1003041 (2012).
  40. Ostrowski, M. A., Chun, T. W., Cheseboro, B., Stanley, S. K., Tremblay, M., et al. Detection assays for HIV proteins. Current protocols in immunology / edited by John E. Coligan ... [et al.]. 12, (Unit 12 15), Forthcoming.
  41. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, 61-68 (1989).
  42. Inoue, H., Nojima, H., Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene. 96, 23-28 (1990).
  43. Bichara, M., Pinet, I., Schumacher, S., Fuchs, R. P. Mechanisms of dinucleotide repeat instability in Escherichia coli. Genetics. 154, 533-542 (2000).
  44. Ackerson, B., Rey, O., Canon, J., Krogstad, P. Cells with high cyclophilin A content support replication of human immunodeficiency virus type 1 Gag mutants with decreased ability to incorporate cyclophilin A. Journal of virology. 72, 303-308 (1998).
  45. Dudley, D. M., et al. A novel yeast-based recombination method to clone and propagate diverse HIV-1 isolates. BioTechniques. 46, 458-467 (2009).
  46. Ganser-Pornillos, B. K., von Schwedler, U. K., Stray, K. M., Aiken, C., Sundquist, W. I. Assembly properties of the human immunodeficiency virus type 1 CA protein. Journal of virology. 78, 2545-2552 (2004).
  47. Forshey, B. M., von Schwedler, U., Sundquist, W. I., Aiken, C. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. Journal of virology. 76, 5667-5677 (2002).
  48. Gottlinger, H. G., Dorfman, T., Sodroski, J. G., Haseltine, W. A. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proceedings of the National Academy of Sciences of the United States of America. 88, 3195-3199 (1991).
Un enzima di restrizione metodo basato clonazione per valutare l&#39;<em&gt; In vitro</em&gt; Replica Capacità di HIV-1 Sottotipo C Gag-MJ4 chimerici virus
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).More

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter