Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

A Enzima de Restrição método baseado Clonagem para avaliar a doi: 10.3791/51506 Published: August 31, 2014
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Determinar o host e as características virais que influenciam HIV-1 patogênese e progressão da doença é fundamental para o desenho racional de vacina. A resposta imune celular é um componente chave da resposta imunitária humana a infecção por HIV-1. Os linfócitos T citotóxicos (CTL) são necessários para o controle inicial da viremia aguda, e permitir que o host para estabelecer um estado de equilíbrio (set point) da carga viral 1,2. Depleção Experimental destas células efectoras resulta na perda de controlo viral 3,4. Apesar disso, escapar mutações surgem dentro do genoma viral que subverter reconhecimento CTL de células infectadas por vírus 5-9.

Certos alelos HLA têm sido associados com baixas cargas virais e mais lenta a progressão da doença, incluindo o B * 57, B * 27, B * 81 10-15. Parte do benefício de protecção de alelos de HLA de classe I pode ser atribuída ao facto de que eles têm como alvo regiões funcionalmente restritas do genoma, tais como gage seleccionar a presença de mutações de escape que diminuem a capacidade do vírus se replicar in vitro 16-21. Apesar de fuga do sistema imune celular é benéfica para o vírus no contexto da classe I de HLA de selecção de alelos, o efeito de tais mutações podem ter consequências diferenciais para o hospedeiro durante a transmissão para um indivíduo de HLA desemparelhado 22,23. Portanto, compreender os efeitos de mutações de escape transmissíveis associadas ao HLA sobre a capacidade de replicação viral será importante para promover nossa compreensão de início de HIV-1 patogênese.

Embora muito progresso tem sido feito para identificar e caracterizar os defeitos da aptidão de mutações de escape individuais associados a HLA de classe específico I alelos 24-29, que ocorre naturalmente isolados HIV-1 têm pegadas únicas e complexas de polimorfismos HLA-associado, provavelmente decorrente do HLA pressão imune mediada de diferentes origens imunogenéticas 30. Em apanálise revious, Goepfert et al. mostraram que a acumulação de mutações associados a HLA-nas sequências derivadas de Gag transmitidos 88 zambianos agudamente infectadas foi associada com uma redução no ponto de ajuste da carga viral 31. Isto sugeriu que a transmissão de mutações de escape nocivos, especificamente em Gag, para os receptores de HLA desemparelhado fornece um benefício clínico, e pode ser atenuada devido à replicação viral. Seguindo em frente, é imperativo para estudar como as combinações de polimorfismos da mordaça complexa dentro isolados que ocorrem naturalmente trabalhar em conjunto para definir as características do vírus transmitido como a capacidade de replicação, e como replicação precoce pode por sua vez afetar HIV-1 e parâmetros clínicos em estágio final patogênese.

Brockman et al. Demonstrou pela primeira vez uma ligação entre a capacidade de replicação seqüências gag-pro do isolado durante a infecção fase crônica e carga viral, tanto subtipo C e infecções B32-35. A abordagem experimental apresentadas nesses estudos, embora adequado para analisar a capacidade de replicação in vitro de sequências derivadas de indivíduos cronicamente infectados, tem algumas ressalvas técnicas e limitações que torna o estudo HIV-1 capacidade de replicação no subtipo C indivíduos infectados de forma aguda difícil. Este método baseia-se na recombinação de seqüências de PCR amplificados com base populacional para o subtipo B NL4-3 pró-vírus, o que derivou em parte de LAV, um laboratório adaptado estoque de vírus 36. Geração de vírus foi realizada por co-transfecção de uma linha de células T baseia-CEM 37 com amplicões PCR digerido e delta-gag-pro NL4-3 ADN. Este método exige o crescimento de vírus durante um período de semanas a meses, distorcendo potencialmente, a natureza do material de vírus recuperado em relação aos quasiespie viral in vivo, e, portanto, altera a medição da capacidade de replicação in vitro. Este método ié mais adequado para o estudo indivíduos cronicamente infectadas, quando seleciona eficazmente para o vírus com a mais elevada capacidade de replicação, e onde a clonagem numerosas variantes virais diferentes a partir de um grande número de indivíduos cronicamente infectados é bastante trabalhoso e, por conseguinte, não é viável. No entanto, dentro de um indivíduo com infecção aguda, há geralmente 1-2 variantes presente e eliminando assim o risco de distorcer a natureza da ação do vírus recuperado, através in vitro pressões de seleção, permite uma avaliação mais precisa da capacidade de replicação em vitro. Em segundo lugar, este método requer sequências gag-pro subtipo C recombinação em um subtipo B espinha dorsal derivadas, e pode apresentar desvios incompatibilidade backbone para a análise. Devido a essas limitações, um grande número de sequências devem ser analisados ​​a fim de superar quaisquer potenciais vieses introduzidos.

Aqui nós descrevemos um apro experimental alternativaada apropriado para estudar as sequências derivadas do subtipo C indivíduos com infecção aguda. Nós usamos uma estratégia de clonagem com base de enzima de restrição para introduzir o gene gag derivada de pontos agudos tempo infecção de indivíduos infectados pelo HIV-1 do subtipo C no esqueleto proviral subtipo C, MJ4. O uso de MJ4 como uma espinha dorsal comum, no qual para clonar genes gag é crucial para a análise das sequências derivadas do subtipo C. MJ4 é derivado de um isolado primário 38, e, portanto, seria menos provável a introdução de viés devido ao subtipo incompatibilidade entre o backbone e gene gag. Além disso, a abordagem de clonagem de enzima à base de restrição permite a proviral constrói a ser transfectada directamente em células 293T, e para a recuperação de um estoque de vírus clonal idêntica à sequência gag clonada.

O método apresentado a seguir é um método de alto rendimento para avaliar a capacidade de replicação do subtipo C derivado Gag-MJ4vírus quiméricos. A transfecção para células 293T é simples e recuperação de vírus tem apenas três dias. Em capacidade de replicação in vitro é ensaiada na mesma linha de células T baseia-CEM CCR5 criado por Brockman et al. 37, mas usando modificações do protocolo importantes necessárias para a replicação de sucesso do subtipo C MJ4 vírus quiméricos. O uso de uma linha de células T apropriado, em vez de PBMC permite um grande número de vírus do subtipo C-MJ4 quimérica para ser testado com o ensaio de alta reprodutibilidade. Finalmente, usando um ensaio de transcriptase reversa radiomarcado para quantificação do vírus no sobrenadante é mais rentável do que usar p24 disponível comercialmente kits ELISA. Ele também dá uma maior amplitude dinâmica, o que foi importante para a detecção de ambos os vírus mal e altamente replicar dentro do mesmo ensaio e para detectar diferenças sutis na replicação entre os isolados.

Em conclusão, o método aqui apresentado tem permitidoo estudo aprofundado da capacidade de replicação das sequências derivadas de gag do HIV-1 subtipo C com infecção aguda indivíduos da Zâmbia, e como está escrito, também poderia ser expandido para estudar outro subtipo C infectados populações. Observou-se um alto grau de variação nas capacidades de replicação entre os diferentes isolados da mordaça. Além disso, fomos capazes de mostrar uma associação estatística entre a capacidade de replicação do Gag transmitida e carga viral do ponto de ajuste, bem como com CD4 + declínio ao longo de um período de três anos 39. Esses resultados destacam a importância de se estudar as características virais como transmissíveis, como a capacidade de replicação, interagir com o sistema imune do hospedeiro para influenciar patogênese durante a infecção inicial e será fundamental para o desenvolvimento de intervenções vacina eficaz, bem como o tratamento.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1 Ampliação do HIV-1 gag Gene de Infected, Congelado Plasma

  1. Extrair o RNA viral a partir de 140 ul descongeladas HIV-1 no plasma infectado usando um kit de extração.
    1. Sempre que possível, proceder imediatamente a síntese de cDNA após a extração do RNA como RNA viral unfrozen produz os melhores resultados de amplificação. Se possível, configure PCR master mix para a primeira rodada de amplificação de DNA e armazenar a 4 ° C antes da extração do RNA viral.
  2. Reverse-transcrever de cDNA a partir de RNA e amplificam produtos de ADN na primeira rodada utilizando transcriptase reversa e uma polimerase de ADN termoestável, em um único passo de RT-PCR.
    1. Tome RNA de freezer -80 ° C (se o congelamento foi necessário) e brevemente descongelar à temperatura ambiente, em seguida, colocar em bloco frio. Transferência de 5 ul de ARN para cada tubo de PCR contendo 45 ul de mistura principal para dar um volume final de 50 ul. Imediatamente coloque restantes amostras de RNA em freezer -80 ° C.
    2. Depois de um enzima édded para a primeira ronda de PCR master mix (Tabela 1A), alíquota de 45 ul a cada tubo de paredes finas, a amplificação por PCR para o número de reacções desejadas. Certifique-se de usar tubos de PCR com tampas individuais e não tira as tampas para garantir a contaminação cruzada mínima entre as amostras. Inserir os tubos de PCR num bloco frio para proteger o modelo sensível à temperatura e de RNA enzima RT. Nota: As amostras devem ser executados em triplicado, a fim de provar adequadamente os quasispecies virais. Também é importante utilizar um produto com uma enzima polimerase de DNA de alta fidelidade, a fim de minimizar a incorporação errada por PCR introduzido. Por favor, consulte a lista de reagentes para o produto recomendado.
    3. Depois de molde de ARN foi adicionado a todos os tubos de ensaio, tubos de transferência de PCR para a amplificação num termociclador utilizando o programa ciclador descrita na Tabela 1B. Nota: O produto de amplificação este vai ser utilizado em uma segunda ronda de PCR aninhada.
  3. Realize um se aninhadoscond-ronda de amplificação de PCR, utilizando-se 1 ul da primeira ronda de amplificação de PCR (1,2), como o modelo de DNA.
    1. Aliquota 49 ul de segunda ronda de PCR master mix (Tabela 2A) a cada tubo de PCR de paredes finas, para a série de reacções desejadas. Transferir 1 ul da primeira ronda de PCR para a amplificação de cada tubo de reacção para se obter um volume final de 50 ul. Nota: Isto irá servir DNA como molde para a amplificação da segunda rodada. Também é importante utilizar uma polimerase de DNA com capacidades muito alta fidelidade e de revisão, a fim de minimizar a incorporação errada por PCR introduzido. Por favor, consulte a lista de reagentes para o produto recomendado.
    2. Transferir segunda rodada PCR mix reação ao termociclador e executar o programa descrito na Tabela 2B. Nota: Após a conclusão do programa, os produtos desta reacção irá ser executado em um gel de agarose para confirmar a produção de produto.
  4. Adicionar 3 ul de corante de carregamento de 5x 5 & #181; l da segunda ronda de volume de reacção de 50 ul e executar a 120 V num gel de agarose a 1%-TAE contendo um corante de ADN fluorescente à luz ultravioleta até bandas são resolvidos. Visualizar as bandas de 1,6 kb em um iluminador de luz azul (ver Figura 1A).
  5. Executar o volume de reacção de 45 ul restante num gel de agarose a 1%-TAE contendo um corante de ADN, e excisar as bandas apropriadas com uma lâmina de barbear limpa.
    1. Extrair DNA a partir da fatia de gel utilizando um kit de purificação em gel, eluição em água isenta de nuclease, combinam três reacções positivas por indivíduo, e congelar o produto a -20 ° C para uso posterior.

2. Preparando amplicons da mordaça para Clonagem de Introdução dos sítios de restrição necessários

  1. Amplificar a repetição longa terminal (LTR) / porção de 5 'UTR do plasmídeo MJ4 (ver Tabela 3).
  2. Visualize produtos 1.3 kb PCR em iluminador, impostos especiais de consumo amplicons positivos, gel purificar e congelar como anteriormentedescrito (1.4,1.5; ver Figura 1B).
  3. Criar fundido MJ4 LTR- amplicões gag através de "splicing sobreposição de extensão de" PCR (ver Tabela 4).
  4. Visualize, consumo, purificar, e congelar os amplicons 3,2 kb como em 1.4,1.5 (ver Figura 1C).

3. Clonagem Amplified mordaça genes no MJ4, o subtipo C, Clone Molecular Infecciosas

  1. Digerir 1,5 ug de MJ4 plasmídeo e 1,5 ^ g de produto purificado LTR- gag PCR com o Bell (metilação sensíveis) com endonuclease de restrição de 1,5 h a 50 ° C (ver Tabela 5A).
  2. Adicionar 1 ml de NgoMIV para a reacção de digestão e incubar a 37 ° C durante 1 hora.
  3. Adicione corante 5x a restrição digerir reações e electroforese lentamente o volume total em um gel de agarose 1%-TAE contendo uma mancha gel DNA durante 1-2 horas a 100 V. Visualize, consumo, e purificar bandas indicadas para clonagem como anteriormente described (ver Figura 2).
  4. Prepare reacções de ligação usando purificada inserção gag LTR- e DNA vetor MJ4 em um 3: 1 Insira a relação vetor. Incubar reacções de ligação durante a noite a 4 ° C (ver Tabela 5B).
  5. Transformar JM109 bactérias quimicamente competentes com produtos de ligação e espalhadas em placas de agar LB com 100 ug / ml de ampicilina e crescimento a 30 ° C durante 22 + h.
    1. Descongele JM109 células competentes no gelo por 15 min. Rotular 1,5 ml microtubos e frio no gelo.
    2. Aliquota 50-100 ul de células JM109 de pré-arrefecida de 1,5 ml de tubos de microcentrífuga. Adicionar 2,5-5 ul de reacção de ligação para as células JM109, sacudindo tubo levemente para misturar e devolver imediatamente em gelo. Incubar as células competentes com produto de ligação em gelo durante 30 min.
    3. O choque térmico 1,5 ml microtubos contendo células competentes JM109 e reacção de ligação C num bloco de calor a 42 ° C durante 45 seg e retornam ao gelo durante pelo menos 3 min.
    4. Adicionar 50 ul de meio SOC a cada tubo de microcentrífuga e a placa inteira para a reacção de transformação de temperatura ambiente de LB-agar suplementadas com placas de 100 ug / ml de ampicilina.
    5. Placas de transferência para um 30 ° C incubadora e deixe por 20 horas, ou até que as colônias são claramente formado.
  6. Escolha colónias isoladas e crescer em 4 ml de LB com 100 ug / ml de ampicilina a 30 ° C durante 22 + h.
  7. Girar as culturas a 3200 xg durante 15 minutos, deitar fora o caldo, e extrai-se o DNA de plasmídeo.
  8. Para confirmar a clonagem de fidelidade, cortar o ADN miniprep com NgoMIV e enzimas de restrição Hpal numa dupla digestão a 37 ° C durante 2 horas. Analise em 1% de gel de agarose-TAE (ver Tabela 5C).
  9. Sequência da região de inserção do LTR-gag de cada plasmídeo utilizando os seguintes iniciadores: GagInnerF1, GagF2, Rev. 1, rev3, e GagR6 (Tabela 6) para confirmar a identidade de sequência.
  10. Compare as sequências clonadas obtidas com as sequências população derIVED do amplicão purificada inicial de 1.5.1. Nota: É importante avaliar a capacidade de replicação em última análise, de dois clones independentes, a fim de assegurar que qualquer fenótipo de replicação in vitro não são devidos a erros de backbone introduzidas durante o processo de clonagem.

4. Geração e Titulação de replicação competentes gag-MJ4 quiméricos Vírus

  1. Gerar a replicação do vírus competente através da transfecção 1,5 pg do DNA de miniprep MJ4 plasmídeo quimérico em células 293T utilizando um proporção de 4: 1 de Fugene HD tal como descrito por Prince e ai 39.
  2. Título colhidas stocks de vírus nas células MZ-bl conforme descrito abaixo e em Prince et al 39.
    1. Placa TZM-bl as células 24 h antes da infecção com o vírus, de modo a ter uma monocamada confluente de células de 30-40% no dia seguinte. Esta geralmente pode ser conseguido através da adição de 5 x 10 4 células, num volume total de 800 ul por poço de uma placa de 24 poços.
    2. Após a adição de células ao poço, mova suavemente a placa de 24 cavidades para a frente e para trás, em seguida, para os lados, a fim de distribuir de forma eficaz as células. Nunca redemoinho - isto irá resultar em células que se acumulam no centro da placa.
    3. No dia seguinte, preparar 1% de FBS em DMEM; este vai ser utilizado para diluir o DEAE-dextrano e para diluir estoques de vírus. Banco de DEAE-dextrano é de 10 mg / ml ou de 125x, e uma concentração final de 80 ug / ml ou 1 x é desejada.
    4. Retire estoque de vírus a ser testado a partir de -80 ° C e colocar no congelador agitador descongelar à temperatura ambiente.
    5. Usando uma pipeta de canais múltiplos, serialmente dilua stocks de vírus em cultura de tecidos de fundo redondo de 96 poços tratados com placa de tampa. Este é um protocolo de diluição de 3 vezes. Consulte a Tabela 7 para o esquema de diluição.
    6. Remova a mídia da semeadas placas de 24 poços TZM-bl usando um aspirador a vácuo tomando cuidado para não perturbar a monocamada de células. Apenas remova a mídia de uma placa de 24 poços de cada vez para que as células fazemnão secar.
    7. Adicionar 150 ul de 1x a DEAE-dextrano + 1% de FBS em mistura de DMEM a cada poço com uma pipeta de 1000 ul. Não use repita pipeta pois isso atrapalha a monocamada.
    8. Adicionar 150 ul de cada diluição do vírus para o poço apropriado. Adicionar vírus para o centro do poço e agitar suavemente para distribuir uniformemente o vírus através da monocamada de células. Incubar as células infectadas durante 2 horas numa incubadora de cultura de tecidos a 37 ° C e 5% de CO 2.
    9. Após a incubação de 2 h, adicionar 0,5 ml de 10% de FBS em DMEM a cada poço e as placas retornar para uma incubadora para 48 horas adicionais.
    10. Após 48 horas, as células devem ser 100% confluente. MJ4 porque é um vírus competente para replicação, haverá alguma morte celular, mas isto é de se esperar.
    11. Remova a mídia de cada bem e adicione 400 mL / poço de solução (ver Tabela 8A para a receita) de fixação. Fixar apenas uma placa de cada vez. Adicionar solução de fixação, utilizando uma pipeta de 1000 mL, e deixar repousar durante 5 min atemperatura ambiente.
    12. Remova a solução de fixação e lavar 3x com PBS com Ca 2 + / Mg 2 +. Use uma garrafa de esguicho de adicionar suavemente PBS ao lado do poço para evitar perturbar a monocamada. Após a terceira lavagem, seque placa seca em papel absorvente.
    13. Adicionar 400 ul / poço de solução de coloração (ver Tabela 8B por receita) para cada poço da placa de 24 poços, e incuba-se a 37 ° C durante pelo menos 2 horas. Períodos de incubação mais longos são aceitáveis, mas os tempos de incubação deve ser mantido consistente entre experimentos titulação.
    14. Lavar 2x com PBS com Ca 2 + / Mg 2 + e marcar para a infecção, ou adicione PBS e armazenar a 4 ° C para a pontuação mais tarde. As placas podem ser mantidas a 4 ° C durante até quatro dias, desde que a monocamada é mantido hidratado.
    15. Para marcar a infecção, usar um marcador permanente para dividir as cavidades da placa de 24 poços em quadrantes. Contagem de todas as células azuis dentro de um campo de visão, utilizando uma ampliação total de 200x, uma vez emcada um dos quatro quadrantes de um poço.
    16. Calcule unidades infecciosas por mL, como se segue: [(# células azuis / 4) x 67] / (ul de vírus adicionado) = IU / mL. Consulte a Tabela 8C para o volume em ul de vírus a cada poço. Média de vários poços junto; Os números devem ser relativamente semelhante para uma titulação exata.

5 Preparação de Meios de Cultura e Propagação de GXR25 células in vitro Ensaio Replication

  1. Prepare RPMI completo (cRPMI) para a propagação de células GXR25. NOTA: É extremamente importante para a cultura de células GXR25 pelo menos 4 meses antes das experiências de replicação previstas (ver Tabela 9).
  2. Células divididas 1:10 duas vezes por semana e manter a densidade de células entre 1 x 05-02 outubro x 10 6 células / ml.

6. na replicação in vitro de Gag-MJ4 Quimeras em GXR25 (CEM-CCR5-GFP) Células

  1. Um dia antes do infection, dividir as células a uma concentração entre 2-3 x 10 5 células / ml de modo a que eles estão em crescimento logarítmico, no dia da infecção.
  2. No dia da infecção, remover stocks de vírus a partir de -80 ° C e descongelamento congelador. Calcula-se o volume de vírus necessária de cada unidade com base no UI / mL título de ensaio de células TZM-bl, a fim de infectar 5 x 10 5 GXR25 células com uma multiplicidade de infecção de 0,05, utilizando a fórmula:
    Volume de vírus para a infecção (pi) = 1 mL / X UI x 0,05 x 500.000
    NOTA: Nós escolhemos um MOI de 0,05 como isso resulta em uma fase logarítmica de crescimento para todos os vírus que nós testamos. É importante a realização de experiências iniciais, a fim de determinar a MOI óptima para capturar o crescimento logarítmica para o vírus a ser testado.
  3. Dilui-se o vírus em cRPMI a um volume de 100 ul (de forma a alcançar uma MOI de 0,05) e adicionar a um poço de uma cultura de tecido de fundo em V de 96 poços tratados placa. Nota: Inclua um positive controlo (WT MJ4 infectada) e um negativo (células infectadas simuladas) em cada conjunto de experiências de replicação. Configure a placa de tal forma que todas as outras coluna está em branco para limitar a contaminação cruzada entre os poços. O controlo positivo é imperativo, uma vez que será mais tarde utilizada como um padrão para normalizar as pistas de replicação, os quais são uma medida da taxa de replicação de experiências em replicado.
  4. Contagem de células GXR25 utilizando um contador de células automatizado. Calcula-se o número de células necessário no total de todas as infecções (5 x 5 x 10 # infecções). Alíquota do volume necessário para um tubo de 50 ml e centrífuga para sedimentar as células. Sempre calcular para 25% mais infecções do que o necessário.
  5. Mídia Aspirar cuidadosamente e ressuspender em cRPMI a uma concentração de 5 x 10 5 células / 100 mL.
  6. Células de pipeta em uma calha estéril e misture bem. Usando uma pipeta de multi-canal, adicionar 100 ml de células em cada poço da placa de 96 poços contendo vírus diluído. Mix completamente.
  7. Adicionar 2 ml de solução de 5 mg / ml (100x) de polibreno a cada poço e as células misturar completamente.
  8. Incubar a 37 ° C na incubadora de cultura de tecido com 5% de CO 2 durante 3 h.
  9. A fim de lavar as células infectadas, centrífuga placa de 96 poços de fundo em V para sedimentar as células. Em seguida, remove cuidadosamente 150 ul do meio e substituir com 150 ul de fresco cRPMI sem perturbar o sedimento celular. Repita mais duas vezes (incluindo a centrifugação) para suficientemente lave as células.
  10. Após a última centrifugação e adição de 150 ul de cRPMI, ressuspender o sedimento de células com uma pipeta de canais múltiplos e adicionar toda a mistura de células / vírus (cerca de 200 ul) de cada poço a 800 ul independentemente de cRPMI em uma cavidade de um tecido de 24 poços placa de cultura.
  11. Colocar a placa de 5% de CO 2 de tecido de cultura incubadora a 37 ° C.
  12. A cada dois dias, remover 100 ml de sobrenadante a partir da superfície do poço de cultura e transferidos para um poço de 96 Lplaca -bottom e armazenamento congelado a -80 ° C até à execução do ensaio de quantificação do vírus. NOTA: arranjo cuidadosa do sobrenadante em placas de 96 poços irá permitir a transferência de uma pipeta multi-canal de sobrenadantes de culturas durante a quantificação por meio de um virião da transcriptase reversa (RT) de ensaio marcado radioactivamente. Cada placa deve conter amostras de um padrão de infecção, a fim de normalizar variações entre as placas no ensaio de RT de leitura.
  13. Após a remoção de cada amostra de 100 ul, células divididas 1: 2 por células completamente ressuspensão e remoção de metade do volume remanescente (450 mL). Restaurar o volume inicial (1 ml) através da adição de 550 ul de cRPMI fresco a cada poço.

7 Análise de transcriptase inversa (RT), em sobrenadantes de cultura celular

Protocolo adaptado a partir de Ostrowski et al 40.

  1. Configure capuz de segurança biológica em uma facilidade BSL-3 para uso com materiais radioativos.
    1. Coloque papel absorvente em hood e substituir aspirador para aspirador designado para uso radioativo. Nota: Todos os resíduos radioactivos devem ser eliminadas de acordo com as normas de segurança.
  2. Adicionar 1-2 ul de 10 mCi / ml de [α- 33 P] dTTP e 4 ul de 1 M de ditiotreitol (DTT) a cada alíquota de 1 ml de RT master mix (ver Tabela 10 e Ostrowski et al. 40).
  3. Misturar cuidadosamente cada tubo de microcentrífuga de 1,5 ml de mistura principal RT, DTT, e [α- 33 P] dTTP com uma pipeta de 1000 ul e de transferência para uma calha de estéril.
  4. Distribuir 25 ul de mistura de RT marcado em cada cavidade de 96 poços de paredes finas placa de PCR. Nota: Incluir espaço para um controle positivo (infecção MJ4 WT) e controle negativo (infecção Mock).
  5. Adicionar 5 mL de cada sobrenadante para a placa de PCR contendo a mistura principal de RT.
  6. Selar placa de PCR com cobertura de folha adesiva e incuba-se durante 2 horas a 37 ° C num termociclador. Por razões de segurança, rinSE pontas de pipeta com Amphyl e dispor de dicas em pequeno recipiente contendo resíduos Amphyl, que serão posteriormente descartados em lixo radioativo.
  7. Após a incubação, fazer pequenos buracos na cobertura de folha usando uma pipeta de multi-canal de 200 ul. Nota: Se as pontas de pipeta tocar líquido no bem, troque dicas antes de passar para a próxima coluna ou linha.
  8. Mistura amostras transferência 5x e 5 ul de cada amostra para o papel de DE-81. Air secar 10 min.
  9. Blots Lavar 5X com 1x SSC (cloreto de sódio, citrato de sódio) e, em seguida 2x com etanol a 90% em 5 minutos por lavagem. Deixar secar ao ar.
    1. Colocar cada blot em um recipiente separado de lavagem, tais como uma caixa de armazenamento de sanduíche, adicionar tampão de lavagem suficiente (1x SSC ou 90% de EtOH) para cobrir blot, e agitar durante 5 min.
    2. Deitar fora tampão de lavagem em um recipiente e repita separado. Nota: Os primeiros 3 lavagens são considerados radioativo e deve ser descartado corretamente. As últimas duas lavagens podem ser eliminados regularmente.
  10. Depois de seco, o carroefully embrulhar blot em Saran e expor a um phosphoscreen numa cassete hermeticamente fechado durante a noite a temperatura ambiente.
  11. Analise phosphoscreens com um phosphorimager e quantificar transcritos radioactivas.
  12. Desenhe um círculo em torno de cada sinal radioativo usando software OptiQuant. Gráfico dos valores unitários de luz Digital (DLU) para gerar curvas de replicação.
  13. A fim de gerar escores de capacidade de replicação, os valores de log 10 DLU foram -transformed e pistas foram calculados usando o dia 2, 4, e 6 pontos de tempo. Encostas de replicação são então dividido pela inclinação da WT MJ4 a fim gerar escores de capacidade de replicação. É importante para normalizar os valores com base em MJ4 WT obtidos a partir da mesma chapa de RT para reduzir a variabilidade intra-ensaio.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A fim de executar corretamente este protocolo, o que cria um plasmídeo proviral capaz de montar totalmente funcionais, infecciosas quimeras Gag-MJ4, deve ser tomado muito cuidado para gerar os amplicons PCR adequados. Determinar se a PCR tem gerado o amplicon mordaça de tamanho adequado é fundamental. Os produtos devem estar dentro de 100 pares de bases (pb) do fragmento amplificado de aproximadamente 1700 pb apresentado na Figura 1A. O comprimento exacto deste fragmento irão variar de acordo com o gene gag sob estudo. Em seguida, a porção 5 'da repetição terminal longa (LTR) do clone molecular MJ4 deve ser amplificado e unido ao fragmento amplificado gag de modo a torná-lo adequado para a clonagem subsequente. O amplicon MJ4 LTR deve ser 1474 pb de comprimento. Figura 1B mostra uma imagem representativa gel para que tamanhos da banda corretos são indicados. Após a emenda sobreposição de extensão de PCR 41, os produtos da mordaça LTR- combinado deve seraproximadamente 3200 pb de comprimento, tal como ilustrado na Figura 1C.

Uma vez que o gene gag foi tornado adequado para a clonagem de fusão para o LTR 5 'de MJ4, que contém o local necessário NgoMIV restrição, vectores e inserção gag deve ser digerido com NgoMIV e enzimas de restrição Bell e excisada a partir de um gel de agarose após electroforética separação. É imperativo para extirpar as bandas vetoriais e de inserção adequados. Um gel representativo é mostrado na Figura 2. A parte vector do plasmídeo MJ4 deve ser de aproximadamente 10000 pb de comprimento, enquanto que a inserção da mordaça LTR- deve permanecer em cerca de 3000 pb de comprimento, como os locais de restrição estão localizados nos extremos de o fragmento amplificado. Qualquer redução significativa no tamanho irá indicar um local de corte suplementar no interior do gene gag sob estudo.

Após a ligação dos dois fragmentos, a transformação de bactérias, umand isolamento de DNA plasmídeo, as quimeras Gag-MJ4 devem ser verificados para o tamanho apropriado, realizando uma digestão dupla com NgoMIV ea GAAP enzimas de restrição. Full-length quimeras-MJ4 Gag que não têm quaisquer eventos ocorridos durante a replicação bacteriana de deleção deverá ter um padrão de restrição semelhante à ilustrada na Figura 3, com duas bandas de aproximadamente 8700 e 4300 pb.

Uma distinção importante deste protocolo comparado com abordagens anteriores, é a utilização do clone molecular de HIV-1 subtipo C infecciosa, MJ4, em vez do vírus adaptada em laboratório mais comum NL4-3. No entanto, as abordagens descritas na seção anterior poderia ser modificado para clonagem de seqüências do subtipo B mordaça em pNL4-3.

Uma optimização da multiplicidade de infecção (MOI) para utilização em experiências subsequentes foi realizada a fim de seleccionar o MOI ideal que mostrou crescimento logarítmica da maioria dos vírus testados.A Figura 4 mostra curvas representativas de replicação a partir de três diferentes MOI (0,01, 0,05, e 0,25) para MJ4 (Figura 4A), bem como para NL4.3 (Figura 4B). MJ4 replica muito menos eficiente em células GXR25 que NL4-3, o que é importante levar em consideração, como apropriado MOI para replicação NL4-3 provável seria muito baixo para detectar a replicação MJ4 eficiente. Como observado na Figura 4A, uma MOI de 0,05 em vez de 0,01 ou 0,25, era a escolha ideal, porque foi observado crescimento logarítmica entre os dias 2-6 para MJ4. Para o MOI mais baixa, 0,01, dia 6 valores DLU são quase imperceptível, e nós antecipamos a geração de Gag-MJ4 vírus quiméricos que reproduziam inferior MJ4. Por conseguinte, este MOI não capturar o crescimento das quimeras Gag MJ4 mais atenuados, o que também pode ser o mais biologicamente crítica. Além disso, uma MOI de 0,25 não era ideal, porque os cinética rápida de replicação viral matou um amou substancialnt de células, mesmo por dia 4. Isto faz com que a curva de replicação de planalto, e o cálculo de uma inclinação com base numa curva tal como esta seria subestimar a capacidade de replicação. Com base em curvas geradas para NL4-3, mesmo a uma MOI de 0,01, de alvos celulares disponíveis foram visivelmente esgotado por dia 6 pós-infecção. Em conclusão, a uma MOI de 0,05 foi encontrado para ser óptima para um grande painel de vírus quiméricos Gag MJ4, todas as quais tinham diversas sequências gag e diferentes graus de replicação.

Um total de 149 Gag MJ4 vírus quiméricos derivados de sequências do subtipo C aguda Gag foram testados para a replicação in vitro utilizando este ensaio. Os valores normalizados RC foi de 0,01 para 3,5 com alguns vírus replicam mais do que 100 vezes mais eficiente do que o de tipo selvagem MJ4. Figura 5 mostra as curvas de replicação a partir de nove vírus quiméricos Gag-MJ4 representativos, com o tipo selvagem MJ4 descritos no vermelho, e demonstra a ampla gama de replicação capacities observada. Deste modo, a diversidade de sequências no interior do gene gag por si só pode impactar drasticamente a capacidade do vírus se replicar in vitro. Embora este seja representante do vírus quiméricos Gag-MJ4 derivados de zambianos agudamente infectados, outras seqüências do subtipo C não têm sido extensivamente testado, e pode apresentar diferentes cinéticas de replicação. Portanto, deve-se tomar muito cuidado para otimizar o MOI para atender a replicação dos vírus específico de um estudo particular, porque não pode haver uma ampla gama nos níveis de replicação entre diferentes HIV-1 Gag backbones e isola.

Uma das vantagens da utilização de uma linha de células-T, tais como a linha celular GXR25, que suporta a replicação do MJ4, é o nível de reprodutibilidade observada em relação às experiências de replicação utilizando estimuladas células mononucleares do sangue periférico, como alvos. Em experimentos iniciais de otimização, MJ4 tipo selvagem mostraram uma variabilidade intra-ensaio de 8,7%, e diferent clones da mesma variabilidade do vírus quimérico Gag MJ4 exibiu na replicação de 8,5%. Devido diferentes misturas principais e exposições phosphoscreen podem dar valores DLU que diferem ligeiramente em magnitude, a variabilidade intra-ensaio pode ser ainda controlada através da execução do mesmo vírus padrão (no nosso caso, de tipo selvagem MJ4) em cada placa de ensaio de RT. Figura 6 representa graficamente a DLU valores derivados da mesma infecção MJ4, quantificado em oito placas RT diferentes. Normalizar a um vírus que é comum a todos os ensaios de RT pode ajudar a mitigar erro potencial induzida por estas pequenas alterações na grandeza de sinal entre os ensaios.

Inter-ensaio variável também foi testado e replica repetidas em dias diferentes foram altamente correlacionadas. Figura 7 parcelas os valores dos escores RC normalizados a partir de dois experimentos independentes realizados aproximadamente um ano de intervalo. Um elevado grau de correlação com a ausência de grandes valores extremos (R2 = 0,873), foi observado entreen as duas repetições independentes.

Embora altamente correlacionado, existe alguma variabilidade na magnitude total da cinética de replicação entre as duas experiências independentes. Isto pode ser atribuído, em parte, à diferença no número de passagem entre as células estoques GXR25 utilizados em cada experiência. Em geral, as células GXR25 stocks que tenham sido subculturas durante um período de tempo superior a 6 meses tendem a suportar uma replicação mais eficiente de quimeras Gag MJ4. Portanto, é aconselhável para avaliar a capacidade de replicação de quimeras entre grupos dentro de um intervalo de tempo de um mês. Quando os passos anteriores são seguidos de perto, este ensaio é capaz de produzir resultados altamente robustos e reprodutíveis, que são aplicáveis ​​a uma ampla gama de estudos.

Figura 1
Figura 1 representativas imag geles que descrevem a separação electroforética dos produtos da PCR. Para todos os produtos de PCR, 5 ul de cada reacção de 50 ul foi misturado com 3 ul de corante de carregamento de 5x, carregado em um 1% de agarose-TAE gel suplementado com 1X SYBR segura mancha de gel de DNA, e separadas por electroforese a 120 V durante 45 min. A Promega 1 kb escada de ADN (pista 1) foi usada para aproximar tamanhos. Amplicon A) O gene gag foi amplificado a partir de RNA viral utilizando uma abordagem de PCR aninhada. Devido a inserções e deleções, o amplicon mordaça pode variar de 1,600-1,700 bp de comprimento e parece um pouco acima do 1,500 bp marcador escada de DNA. As pistas 2-5 mostram a amplificação do gene gag de sucesso. B) A LTR 5 'de MJ4 foi amplificado a partir do plasmídeo MJ4 de tipo selvagem e visualizados através de separação electroforética. As pistas 2-5 mostram a amplificação com êxito do produto LTR 1474 pb, o qual parece ser ligeiramente inferior ao 1.500 pb escada de DNA marcador. C) A 5R17; Derivada da LