Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Et restriksjonsenzym Basert Cloning metode for å vurdere den doi: 10.3791/51506 Published: August 31, 2014
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bestemme både vert og viral egenskaper som påvirker HIV-1 patogenesen og sykdomsutvikling er viktig for rasjonell vaksine design. Den cellulære immunrespons er en viktig del av det menneskelige immunrespons mot HIV-1-infeksjon. Cytotoksiske T-lymfocytter (CTL) som er nødvendig for den første kontroll av akutt viremi, og tillater verten for å etablere en stabil tilstand (settpunkt) virusmengde 1,2. Eksperimentell uttømming av disse effektor-celler resulterer i tap av viral kontroll 3,4. Til tross for dette, rømme mutasjoner oppstår i det virale genomet som grave CTL anerkjennelse av virusinfiserte celler 5-9.

Visse HLA-alleler har vært forbundet med lavere virusmengde og tregere sykdomsutvikling inkludert B * 57, B * 27 og B * 81 10-15. En del av den beskyttende fordelen av HLA klasse I allelene kan tilskrives det faktum at de målrette funksjonelt begrenset regioner av genomet som for eksempel Gagog selektere for rømnings mutasjoner som reduserer evnen av viruset til å replikere in vitro 16-21. Selv unnslippe fra det cellulære immunsystemet er fordelaktig for viruset i sammenheng med å velge HLA klasse I alleler, kan virkningen av disse mutasjonene har differensial konsekvenser for verten ved overføring til et HLA-umake individuelle 22,23. Derfor vil forstå virkningene av overfør HLA-assosierte rømnings mutasjoner på viral replikasjon kapasitet være viktig for å fremme forståelsen av tidlig stadium av HIV-1-patogenesen.

Mens mye fremgang har blitt gjort for å identifisere og karakterisere trenings defekter av individuelle rømnings mutasjoner assosiert med spesifikke HLA klasse I alleler 24-29, naturlig forekommende HIV-1-isolater har unike og komplekse fotavtrykk av HLA-assosierte polymorfismer, trolig som følge av HLA -mediert immun press forskjellige immunogenetic bakgrunn 30. I aporrige analyse, Goepfert et al. viste at en akkumulering av HLA-assosierte mutasjoner i de overførte Gag sekvenser avledet fra 88 akutt infiserte Zambierne var assosiert med en reduksjon i settpunktet virusmengde 31. Dette antydet at overføring av skadelige rømnings mutasjoner, spesielt i Gag, til HLA-umake mottakere gir en klinisk fordel, og kan skyldes attenuert virusreplikasjon. Fremover er det viktig å studere hvordan komplekse kombinasjoner av Gag polymorfismer innen naturlig forekommende isolater jobber sammen for å definere egenskapene til overført virus som replikasjonskapasitet, og hvor tidlig replikering kan i sin tur påvirke HIV-1 kliniske parametre og sent stadium patogenesen.

Brockman et al. Første gang påvist en sammenheng mellom replikasjonskapasitet av gag-pro sekvenser isolert ved kronisk stadium infeksjon og virusmengde i både subtype C og B-infeksjoner32-35. Den eksperimentelle metode presentert i disse studiene, men hensiktsmessig for behandlingen av in vitro replikasjonskapasitet av sekvenser avledet fra kronisk infiserte individer, har flere tekniske begrensninger og begrensninger som gjør studere HIV-1-replikasjonskapasitet i subtype C akutt infiserte individer vanskelig. Denne fremgangsmåte er avhengig av rekombinasjon av befolkningen basert PCR-amplifiserte sekvenser inn i subtype B NL4-3 provirus, som ble avledet delvis fra LAV, et laboratorium tilpasset virus lager 36. Virus generasjonen ble oppnådd ved co-transfeksjon av en CEM-baserte T-cellelinje 37 med PCR-amplikoner og fordøyd delta-gag-pro NL4-3 DNA. Denne metoden krever utvekst av virus over en periode på uker til måneder, potensielt forvrenger arten av den gjenvinnes virus lager i forhold til de virale quasispecies in vivo, og således endre måling av replikasjonskapasitet in vitro. Denne metoden jeger mer egnet for å studere kronisk infiserte individer, hvor den effektivt selekterer for virus med høyest replikative kapasitet, og hvor kloning rekke forskjellige virale varianter fra et stort antall av kronisk infiserte individer er ganske arbeidskrevende og derfor ikke er mulig. Imidlertid, innenfor en akutt infisert individ, er det vanligvis ett femtinitti varianter til stede, og dermed eliminere risikoen for å skråstille arten av den gjenvinnes virus lager, ved in vitro seleksjonstrykk, gir mulighet for en mer nøyaktig vurdering av in vitro replikasjonskapasitet. Dernest krever denne metoden recombining subtype C gag-pro sekvenser i en subtype B avledet ryggrad, og kunne introdusere ryggrad inkompatibilitet skjevheter i analysen. På grunn av disse begrensningene, må et stort antall sekvenser bli analysert for å overvinne eventuelle skjevheter innført.

Her beskriver vi en alternativ eksperimentell hensiktsach hensiktsmessig for å studere sekvenser avledet fra subtype C akutt infiserte individer. Vi bruker en begrensning enzym basert kloning strategi for å introdusere gag genet stammer fra akutt infeksjon tidspunkter av HIV-1 subtype C smittede personer inn i subtype C proviral ryggrad, MJ4. Bruken av MJ4 som et felles ryggraden i hvilken for å klone gener gag er avgjørende for analyse av undertype C-avledede sekvenser. MJ4 er avledet fra et primært isolat 38, og dermed ville være mindre sannsynlighet for å innføre skjevhet på grunn av subtype inkompatibilitet mellom ryggraden og gag-genet. I tillegg er den tilnærming for å bruke enzymbasert restriksjons kloning gjør det mulig for proviral konstruerer å bli transfektert direkte inn i 293T-celler, og for gjenvinning av en klonal viruslager identisk med det klonede gag sekvens.

Metoden som presenteres nedenfor er en høy gjennomstrømning metode for vurdering av replikasjonskapasitet av subtype C avledet Gag-MJ4kimære virus. Transfeksjon inn i 293T-celler er enkel og gjenvinning av virus tar bare tre dager. In vitro replikasjonskapasitet blir analysert på samme CEM-CCR5 basert T-cellelinje som er laget av Brockman et al. 37, men ved anvendelse av protokollen viktige modifikasjoner som er nødvendig for en vellykket replikering av subtype C MJ4 kimære virus. Bruken av et passende T-cellelinje i stedet for PBMC tillater et stort antall undertype C MJ4-kimære virus for å bli testet med høy analyse reproduserbarhet. Til slutt, ved å bruke en radioaktivt merket revers transkriptase assay for kvantifisering av virus i supernatanten er mer kostnadseffektivt enn å bruke kommersielt tilgjengelig P24 ELISA kit. Det gir også en høyere dynamisk område, som var viktig for å oppdage både dårlig og svært replikere virus innen samme analysen og for å avdekke små forskjeller i replikering mellom isolater.

Som konklusjon, har fremgangsmåten som presenteres her er tillatt forden inngående studie av replikasjonskapasitet av gag sekvenser avledet fra HIV-1 subtype C akutt infiserte individer fra Zambia, og som skrevet, kan også utvides til å studere andre subtype C smittet populasjoner. En høy grad av variasjon i replikering kapasiteter mellom ulike Gag isolater ble observert. I tillegg var vi i stand til å vise en statistisk sammenheng mellom replikasjonskapasitet av den overførte Gag og settpunkt virusmengde samt med CD4 + nedgang over en tre-års periode 39. Slike resultater reke viktigheten av å studere hvordan overførte virale egenskaper, for eksempel replikasjonskapasitet, samhandle med vertens immunsystem til å påvirke patogenesen under tidlig infeksjon og blir integrert for å utvikle effektive vaksine inngrep så vel som behandling.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Amplifikasjon av HIV-1 gag-genet fra infiserte, frosset plasma

  1. Utdrag viral RNA fra 140 mL tinte HIV-1 infiserte plasma ved hjelp av en utvinning kit.
    1. Når mulig, umiddelbart videre til cDNA syntese etter RNA ekstraksjon som gassform viral RNA gir de beste forsterkning resultater. Hvis det er mulig, sett opp PCR Master Mix for første runde DNA forsterkning og oppbevar ved 4 ° C før viral RNA ekstraksjon.
  2. Reverse-transkribere cDNA fra RNA og forsterke første runde DNA produkter ved hjelp av revers-transkriptase og en varme DNA polymerase i en ett-trinns RT-PCR.
    1. Ta RNA av -80 ° C fryseren (ved frost var nødvendig) og kort tining ved værelsestemperatur og deretter plassere i kald blokk. Overfør 5 pl av RNA i hver PCR-rør inneholdende 45 mL av konsentrat-blanding for å gi et sluttvolum på 50 pl. Umiddelbart plassere rester RNA prøver i -80 ° C fryser.
    2. Etter at enzymet er endded til den første runde PCR-konsentrat-blanding (tabell 1A), 45 pl alikvot inn i hvert tynnvegget PCR amplifikasjon rør for antall ønskede reaksjoner. Sørg for å bruke PCR-rør med individuelle caps og ikke strippe caps for å sikre minimal krysskontaminering mellom prøvene. Plasser PCR-rør i en kald blokk for å beskytte det temperaturfølsomme RT enzym og RNA-malen. Merk: Prøvene skal kjøres i tre eksemplarer for å tilstrekkelig smake de virale quasispecies. Det er også viktig å benytte et produkt med en high fidelity DNA polymerase enzym for å minimalisere PCR-introdusert misincorporation. Vennligst referer til listen reagenser for anbefalt produkt.
    3. Etter RNA malen er lagt til alle reaksjonsrørene, overføre PCR-rør til en thermocycler for forsterkning ved hjelp av cycler programmet som er beskrevet i Tabell 1B. Merk: Produktet av denne forsterkning vil bli brukt i en andre runde nestet PCR.
  3. Utfør en nestet sekond-runde PCR-amplifisering ved å bruke 1 pl av den første runde PCR-amplifisering (1.2) som DNA-templat.
    1. Delmengde 49 mL av andre-runde PCR Master Mix (tabell 2A) til hver tynnvegget PCR rør for antall reaksjoner ønsket. Overføring 1 pl fra den første runde PCR-amplifisering til hvert reaksjonsrør for å gi et sluttvolum på 50 pl. Merk: Dette vil fungere som mal DNA for andre-runde forsterkning. Det er også viktig å utnytte en DNA polymerase med svært high fidelity og korrekturlesing evner for å minimere PCR-introdusert misincorporation. Vennligst referer til listen reagenser for anbefalt produkt.
    2. Overfør andre-runde PCR reaksjon mix å Termocycler og kjøre programmet som er beskrevet i Tabell 2B. Merk: Etter fullførelse av programmet, vil produktene av denne reaksjon bli kjørt på en agarosegel for å bekrefte produksjon av produktet.
  4. Tilsett 3 mL av 5x lasting fargestoff til 5 & #181; l av 50 mL andre-runde reaksjon volum og kjøre på 120 V på en 1% agarose-TAE gel som inneholder en UV-fluorescerende DNA flekken til band er løst. Visual 1,6 kb band på et blått lys lys (se figur 1A).
  5. Kjør de resterende 45 mL reaksjon volum på en 1% agarose-TAE gel som inneholder en DNA flekken, Vesenet de aktuelle band med en ren barberblad.
    1. Ekstraher DNA fra gelen skive ved hjelp av en gel-rensing kit, elueres i nuclease-fritt vann, kombineres tre positive reaksjoner per individ, og fryse produktet ved -20 ° C for etterfølgende bruk.

2. Å kneble amplikonene for Kloning ved innføring av nødvendig restriksjonsseter

  1. Forsterke Long Terminal Repeat (LTR) / 5 'UTR del av MJ4 plasmid (se tabell 3).
  2. Visual 1.3 kb PCR produktene på lyset, avgifter positive amplikonene, gel rense og fryse som tidligerebeskrevet (1.4,1.5, se figur 1B).
  3. Create smeltet MJ4 LTR- gag amplikonene via "forlengelse spleise-overlapp-" PCR (se tabell 4).
  4. Visualisere, avgiftsdirektoratet, rense og fryse 3,2 kb amplikonene som i 1.4,1.5 (se figur 1C).

3. Cloning Amplified gag gener i den MJ4, Undergruppe C, Infeksiøs Molecular Clone

  1. Fordøy 1.5 pg av plasmid MJ4 og 1,5 mikrogram av renset LTR- GAG PCR-produkt med den BclI (metylering sensitive) restriksjonsendonuklease i 1,5 timer ved 50 ° C (se tabell 5A).
  2. Tilsett 1 mL av NgoMIV til digereringsreaksjon, og inkuberes ved 37 ° C i 1 time.
  3. Legg 5x lasting fargestoff til begrensning fordøye reaksjoner og sakte electrophorese det totale volumet på en 1% agarose-TAE gel som inneholder en DNA gel flekken i 1-2 timer ved 100 V. visualisere, avgifter og rense indikert band for kloning som tidligere synkenderibed (se figur 2).
  4. Forbered ligation reaksjoner bruke renset LTR- gag innsats og MJ4 vektor-DNA på en 3: 1 Sett til vektor ratio. Inkuber ligation reaksjoner natten ved 4 ° C (se tabell 5B).
  5. Transform JM109 kompetente bakterier kjemisk med ligation produkter og spredt på LB-agar-plater med 100 ug / ml ampicillin og vokse ved 30 ° C i 22 + timer.
    1. Tin JM109 kompetente celler på is i 15 min. Etikett 1,5 ml mikrosentrifugerør og chill på is.
    2. Delmengde 50-100 mL av JM109 celler til pre-kjølt 1,5 ml mikrosentrifugerør. Legg 2,5-5 mL av ligation reaksjon på JM109 celler, flicking tube lett å blande og umiddelbart returnere til isen. Inkuber kompetente celler med ligerings produktet på is i 30 min.
    3. Termisk sjokk 1,5 ml mikrosentrifugerør inneholdende JM109 kompetente celler og ligerings-reaksjon i en 42 ° C varmeblokk i 45 sek og vender tilbake til is i minst 3 min.
    4. Tilsett 50 pl av SOC-mediet til hver mikrosentrifugerør og plate hele transformasjon reaksjon på romtemperatur LB-agar-plater supplert med 100 ug / ml ampicillin.
    5. Overfør platene til en 30 ° C inkubator og la stå i 20 timer, eller til koloniene er tydelig dannet.
  6. Pick isolerte kolonier og vokse i 4 ml LB med 100 ug / ml ampicillin ved 30 ° C i 22 + timer.
  7. Spinn ned kulturer på 3200 xg i 15 min, hell av kjøttkraft, og trekke ut plasmid DNA.
  8. For å bekrefte kloning fidelity, kuttet miniprep DNA med NgoMIV og HpaI restriksjonsenzymer i en dobbel fordøye ved 37 ° C i 2 timer. Analyser på 1% agarose-TAE gel (se tabell 5C).
  9. Sekvens LTR-gag innsats regionen hver plasmid med følgende primere: GagInnerF1, GagF2, REV1, rev3, og GagR6 (tabell 6) for å bekrefte sekvens identitet.
  10. Sammenligne de klonede sekvenser oppnådd med befolkningen sekvenser derived fra den første renset fragment frå 1.5.1. Merk: Det er viktig å vurdere slutt replikasjonskapasitet på to uavhengige kloner for å sikre at eventuelle in vitro gjentagelse fenotyper ikke er på grunn av ryggraden feil introdusert under kloningsprosessen.

4. generasjon og Titering av replikasjonskompetente gag-MJ4 Chimerisk virus

  1. Generer replikering kompetente virus ved transfeksjon av 1,5 ug av det chimeriske MJ4 plasmid miniprep DNA inn i 293T-celler ved bruk av en 4: 1 forhold av Fugene HD som beskrevet av Prince et al 39.
  2. Titer høstet virus aksjene på TZM-bl celler som er beskrevet nedenfor og i Prince et al 39.
    1. Plate TZM-bl celler 24 hr før infeksjon med virus for å ha en 30-40% konfluent cellemonolag på neste dag. Dette kan vanligvis oppnås ved tilsetning av 5 x 10 4 celler i et totalvolum på 800 ul per brønn i en 24-brønns plate.
    2. Etter tilsetning av celler til brønnen, forsiktig flytte 24-brønns plate frem og tilbake, og deretter sideveis for å effektivt fordele cellene. Aldri virvel - dette vil resultere i celler akkumulert seg i midten av platen.
    3. Dagen etter, forberede 1% FBS i DMEM; Dette vil bli brukt til å fortynne DEAE-Dextran og fortynne virusbestander. Lager DEAE-Dextran 10 mg / ml eller 125x, og en sluttkonsentrasjon på 80 pg / ml eller 1x er ønsket.
    4. Ta ut virus lager som skal testes fra -80 ° C fryser og stedet på shaker å tine ved romtemperatur.
    5. Ved hjelp av en flerkanals pipette, serielt fortynne virusstammene i en rundbunnet vev kultur behandlet 96-brønns plate med lokk. Dette er en 3-gangers fortynning protokoll. Se tabell 7 for fortynning ordningen.
    6. Ta ut mediet fra seeded TZM-bl 24-brønners plater ved hjelp av et vakuum aspirator sørge for ikke å forstyrre cellemonolag. Fjerne bare media fra en 24-brønns plate om gangen, slik at celler gjørikke tørke ut.
    7. Tilsett 150 pl av den 1x DEAE-Dextran + 1% FBS i DMEM blandingen i hver brønn ved bruk av en 1000 mikroliter pipette. Ikke bruk gjenta pipette da dette forstyrrer monolayer.
    8. Tilsett 150 ul av hver virus fortynning til passende godt. Legg virus til midten av brønnen og virvel forsiktig for å fordele virus på tvers av cellemonolaget. Inkuber infiserte celler i 2 timer i en vevskultur inkubator ved 37 ° C og 5% CO2.
    9. Etter 2 timers inkubering, tilsett 0,5 ml 10% FBS i DMEM til hver brønn og platene går tilbake til inkubatoren i ytterligere 48 timer.
    10. Etter 48 hr, bør cellene være 100% sammenflytende. Fordi MJ4 er en replikasjonskompetente virus, vil det være noen celledød, men dette er å forvente.
    11. Ta ut mediet fra hver brønn og tilsett 400 mL / brønn fikse løsning (se tabell 8A for oppskrift). Løs bare en plate om gangen. Legg fikse løsning ved hjelp av en 1000 mL pipette, og la sitte i 5 min vedromtemperatur.
    12. Fjern fikserløsning og vask 3 ganger med PBS med Ca 2 + / Mg 2 +. Bruk en sprut flaske å tilsett PBS til siden av brønnen for å unngå å forstyrre monolag. Etter tredje vask, blot plate tørr på absorberende papir.
    13. Tilsett 400 ul / brønn av farvestoffoppløsningen (se Tabell 8B for oppskriften) til hver brønn av 24-brønns plate og inkuberes ved 37 ° C i minst 2 timer. Lengre inkubasjonstider er akseptabelt, men inkubasjonstid bør holdes konsekvent mellom titering eksperimenter.
    14. Vask 2x med PBS med Ca 2 + / Mg 2 + og scorer for infeksjon, eller legge PBS og oppbevar ved 4 ° C for scoring senere. Platene kan holdes ved 4 ° C i opp til fire dager, så lenge den monolaget holdes hydrert.
    15. Å score for infeksjon, kan du bruke en permanent markør for å dele brønnene i 24-brønns plate inn i kvadranter. Telle alle blå celler i et synsfelt, med en total forstørrelse på 200X, en gang ihver av de fire kvadranter av en brønn.
    16. Beregn Smittsomme Enheter per mikroliter, som følger: [(# blå celler / 4) x 67] / (mL virus lagt) = IE / mL. Se Tabell 8C for volum i ul virus tilsatt til hver brønn. Gjennomsnittet flere brønner sammen; tallene bør være relativt lik for en nøyaktig titrering.

5. Utarbeidelse av Culture Media og Propagation of GXR25 Cells for in vitro Replication analysen

  1. Forbered komplett RPMI (cRPMI) for spredning av GXR25 celler. MERK: Det er ekstremt viktig å kultur GXR25 celler i minst fire måneder før planlagt replikering eksperimenter (se tabell 9).
  2. Split celler 1:10 to ganger per uke og opprettholde celletetthet mellom 1 x 5-2 oktober x 10. 6 celler / ml.

6. In vitro Replication av Gag-MJ4 hjernespinn i GXR25 (CEM-CCR5-GFP) Celler

  1. Dagen før jegnfection, splitte cellene til en konsentrasjon mellom 2-3 x 10 5 celler / ml, slik at de er i logaritmisk vekst på dagen for infeksjonen.
  2. På dagen for infeksjon, fjerne virus aksjer fra -80 ° C fryser og tiner. Beregn volum av virus nødvendig fra hvert lager basert på IU / mL titer fra TZM-bl celle assay for å infisere 5 x 10 5 GXR25 celler ved en multiplisitet for infeksjon på 0,05, med formelen:
    Volum av virus for infeksjon (mL) = 1 mL / X IE x 0,05 x 500.000
    MERK: Vi har valgt en MOI på 0,05, da dette resulterer i en logaritmisk vekstfase for alle de virus som vi har testet. Det er viktig å utføre innledende forsøk for å bestemme den optimale MOI for å fange logaritmisk vekst for at viruset skal bli testet.
  3. Fortynn virus i cRPMI til et volum på 100 ul (for å oppnå en 0,05 MOI) og tilsett til en brønn av en V-bunn vevskultur behandlede 96-brønns plate. Merk: Ta med både en posive (MJ4 WT infiserte) og en negativ (mock-infiserte celler) kontroll i hvert sett av eksperimenter replikering. Sett opp platen slik at alle andre kolonnen er tomt for å begrense krysskontaminering mellom brønnene. Den positive kontrollen er viktig, ettersom det vil bli brukt senere som en standard for å normalisere replikering bakker, som er et mål for frekvensen av replikering eksperimentelle replikater.
  4. Count GXR25 celler ved hjelp av en automatisert celleteller. Beregn det antall celler som trengs totalt for alle infeksjoner (5 x 10 5 x # infeksjoner). Alikvot nødvendig volum til en 50 ml konisk rør og sentrifuger for å pelletere cellene. Alltid beregne for 25% flere infeksjoner enn nødvendig.
  5. Aspirer media nøye og resuspender i cRPMI i en konsentrasjon på 5 x 10 5 celler / 100 mikroliter.
  6. Pipette celler i en steril trau og bland godt. Ved hjelp av en flerkanals pipette, tilsett 100 ul celler til hver brønn på 96-brønners plate inneholdende fortynnet virus. Mix grundig.
  7. Tilsett 2 pl av 5 mg / ml (100x) oppløsning av polybren til hver brønn og cellene bland grundig.
  8. Inkuber ved 37 ° C i vevskultur-inkubator med 5% CO2 i 3 timer.
  9. For å vaske infiserte celler, til sentrifuge 96-brønners V-bunn-plate pelletere cellene. Deretter forsiktig fjerne 150 pl av mediet og erstatte med frisk 150 ul cRPMI uten å forstyrre cellepelleten. Gjenta 2 ganger (inkludert sentrifugering) å vaske cellene tilstrekkelig.
  10. Etter den siste sentrifugering og tilsetning av 150 pl cRPMI, cellepelleten suspenderes med en multikanal pipette og legge hele cellen / virus-blanding (ca. 200 ul) fra hver brønn uavhengig til 800 pl av cRPMI i en brønn av en 24-brønn vev kultur plate.
  11. Sett platen i 5% CO2 vevskultur inkubator ved 37 ° C.
  12. Annenhver dag, fjerne 100 mL av supernatant fra overflaten av kulturen godt og overføre til en 96-brønns U-bottom plate og butikken fryses ved -80 ° C inntil kjører virus kvantifisering analysen. MERK: Forsiktig arrangement av supernatanter i 96-brønners plater vil gi rom for flerkanals pipette overføring av kultur-supernatanter under virion kvantifisering via en radioaktivt merket revers transkriptase (RT)-assay. Hver plate bør inneholde prøver fra en infeksjon standarden for å normalisere inter-plate variasjon i RT-analysen avlesning.
  13. Etter fjernelse av hver 100 ul prøve, delt celler 1: 2 ved grundig nytt oppslemme cellene og fjerning av halvparten av det gjenværende volum (450 ul). Restore opprinnelige volum (1 ml) ved tilsetning av 550 ul av frisk cRPMI til hver brønn.

7. Analyse av revers transkriptase (RT) i cellekultur Supernatanter

Protokoll tilpasset fra Ostrowski et al 40.

  1. Sett opp biologisk sikkerhet hette i en BSL-3 anlegg for bruk med radioaktivt materiale.
    1. Plasser absorberende papir i hood og erstatte aspirator for aspirator utpekt for radioaktiv bruk. Merk: Alle radioaktivt avfall skal kastes på forsvarlig måte med henhold til sikkerhetsforskrifter.
  2. Legg 1-2 pl av 10 mCi / ml av [α- 33 P] dTTP og 4 ul av 1 M ditiotreitol (DTT) til hver 1 ml aliquot av RT konsentrat-blanding (se tabell 10 og Ostrowski et al. 40).
  3. Bland forsiktig hver 1,5 ml mikro tube RT mester mix, DTT, og [α- 33 P] dTTP med en 1000 mL pipette og overføring til en steril trau.
  4. Tilsett 25 pl av merket RT blande inn i hver brønn av 96-brønns tynnvegget PCR-plate. Merk: Ta med plass for en positiv kontroll (MJ4 WT-infeksjon) og negativ kontroll (Mock infeksjon).
  5. Tilsett 5 ul av hver supernatant til PCR-plate som inneholder RT konsentrat-blanding.
  6. Forsegl PCR-plate med klebefoliedeksel og inkuberes i 2 timer ved 37 ° C i en thermocycler. Av sikkerhetsmessige grunner, rinSE pipetter med Amphyl og kast tips i liten beholder som inneholder Amphyl avfall, som senere vil bli avhendet i radioaktivt avfall.
  7. Etter inkubasjon foreta små hull i folien ved hjelp av et deksel 200 ul flerkanals pipette. Merk: Hvis pipetter berøre flytende i vel, erstatte tips før du går til neste kolonne eller rad.
  8. Bland prøvene 5x og overføring 5 ul av hver prøve til DE-81-papir. Air tørke 10 min.
  9. Vask blots 5x med 1x SSC (natriumklorid, natrium-citrat), og deretter 2 x med 90% etanol ved 5 min per vask. La det lufttørke.
    1. Plasser hver blot i en separat vaskebeholder, slik som en sandwich oppbevaringsboks, legger nok vaskebuffer (1 x SSC og 90% EtOH) for å dekke blot, og rist i 5 min.
    2. Hell av vaskebuffer i egen beholder og gjenta. Merk: De første 3 vasker anses radioaktivt og skal behandles som spesialavfall. Kan kastes de siste 2 vasker av regelmessig.
  10. Når tørr, bilefully vikle blot i Saran vikle og utsettes for en phosphoscreen i en tett forseglet kassett over natten i romtemperatur.
  11. Analyser phosphoscreens med phosphorimager og kvantifisere radioaktive transkripsjoner.
  12. Tegn en sirkel rundt hver radioaktivt signal ved hjelp OptiQuant programvare. Graf Digital Light Unit (DLU) verdier for å generere replikering kurver.
  13. For å generere replikasjonskapasitet score, DLU verdier var log 10-transform og bakkene ble beregnet ved hjelp av dag 2, 4 og 6 tidspunkter. Replikering bakkene er deretter delt på skråningen av WT MJ4 i ordre generere replikasjonskapasitet score. Det er viktig å normal basert på MJ4 WT verdiene oppnådd fra den samme RT-plate for å redusere intra-assay variabilitet.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

For å kunne utføre denne protokollen, som skaper en proviral plasmid stand til montering fullt funksjonelle, smittsomme Gag-MJ4 hjernespinn, må det utvises stor forsiktighet for å generere de riktige PCR amplikonene. Fastslå om PCR har generert riktig størrelse gag amplicon er avgjørende. Produktene bør være innenfor 100 basepar (bp) av omtrent 1700 bp fragment vist i figur 1A. Den nøyaktige lengden av dette fragment vil variere avhengig av gag-genet under studien. Deretter må den 5 'lang terminal repeat (LTR)-delen av MJ4 molekylær klon bli amplifisert og spleiset til gag-fragment for å gjøre det egnet for etterfølgende kloning. Den MJ4 LTR amplicon bør være 1474 bp i lengde. Figur 1B viser en representativ gel image som riktig båndstørrelser er angitt. Etter-overlapp-utvidelse spleise PCR 41, bør kombineres LTR- gag produkter væreomtrent 3200 bp i lengde, som vist i figur 1C.

Når gag-genet er blitt gjort egnet for kloning ved fusjon til den 5 'LTR fra MJ4, som inneholder den nødvendige NgoMIV restriksjonssete, både vektor og gag innsatsen må være spaltet med NgoMIV og BclI-restriksjonsenzymer og fjernes fra en agarosegel etter elektrofore separasjon. Det er viktig å skjære de riktige vektor og innsats band. En representativ gel er vist i figur 2. Vektoren delen av MJ4 plasmidet bør være omtrent 10 000 bp i lengde, mens LTR- gag innsatsen bør forbli ved omtrent 3000 bp i lengde, ettersom de restriksjonsseter er lokalisert ved de ekstreme endene amplikonet. Enhver betydelig reduksjon i størrelse vil indikere en ytterligere kutt-området innen gag-genet under studien.

Etterfølgende ligering av de to fragmenter, bakteriell transformasjon, etnd isolering av plasmid-DNA, må Gag-MJ4 kimærer bli sjekket for hensiktsmessig størrelse, ved å utføre en dobbel fordøye med NgoMIV og HpaI restriksjonsenzymer. Full-lengde Gag-MJ4 kimærer som ikke er inntruffet noen delesjonshendelser under bakteriell replikasjon bør ha et restriksjonsmønster lik den som er avbildet i figur 3, med to bånd på omtrent 8700 og 4300 bp.

En viktig forskjell av denne protokollen, sammenlignet med tidligere tilnærminger, er bruken av HIV-1 subtype C infeksiøs molekylær klon, MJ4, i stedet for den mer vanlige laboratorie-tilpasset NL4-3 virus. Imidlertid kunne de tilnærmingene som er beskrevet i forrige avsnitt endres for kloning av subtype B gag sekvenser inn pNL4-3.

En optimalisering av mangfoldet av infeksjon (MOI) for bruk i etterfølgende forsøk ble utført for å velge det ideelle MOI som viste logaritmisk vekst av et flertall av de virus som ble testet.Figur 4 viser representative kurver replikering fra tre forskjellige mois (0.01, 0.05, og 0.25) for MJ4 (figur 4A) samt for NL4.3 (figur 4B). MJ4 replikerer mye mindre effektivt i GXR25 celler enn NL4-3, noe som er viktig å ta hensyn til, som en MOI passer for NL4-3 replikering vil trolig være for lav til å oppdage effektive MJ4 replikering. Som vist i figur 4A, en MOI på 0,05 i motsetning til 0,01 eller 0,25, var det ideelle valg, fordi logaritmisk vekst ble observert mellom 2-6 dager etter MJ4. For den nedre MOI, 0,01, dag 6 DLU verdier er knapt synlig, og vi forventet generering av Gag-MJ4 kimære virus som reproduserte lavere enn MJ4. Derfor vil ikke denne MOI fange veksten av de svekkede Gag-MJ4 kimærer, som også kan være den mest biologisk kritisk. I tillegg kan en MOI på 0,25 var ikke ideell, fordi den raske kinetikk av viral replikasjon drept en betydelig amount av cellene selv etter dag 4. Dette fører til at replikering kurve til platået, og beregne en skråning basert på en kurve som dette ville undervurdere replikasjonskapasitet. Basert på kurver generert for NL4-3, selv på en MOI på 0,01, har tilgjengelige celle mål blitt merkbart utmattet av dag 6 etter infeksjon. Som konklusjon, ble en MOI på 0,05 funnet å være optimal for et stort panel av Gag-MJ4 kimære virus, som alle har hatt forskjellige Gag sekvenser og varierende grad av replikasjon.

Totalt 149 Gag-MJ4 kimære virusene avledet fra akutt subtype C Gag-sekvenser har blitt testet for in vitro replikasjon ved hjelp av denne analysen. De normaliserte rc-verdier varierte fra 0,01 til over 3,5 med noen virus replikerende mer enn 100 ganger mer effektivt enn villtype-MJ4. Figur 5 viser de replikasjonskurvene fra ni representative Gag-MJ4 kimære virus, med vill-type MJ4 avbildet i rødt, og viser det store omfanget av replikering capacities observert. Således kan sekvensen mangfold innenfor gag-genet alene drastisk påvirke evnen av viruset til å replikere in vitro. Selv om dette er representativt for Gag-MJ4 kimære virus som stammer fra akutt infiserte zambiere, andre subtype C sekvenser har ikke blitt grundig testet, og kan fremvise forskjellige replikering kinetikk. Derfor må det utvises stor forsiktighet for å optimalisere MOI for å passe den bestemte replikering av virusene i en bestemt undersøkelse, fordi det kan være en rekke i nivåene av replikasjon mellom forskjellige HIV-1-ryggrader og Gag-isolater.

En av fordelene ved å bruke en T-cellelinje som for eksempel GXR25 cellelinje, som støtter replikering av MJ4, er nivået av reproduserbarhet observert i forhold til replikering eksperimenter ved hjelp av stimulerte perifere mononukleære celler som mål. I innledende optimalisering eksperimenter, MJ4 villtype utstilt en intra-assay variasjon på 8,7%, og different kloner av samme Gag-MJ4 kimære virus viste variasjon i replikasjon av 8,5%. Fordi ulike Master Mix og phosphoscreen eksponering kan gi DLU verdier som skiller seg litt i størrelse, kan intra-assay variasjonen ytterligere kontrolleres ved å kjøre det samme viruset standard (i vårt tilfelle villtype MJ4) i hver RT analysen plate. Figur 6 grafer DLU verdier avledet fra samme MJ4 infeksjon, kvantifisert i åtte forskjellige RT plater. Normalisering til et virus som er felles for alle RT-analyser kan bidra til å redusere potensiell feil indusert av disse små endringer i signalstørrelsesorden mellom assayer.

Inter-assay løst ble også testet og replikerer gjentas på ulike dager var sterkt korrelerte. Figur 7 tomter de normalis RC poengsum verdier fra to uavhengige eksperimenter utført omtrent ett år fra hverandre. En høy grad av korrelasjon med fravær av store utliggere (R 2 = 0,873) ble observert between de to uavhengige replikater.

Selv sterkt korrelert, det er noen variasjon i den totale størrelsen av replikasjonskinetikken mellom de to uavhengige eksperimenter. Dette kan tilskrives delvis til forskjellen i passasjen Tallene mellom GXR25 celler aksjer som brukes i hvert forsøk. Generelt GXR25 celler bestander som er passaged for en tidsperiode som er større enn 6 måneder har en tendens til å støtte en mer effektiv replikasjon av Gag-MJ4 kimærer. Derfor er det tilrådelig å vurdere replikasjonskapasitet blant grupper av hjernespinn innen en måned tidsramme. Når de foregående trinnene blir fulgt, er denne analysen stand til å produsere meget robuste og reproduserbare resultater, som er anvendelig til en lang rekke undersøkelser.

Figur 1
Figur 1. Representant gel images som viser elektro separasjon av PCR produktene. For alle PCR-produkter, ble 5 mL av hver 50 mL reaksjon blandet med 3 mL av 5x lasting fargestoff, lastet inn i en 1% agarose-TAE gel supplert med 1X SYBR-sikker DNA gel flekken, og adskilt ved elektroforese ved 120 V i 45 min. The Promega 1 kb DNA-stige (Felt 1) ble brukt til tilnærmet amplikon størrelser. A) gag-genet ble amplifisert fra viral RNA ved bruk av en nestet PCR metode. På grunn av innsettinger og delesjoner, kan gag amplikon variere fra 1,600-1,700 bp i lengde, og ser ut til noe over 1500 bp DNA-stige markør. Baner 2-5 avbilder vellykket gag genamplifikasjon. B) 5 'LTR av MJ4 ble amplifisert fra villtype MJ4 plasmid og visualisert via elektroforetisk separasjon. Lanes 2-5 skildre vellykket forsterkning av 1474 bp LTR produkt, som vises litt under 1500 bp DNA stigen markør. C) 5R17; LTR stammer fra villtype MJ4 og gag-genet forsterket fra pasient plasma er smeltet sammen via forlengelse spleise-overlapp-PCR og visualisert via elektro separasjon. Lanes 2-5 skildre hell smeltet amplikonene som er ca 3200 bp i størrelse, og som frem litt over 3000 bp DNA ladder markør.

Figur 2
Figur 2. Representative gel bilde som viser elektroforetisk separasjon av restriksjons digests for kloning av pasient gag gener i MJ4. Wild-type MJ4 plasmid og LTR- gag-fusjons produkter ble fordøyd med BclI i 1,5 timer ved 50 ° C og NgoMIV i 1 time ved 37 ° C. Vektor og innskutte fragmenter ble visualisert via elektro separasjon på en 1% agarose-TAE gel supplert med 1X SYBR-sikker DNA gel flekk ved 100 V i 2 timer, og ved hjelp av en blå lys-lys for å redusere UV-indusert DNA-skade. Vektor og innskutte fragmenter egnet for påfølgende kloning trinn vises på ca 10.000 bp og 2900 bp hhv.

Figur 3
Figur 3. Representative gel bilde som viser elektroforetisk separasjon av restriksjons fordøyinger av renset Gag-MJ4 chimera plasmid DNA. Renset Gag-MJ4 chimera plasmid DNA ble dobbelt-spaltet med HpaI NgoMIV og restriksjonsenzymene i 2 timer ved 37 ° C. Restriksjons fordøyinger ble visualisert via elektroforetisk separasjon på en 1% agarose-TAE-gel supplert med 1X SYBR-sikker DNA gel flekk ved 120 V i 45 min. Plasmider uten store slettinger vil løse to forskjellige band på ca 8700 og 4300 bp.


Figur 4. Replikering av MJ4 og NL4-3 isolater av HIV-1 i GXR25 cellelinje på forskjellige multiplicities av infeksjon (MOI). 5 x 10 5 GXR25 celler ble infisert som beskrevet i metoden protokoll med 5-ganger økende MOI av hver virus lager. Supernatanter ble oppsamlet på dagene 2, 4, 6 og 8 etter infeksjon og virion produksjonen ble kvantifisert via en radioaktivt merket revers transkriptase assay. Infeksjoner ble kjørt i tre eksemplarer og feilfelt betegne standardavvik for de tre gjentak. (A) MJ4 (B) NL4-3.

Figur 5
Figur 5. Representant spekter av replikering for ulike Gag-MJ4 hjernespinn. 5 GXR25 celler infisert med vill-type eller MJ4 Gag-MJ4 kimærer ved en MOI på 0,05, ble supernatantene oppsamlet ved to dagers intervaller etter infeksjon, og virion produksjon kvantifisert ved en radiomerket RT-analysen. Innsetting av ulike subtype C avledet gag gener kan ha en dramatisk innvirkning på replikering kapasitet på MJ4. Villtype MJ4 replikering er merket med rødt.

Figur 6
Figur 6. Sammenligning av intra-assay variasjon i radiomerket revers transkriptase (RT) kvantifisering assay. Grafen viser iboende intra-assay variabilitet ved å plotte de DLU verdier av de samme supernatantene fra en enkelt villtype MJ4 infeksjon i åtte forskjellige RT-analysen platene. Variasjonen i kurver reflekterer de små endringer i signal magnitude betlom plater, som kan korrigeres for ved å kjøre en standard på hver RT plate, som kan senere brukes til å normalisere bakken av Gag-MJ4 hjernespinn analysert på samme plate.

Figur 7
Figur 7. Reproduserbarhet av replikering assay over tid i GXR25 cellelinje. Samme Gag-MJ4 kimære virusene ble anvendt for å infisere celler GXR25 i to uavhengige eksperimenter utført omtrent ett år fra hverandre. Replikering skår ble generert ved å beregne stigningstallet for log-transformeres DLU verdier og normalisering som skråner til villtype MJ4. Gag-MJ4 hjernespinn som kopierer mer effektivt enn villtype MJ4 har replikering score større enn 1, og de som replikere mindre effektivt enn villtype MJ4 har replikering scorer mindre enn 1. De to uavhengige målinger er sterkt korrelerte (R2 = 0,87, lineær regresjon) og merke reproduserbarheten av analysene utført på forskjellige tidspunkter, og med cellene ved forskjellige passasjer.

A)

Reagens Volum for 1x reaksjon (ul)
2x Reaction Mix (Invitrogen) 25
Nukleasefritt H 2 O 17
Forward primer GOF (20 mikrometer konsentrasjon) 1
Revers primer VIFOR (20 mikrometer konsentrasjon) 1
Super III Ett-trinns Enzyme Mix 1
RNA mal 5
Totalt volum 50

B)

Antall sykluser Tid (t: min: sek) Temperatur (° C)
1 01:00:00 50
1 02:00 94
10 00:15 94
00:30 56
05:00 68
40 00:15 94
00:30 56
05:00 + 5 sek / syklus 68
1 12:00 68
1 4
END

Tabell 1. A) Master mix og B) gag forsterkning. * Merk: GOF primer sekvens: 5'-ATTTGACTAGCGGAGGCTAGAA-3 '. Vifor primer sekvens: 5'-TTCTACGGAGACTCCATGACCC-3 '.

A)

Reagens Volum for 1x reaksjon (ul)
Nukleasefritt H 2 O 35.5
5x Phusion HF Buffer 10
dNTPs (40 mm deoksynukleotider) 1
Forward primer GagInnerF1 (20 mikrometer konsentrasjon) 1
Revers primer BclIDegRev2 (20 mikrometer konsentrasjon) 1
Phusion Hot Start II Polymerase 0.5
Første runde PCR som mal 1
Totalt volum 50

B)

Antall sykluser Tid (t: min: sek) Temperatur (° C)
1 00:30 98
29 00:10 98
00:30 53
01:00 72
1 10:00 72
1 4
END

Tabell 2. A) Master mix og B) Termocycler vilkår for nestet andre-runde gag forsterkning. * Note: GagInnerF1 primer sekvens: 5'-AGGCTAGAAGGAGAGAGATG-3 '. BclIDegRev2 primer sekvens: 5'-AGTATTTGATCATAYTGYYTYACTTTR-3 '.

A)

Reagens Volum for 1x reaksjon (ul)
Nukleasefritt H 2 O 35.5
5x Phusion HF Buffer 10
dNTPs (40 mm deoksynukleotider) 1
Forward primer MJ4For1b (20 mikrometer konsentrasjon) 1
Revers primer MJ4Rev (20 mikrometer konsentrasjon) 1
Phusion Hot Start II Polymerase 0.5
MJ4 plasmid som templat (10 ng / ul) 1
Totalt volum 50

B)

Antall sykluser Tid (t: min: sek) Temperatur (° C)
1 00:30 98
29 00:10 98
00:30 58
00:45 72
1 10:00 72
1 4
END

Tabell 3. A) Master mix og B) Termocycler vilkår for 5 'MJ4 LTR forsterkning. * Merk: MJ4For1b primer sekvens: 5'-CGAAATCGGCAAAATCCC-3 '. MJ4Rev primer-sekvensen: 5 '-CCCATCTCTCTCCTTCTAGC-3 '.

A)

Reagens Volum for 1x reaksjon (ul)
Nukleasefritt H 2 O 34.5
5x Phusion HF Buffer 10
dNTPs (40 mm deoksynukleotider) 1
Forward primer MJ4For1b (20 mikrometer konsentrasjon) 1
Revers primer BclIRev (20 mikrometer konsentrasjon) 1
MJ4 LTR 1.3 kb amplicon (Gel renset, ~ 50 ng) 1
Phusion Hot Start II Polymerase 0.5
Gag amplicon (Gel renset, ~ 100 ng) 1
Totalt volum 50

B)

Antall sykluser Tid (t: min: sek) Temperatur (° C)
1 00:30 98
29 00:10 98
00:30 58
01:30 72
1 10:00 72
1 4
END

Tabell 4. A) Master mix og B) Termocycler vilkår for forlengelse spleise-overlapp-PCR for å generere LTR- gag inserts. * Merk: BclIRev primer sekvens: 5'-TCTATAAGTATTTGATCATACTGTCTT-3 '

A)

Reagens Volum for 1x reaksjon (ul) Inkubasjonstid (HR) Inkubasjon Temperatur (° C)
1,5 mikrogram av 3 kb LTR- gag amplicon eller MJ4 plasmid x ul for 1,5 mikrogram
NEB CutSmart Buffer (tidligere NEB Buffer # 4) 2
BclI restriksjonsenzym 1
Nukleasefritt H 2 O x
Totalt volum 19 1.5 50
NgoMIV begrensning enzym 1
Totalt volum 20 1 37

B)

Reagens Volum for 1x reaksjon (ul) Inkubasjonstid (HR) Inkubasjon Temperatur (° C)
50 ng cut MJ4 plasmidvektor x ul for 50 ng
45 ng cut LTR- gag innsatsen (3: 1 ratio) x mL for 45 ng
Roche 10x ligasebuffer 2
Roche T4 DNA-ligase (5 U / ul) 1
Nukleasefritt H 2 O
Totalt volum 20 18 + (over natten) 4

C)

Reagens Volum for 1x reaksjon (ul) Inkubasjonstid (HR) Inkubasjon Temperatur (° C)
450 ng av Gag-MJ4 plasmid x mL for 450 ng
NEB CutSmart Buffer (tidligere NEB Buffer # 4) 2
NgoMIV begrensning enzym 0.5
HpaI restriksjonsenzym 0.5
Nukleasefritt H 2 O x
Totalt volum 20 2 37

Tabell 5. A) Restriction fordøye mester mix og B) ligation reaksjon for generasjon C) Diagnostisk begrensning Gag-MJ4 kimert provirus. Digest å sikre Gag-MJ4 kloning troskap.

Primer navn Nukleotid sekvens (5 '- 3')
GagInnerF1 AGGCTAGAAGGAGAGAGATG
GagF2 GGGACATCAAGCAGCCAT
For3 CTAGGAAAAAGGGCTGTTGGAAATG
GagR6 CTGTATCATCTGCTCCTG
Rev3 GACAGGGCTATACATTCTTACTAT
Rev1 AATTTTTCCAGCTCCCTGCTTGCCCA

Tabell 6. Liste over sekvenseringsprimere nødvendige for å bekrefte 5 'LTR og gag sekvens identitet Gag-MJ4 kimert provirus.

Brønn A 8 mL virus + 232 pl 1% FBS i DMEM
Well B 80 mikroliter fra Brønn A + 160 pl 1% FBS i DMEM
Vel C 80 mikroliter fra Well B + 160 pl 1% FBS i DMEM
Vel D 80 mikroliter fra brønn C + 160 pl 1% FBS i DMEM
Vel E 80 mikroliter fra Well D + 160 pl 1% FBS i DMEM
Vel F 80 mikroliter fra Well E + 160 pl 1% FBS i DMEM

Tabell 7. Fortynning ordning (3-fold) for titering smittsomme virus på TZM-bl celler.

A)

Reagens Volume
PBS uten Ca 2 + eller Mg 2 + 500 ml
Gluteraldehyd 4 ml
Formaldehyd 11 ml

* Merk: Oppbevar ved 4 ° C.

B)

Reagens Volume
PBS uten Ca 2 + eller Mg 2 + 4.75 ml
Kalium ferricyanide (0,2 M) 100 ul
Kalium ferrocyanid (0,2 M) 100 ul
Magnesiumklorid (1 M) 20 mL
X-gal (50 mg / ml) 40 mL

* Merk: Kontroller frisk og lagre bort fra lys til bruk.


C.

Original fortynning godt A B C D E F
Volum av virus (ul) tilsatt til brønnene i en 24-brønns plate rad 5 1,6667 0,5556 0,1852 0,06173 0,02057

Tabell 8. A) B) festeløsninger for titering av Gag-MJ4 kimære virus på TZM-bl indikator cellelinje. C) Volumet av virus tilsatt per brønn for beregning av smittsomme enheter / mL.

Reagens Volume
Føtalt bovint serum (FBS), defineres 55 ml
Penicillin, streptomycin, Glutamin (100x) 6 ml
HEPES-buffer (1 M) 6 ml

Tabell 9. Oppskrift for komplett RPMI medium for spredning av GXR25 celler.

Reagens Volum (ml)
Nuclease-gratis H 2 O 419,5
Tris-Cl, pH 7,8 (1 M) 30
Kaliumklorid (1 M) 37.5
Magnesiumklorid (1 M) 2.5
Nonidet P-40 (10%) 5
EDTA (0,5 M) 1.02
Polyadenylsyre syre, kaliumsalt (2 mg / ml) 1.25
Oligo-dT primer (25 ug / ml) 3.25
Totalt volum 500

Tabell 10. Oppskrift på radiomerket reverse-transkriptasebestemmelse mester mix. * Merk: Lagres som en ml mengder ved -20 ° C.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

På grunn av lengden og teknisk natur av denne protokollen, er det flere trinn som er avgjørende både for den vellykkede konstruksjon av kimære Gag-MJ4 plasmider, så vel som for kvantifisering av virusreplikasjon kapasitet. Selv om begrensning enzym basert kloning strategi for introduksjon av fremmede gag gener i MJ4 skissert i denne protokollen har mange fordeler i forhold til tidligere brukte rekombinasjon baserte metoder, kan protokollen være teknisk utfordrende hvis kritiske trinnene ikke blir fulgt nøyaktig.

For det første er det helt avgjørende å bruke MJ4 plasmid DNA som har blitt generert i en kompetent bakteriestamme mangler DCM og demningen DNA methylases. Dette er nødvendig, fordi den enzymatiske aktivitet av BclI restriksjonsendonuklease, som brukes til å klone gag gener inn i MJ4 ryggraden, er demningen / DCM metylering følsom. Den JM110 og SCS110 (en Enda negativ JM110 derivat) E. coli stammer enre egnet for generering unmethylated MJ4 plasmid DNA. I tillegg, for eksisjon av vektor og sette inn band, er det sterkt anbefalt at et blått lys lyset brukes for visualisering. Dette vil redusere UV bølgelengde-avhengig DNA-skade, og drastisk øker kloningseffektiviteten. Hvis et blått lys illuminator er utilgjengelig, kan kloning effektivitet maksimeres ved å visualisere DNA med SYBR Sikker DNA gel flekken i stedet for etidiumbromid og minimere UV eksponeringstid.

Endelig har molekylær kloning med store (> 10 kb) og / eller retrovirale plasmider som MJ4 tradisjonelt vært vanskelig for en rekke grunner. Store plasmider redusere effektiviteten av transformasjon kompetente bakteriestammer 42, mens retrovirale innsatser, som inneholder lang terminal repeat (LTR) sekvenser, redusere stabiliteten av plasmidet og kompromiss replikering gjengivelse av plasmid-DNA i den bakterielle vert som fører til sletting av det retrovirale genomet 43 E. coli belastning over DH5α belastning, i våre hender. På grunn av ustabil natur av plasmidet bør rensede plasmid-produkter alltid kontrolleres for riktig plasmid størrelse ved restriksjonsenzymbehandling; her en dobbel fordøye med NgoMIV og HpaI restriksjonsendonukleaser ved 37 ° C i 2 timer.

Når vellykket generasjon av kimære Gag-MJ4 plasmider har blitt oppnådd, er virus generert via transfeksjon av 293T celler, målt med hensyn på en indikatorcellelinje, TZM-Bl-celler, og replikasjonskapasitet måles ved hjelp av en CEM-baserte T-cellelinje. CEM-baserte GXR25 cellelinje som brukes for disse replikasjonsstudier er en av de få etablert T-cellelinjer i stand til å støtte oppføring og replikering av CCR5-tropiske stammer av HIV-1. Dette har blitt oppnådd ved retroviral transduksjon for å tillate stabil ekspresjon av human CCR5 37. Denne cellelinje naturlig uttrykker CXCR4 og vil understøtte replikasjon av CXCR4-tropisk HIV-1, som for eksempel laboratorie-tilpasset belastning NL4-3. Imidlertid, for å støtte effektiv replikasjon av CCR5-tropiske stammer, slik som MJ4 må GXR25 cellene formeres for ikke mindre enn 4 måneder før infeksjon. Riktig passaged kulturer kan støtte replikering selv etter passering i inntil 1 år. Nøye oppfølging av CCR5-tropisk replikering gjennom passaging er avgjørende for vellykkede eksperimenter.

Som med en hvilken som helst teknikk, er det begrensninger på prokollen som må vurderes. På grunn av plasseringen av restriksjonsseter i MJ4 plasmid så vel som tilgjengeligheten av konservert restriksjonssetene i naturlig forekommende HIV-1-isolater, er 3 'distale restriksjonssete, BclI, som ligger 137 nukleotider fra gag-stoppkodonet. Selv om dette genererer en kimert proteasegenet, er denne regionen 96,5% bevart i denne kohorten, og vi ikke observere en overflod av døde eller defekte kimære virus.

En av fordelene med å bruke den MJ4 subtype C smittsomme molekylær klone med subtype C avledet sekvenser er at det reduserer risikoen for suboptimal genet sammenkobling mellom gag gener og ryggrad vektorer av forskjellige undertyper. Det finnes imidlertid en viss mengde innen-klade mangfold som gjenspeiles av clustering av HIV-1-sekvenser etter land eller region selv når de blir funnet innenfor samme subtype 31. Dette kan bidra til suboptimal sammenkobling mellom gag gener derived fra akutt infiserte zambiere og MJ4 smittsomme molekylær klone ryggrad, som ble hentet fra en kronisk infisert individ fra Botswana 38. Imidlertid, et flertall av de analyserte konstruksjoner produsert smittsomme virus-avkom. Ettersom forskjellige HIV-1 subtype C infeksiøse molekylære kloner blir mer tilgjengelig, vil det være viktig å ytterligere bekrefte dette systemet ved kloning i disse HIV-1 clade C gag gener i andre rygger for å sikre at det er en minimal forspenning innført på grunn til ryggraden inkompatibilitet.

Den GXR25 cellelinjen er en unik cellelinje, spesielt på grunn av dens evne til å støtte både CXCR4 og CCR5-tropiske stammer og HIV-1-induserbar GFP reporter 37. Men noen begrensninger eksisterer og bør vurderes nøye før du bruker denne cellelinje for eksperimenter tilpasset fra denne protokollen. Den GXR25 cellelinje ser ikke ut til å støtte oppføring av et flertall av subtype C eller A, CCR5-tropisk, primary isolerer vi har testet. I tillegg er det overordnede CEM cellelinje hvorfra GXR25 cellelinje ble avledet utstillinger høye nivåer av cyclophilin A, opp til 2 til 4 ganger høyere enn ekspresjon av Jurkat cellelinjen 44. På grunn av høye nivåer av cyclophilin A, replikasjonsdefekt som normalt forbindes med den kanoniske HLA-B * 57 forbundet flukt mutasjon, T242N, noe som skyldes en redusert evne for kapsid for å binde cyclophilin A, ikke kan lett oppdages i denne spesielle cellelinjen 25. Således CEM-baserte GXR25 cellelinjen er ikke ideelt for å studere replikering defekter forbundet med mutasjoner i HIV-1-kapsid cyclophilin-bindende løkke.

Til slutt, mens denne protokollen er ideell for å analysere replikasjonskapasitet av gag-sekvenser avledet fra akutte tidspunkter, må gjøres modifikasjoner for å studere replikasjonskapasitet av gag-gener som stammer fra kronisk infiserte individer. Denne protokollen innebærer amplification av befolknings sekvenser fra akutte tidspunkter (median 45 dager etter estimert dato for infeksjon) når viral mangfold er begrenset. Gag-genet fra hver chimera ble deretter sekvensert og sammenlignet med den opprinnelige populasjon PCR-fragment for å sikre kloning gjengivelse. På grunn av begrenset sekvens mangfold på akutte tidspunkter, kloning fra befolknings PCR produktene er mulig. Imidlertid eksisterer sekvens diversitet innenfor de virale quasispecies av en kronisk infisert individ; Derfor, for å vurdere presist replikasjonskapasiteten av de kroniske quasispecies, enkelt genom forsterkning må brukes for å fange opp flere representative varianter. Hver av disse varianter må deretter analysert med hensyn på in vitro replikasjon.

Denne teknikk har flere bredere anvendelse, som stammer fra dens fordeler fremfor eksisterende fremgangsmåter. Siden denne prosessen resulterer i en klonal replikering kompetent plasmid, er det enkelt å bruke konstruksjoner for ekstra mutagenesis studier, som kan bidra til å belyse bidragene fra spesifikke rester til virusreplikasjon. Videre, ved kloning i gag gener fra langsgående tidspunkter, kan man vurdere utviklingen av virusreplikasjon kapasitet over tid og hvordan disse endringene kan påvirke patogenesen i en HIV-1 infiserte individ.

Denne teknikken kan endres for å utvide sin nytteverdi for ulike bruksområder. Andre HIV-1 virusproteiner kan bli manipulert inn i MJ4 plasmid for å vurdere deres effekt på virusreplikasjon eller deres interaksjon med verts proteiner. Dette kan gjøres ved å konstruere ytterligere restriksjoner sider ønskede områder i genomet gjennom innføring av tause nukleotidforandringer. Imidlertid må spesielle hensyn tas ved å konstruere nye restriksjonsseter, og i 3'-halvdelen av HIV-1 genomet så mange aksessoriske proteiner er kodet i alternative leserammer, og stumme endringer i ettproteiner kan føre til aminosyresubstitusjoner i et annet. I dette tilfellet, restriksjonssete uavhengige kloningsmetoder slik som de diskutert av Dudley et al. 45 kan overvinne denne begrensning. Virale sekvenser avledet fra forskjellige populasjoner kan ha varierende nivåer av replikasjonskapasitet, og MOI kan bli justert tilsvarende for å fange opp de fleste virale isolater i deres logaritmiske vekstfase. Endelig har GXR25 cellelinjen blitt stabilt transfektert med GFP under en LTR-drevet, Tat-induserbar promoter, og viral spredning kan måles som en funksjon av GFP-positive celler via flowcytometri 37 som et alternativ til RT-analysen beskrevet her, eller en tradisjonell p24 ELISA.

Som konklusjon, gir denne protokollen en effektiv og kraftfull teknikk for vurdering av HIV-1-virusreplikasjon som gitt av gag-genet, som koder for et strukturelt protein konservert nødvendig for riktig virion dannelse, Spirende, modning, og demontering 46-48. Videre genererer denne teknikken en replikasjonskompetente klonal plasmid, som er ideelt for mutagenese-studier, og dermed tilveiebringer en fremgangsmåte for å belyse de spesifikke aminosyre-determinanter for viral egnethet. Studier som disse er viktig for å øke forståelsen av hvordan immun-drevet viral evolusjon påvirker patogenesen og sykdomsutvikling hos HIV-1-infiserte individer.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
PCR Reagents
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagF2: 5' GGGACATCAAGCAGCCAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagR6: 5' CTGTATCATCTGCTCCTG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
CoolRack PCR 96 XT Biocision BCS-529
CoolRack M15 Biocision BCS-125
Nuclease free water Fisher SH30538FS Manufactured by Hyclone
QIAamp Viral RNA Mini Kit Qiagen 52906
Simport PCR 8 Strip Tubes, Blue (Flat Cap) Daigger EF3647BX
SuperScript III one-step RT-PCR system Life Technologies/Invitrogen 12574035
Phusion Hot-start II DNA polymerase Fisher F-549L
PCR Nucleotide Mix Roche 4638956001
Agarose, high gel strength Fisher 50-213-128
TAE 10X Life Technologies/Invitrogen AM9869
Promega 1 kb DNA ladder Fisher PRG5711 Manufactured by Promega
Sybr Safe DNA Gel Stain, 10,000x Life Technologies/Invitrogen S33102
Wizard SV Gel and PCR Clean-Up System Promega A9282
Razor blades, single-edged Fisher 12-640 Manufactured by Surgical Design
Thermocycler, PTC-200 MJ Research
Microbiology & Cloning Reagents
LB Agar, Miller Fisher BP1425-2
LB Broth, Lennox Fisher BP1427-2
Sterile 100 x 15 mm polystyrene Petri dishes Fisher 08-757-12
Ampicillin sodium salt Sigma-Aldrich A9518-5G
Falcon 14 ml Polypropylene round-bottom tubes BD Biosciences 352059
NgoMIV restriction endonuclease New England BioLabs R0564L
BclI restriction endonuclease New England BioLabs R0160L
HpaI restriction endonuclease New England BioLabs R0105L
T4 DNA Ligase, 5 U/μl Roche 10799009001
JM109 competent cells, >108 cfu/μg Promega L2001
PureYield plasmid miniprep system Promega A1222
Safe Imager 2.0 Blue Light Transilluminator Invitrogen G6600
Microfuge 18 centrifuge Beckman Coulter 367160
Cell Culture Reagents
Amphyl cleaner/disinfectant Fisher 22-030-394
Fugene HD, 1 ml VWR PAE2311 Manufactured by Promega
Hexadimethrine bromide (Polybrene) Sigma-Aldrich H9268-5G
Costar Plates, 6-well, flat Fisher 07-200-83 Manufactured by Corning Life
Costar Plates, 24-well, flat Fisher 07-200-84 Manufactured by Corning Life
Costar Plates, 96-well, round Fisher 07-200-95 Manufactured by Corning Life
Flasks, Corning filter top/canted neck, 75 cm2 Fisher 10-126-37
Flasks, Corning filter top/canted neck, 150 cm2 Fisher 10-126-34 Manufactured by Corning Life
Conical Tubes, 50 ml, blue cap Fisher 14-432-22 Manufactured by BD Biosciences
Conical Tubes, 15 ml, blue cap Fisher 14-959-70C Manufactured by BD Biosciences
Trypsin-EDTA Fisher MT25052CI Manufactured by Mediatech
RPMI, 500 ml Life Technologies/Invitrogen 11875-119
DMEM, 500 ml Life Technologies/Invitrogen 11965-118
Penicillin/Streptomycin/Glutamine, 100x Life Technologies/Invitrogen 10378-016
PBS with magnesium and calcium, 500 ml Life Technologies/Invitrogen 14040-133
PBS without magnesium and calcium Life Technologies/Invitrogen 20012-050
Sarstedt tubes, assorted colors Sarstedt 72.694.996
Reservoir Trays for Multichannel, 55 ml Fisher 13-681-501
DEAE-Dextran Fisher NC9691007
Corning 96 well clear V bottom tissue culture treated microplate Fisher 07-200-96 Manufactured by Corning Life
HEPES, 1 M Buffer Solution Life Technologies/Invitrogen 15630-080
FBS, Defined, 500 ml Fisher SH30070 03
X-gal VWR PAV3941 Manufactured by Promega
Glutaraldehyde, Grade II, 25% in H2O Sigma-Aldrich G6257-100ML
1 M Magnesium chloride solution Sigma-Aldrich M1028-100ML
Formaldehyde solution, for molecular biology, 36.5% Sigma-Aldrich F8775-500ML
Potassium hexacyanoferrate(II) trihydrate Sigma-Aldrich P9387-100G
Potassium hexacyanoferrate(III) Sigma-Aldrich P8131-100G
Allegra X15-R centrifuge Beckman Coulter 392932
TC10 automated cell counter Bio-Rad 1450001
VistaVision inverted microscope VWR
Reverse-Transcriptase Quantification Assay Reagents
dTTP, [α-33P]- 3000 Ci/mmol, 10 mCi/ml, 1 mCi Perkin-Elmer NEG605H001MC
1 M Tris-Cl, pH 8.0 Life Technologies/Invitrogen 15568025 Must be adjusted to pH 7.8 with KOH
2 M Potassium chloride (KCl) Life Technologies/Invitrogen AM9640G Adjust to 1 M solution
0.5 M EDTA Life Technologies/Invitrogen 15575-020
Nonidet P40 Roche 11333941103
Polyadenylic acid (Poly rA) potassium salt  Midland Reagent Co. P-3001
Oligo d(T) primer Life Technologies/Invitrogen 18418-012
Dithiothreitol (DTT) Sigma-Aldrich 43815-1G
SR, Super Resolution Phosphor Screen, Small Perkin-Elmer 7001485
Corning Costar Thermowell 96-well plate model (M) Polycarbonate Fisher 07-200-245 Manufactured by Corning Life
Corning 96-well Microplate Aluminum Sealing Tape, Nonsterile Fisher 07-200-684 Manufactured by Corning Life
DE-81 anion exchange paper Whatman 3658-915
Trisodium citrate dihydrate Sigma-Aldrich S1804-1KG
Sodium Chloride Fisher S671-3
Autoradiography cassette Fisher FB-CA-810
Cyclone storage phoshpor screen Packard

DOWNLOAD MATERIALS LIST

References

  1. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., Oldstone, M. B. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. Journal of virology. 68, 6103-6110 (1994).
  2. Koup, R. A., et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. Journal of virology. 68, 4650-4655 (1994).
  3. Jin, X., et al. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. The Journal of experimental medicine. 189, 991-998 (1999).
  4. Schmitz, J. E., et al. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science. 283, 857-860 (1999).
  5. Brumme, Z. L., et al. Marked epitope- and allele-specific differences in rates of mutation in human immunodeficiency type 1 (HIV-1) Gag, Pol, and Nef cytotoxic T-lymphocyte epitopes in acute/early HIV-1 infection. Journal of virology. 82, 9216-9227 (2008).
  6. Leslie, A. J., et al. HIV evolution: CTL escape mutation and reversion after transmission. Nature medicine. 10, 282-289 (2004).
  7. Phillips, R. E., et al. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature. 354, 453-459 (1991).
  8. Price, D. A., et al. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proceedings of the National Academy of Sciences of the United States of America. 94, 1890-1895 (1997).
  9. Goulder, P. J., et al. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nature. 3, 212-217 (1997).
  10. Tang, J., et al. Favorable and unfavorable HLA class I alleles and haplotypes in Zambians predominantly infected with clade C human immunodeficiency virus type 1. Journal of virology. 76, 8276-8284 (2002).
  11. Prentice, H. A., et al. HLA-B*57 versus HLA-B*81 in HIV-1 infection: slow and steady wins the race. Journal of virology. 87, 4043-4051 (2013).
  12. Migueles, S. A., et al. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proceedings of the National Academy of Sciences of the United States of America. 97, 2709-2714 (2000).
  13. Leslie, A., et al. Additive contribution of HLA class I alleles in the immune control of HIV-1 infection. Journal of virology. 84, 9879-9888 (2010).
  14. Kaslow, R. A., et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nature medicine. 2, 405-411 (1996).
  15. Altfeld, M., et al. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS. 17, 2581-2591 (2003).
  16. Kiepiela, P., et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nature medicine. 13, 46-53 (2007).
  17. Mothe, B., et al. Definition of the viral targets of protective HIV-1-specific T cell responses. Journal of translational medicine. 9, 208 (2011).
  18. Peyerl, F. W., Barouch, D. H., Letvin, N. L. Structural constraints on viral escape from HIV- and SIV-specific cytotoxic T-lymphocytes. Viral immunology. 17, 144-151 (2004).
  19. Rolland, M., et al. Broad and Gag-biased HIV-1 epitope repertoires are associated with lower viral loads. PloS one. 3, e1424 (2008).
  20. Wagner, R., et al. Molecular and functional analysis of a conserved CTL epitope in HIV-1 p24 recognized from a long-term nonprogressor: constraints on immune escape associated with targeting a sequence essential for viral replication. J Immunol. 162, 3727-3734 (1999).
  21. Wang, Y. E., et al. Protective HLA class I alleles that restrict acute-phase CD8+ T-cell responses are associated with viral escape mutations located in highly conserved regions of human immunodeficiency virus type 1. Journal of virology. 83, 1845-1855 (2009).
  22. Chopera, D. R., et al. Transmission of HIV-1 CTL escape variants provides HLA-mismatched recipients with a survival advantage. PLoS pathogens. 4, e1000033 (2008).
  23. Crawford, H., et al. Evolution of HLA-B*5703 HIV-1 escape mutations in HLA-B*5703-positive individuals and their transmission recipients. The Journal of experimental medicine. 206, 909-921 (2009).
  24. Boutwell, C. L., et al. Frequent and variable cytotoxic-T-lymphocyte escape-associated fitness costs in the human immunodeficiency virus type 1 subtype B Gag proteins. Journal of virology. 87, 3952-3965 (2013).
  25. Brockman, M. A., et al. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. Journal of virology. 81, 12608-12618 (2007).
  26. Crawford, H., et al. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. Journal of virology. 81, 8346-8351 (2007).
  27. Martinez-Picado, J., et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. Journal of virology. 80, 3617-3623 (2006).
  28. Schneidewind, A., et al. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. Journal of virology. 81, 12382-12393 (2007).
  29. Wright, J. K., et al. Impact of HLA-B*81-associated mutations in HIV-1 Gag on viral replication capacity. Journal of virology. 86, 3193-3199 (2012).
  30. Kawashima, Y., et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature. 458, 641-645 (2009).
  31. Goepfert, P. A., et al. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. The Journal of experimental medicine. 205, 1009-1017 (2008).
  32. Brockman, M. A., et al. Early selection in Gag by protective HLA alleles contributes to reduced HIV-1 replication capacity that may be largely compensated for in chronic infection. Journal of virology. 84, 11937-11949 (2010).
  33. Huang, K. H., et al. Progression to AIDS in South Africa is associated with both reverting and compensatory viral mutations. PloS one. 6, e19018 (2011).
  34. Wright, J. K., et al. Gag-protease-mediated replication capacity in HIV-1 subtype C chronic infection: associations with HLA type and clinical parameters. Journal of virology. 84, 10820-10831 (2010).
  35. Wright, J. K., et al. Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype. C. Journal of virology. 85, 3996-4006 (2011).
  36. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of virology. 59, 284-291 (1986).
  37. Brockman, M. A., Tanzi, G. O., Walker, B. D., Allen, T. M. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. Journal of virology. 131, 134-142 (2006).
  38. Ndung'u, T., Renjifo, B., Essex, M. Construction and analysis of an infectious human Immunodeficiency virus type 1 subtype C molecular clone. Journal of virology. 75, 4964-4972 (2001).
  39. Prince, J. L., et al. Role of transmitted Gag CTL polymorphisms in defining replicative capacity and early HIV-1 pathogenesis. PLoS pathogens. 8, e1003041 (2012).
  40. Ostrowski, M. A., Chun, T. W., Cheseboro, B., Stanley, S. K., Tremblay, M., et al. Detection assays for HIV proteins. Current protocols in immunology / edited by John E. Coligan ... [et al.]. 12, (Unit 12 15), Forthcoming.
  41. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, 61-68 (1989).
  42. Inoue, H., Nojima, H., Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene. 96, 23-28 (1990).
  43. Bichara, M., Pinet, I., Schumacher, S., Fuchs, R. P. Mechanisms of dinucleotide repeat instability in Escherichia coli. Genetics. 154, 533-542 (2000).
  44. Ackerson, B., Rey, O., Canon, J., Krogstad, P. Cells with high cyclophilin A content support replication of human immunodeficiency virus type 1 Gag mutants with decreased ability to incorporate cyclophilin A. Journal of virology. 72, 303-308 (1998).
  45. Dudley, D. M., et al. A novel yeast-based recombination method to clone and propagate diverse HIV-1 isolates. BioTechniques. 46, 458-467 (2009).
  46. Ganser-Pornillos, B. K., von Schwedler, U. K., Stray, K. M., Aiken, C., Sundquist, W. I. Assembly properties of the human immunodeficiency virus type 1 CA protein. Journal of virology. 78, 2545-2552 (2004).
  47. Forshey, B. M., von Schwedler, U., Sundquist, W. I., Aiken, C. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. Journal of virology. 76, 5667-5677 (2002).
  48. Gottlinger, H. G., Dorfman, T., Sodroski, J. G., Haseltine, W. A. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proceedings of the National Academy of Sciences of the United States of America. 88, 3195-3199 (1991).
Et restriksjonsenzym Basert Cloning metode for å vurdere den<em&gt; In vitro</em&gt; Replication Kapasitet av HIV-1 Undertype C gag-MJ4 Chimerisk virus
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).More

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter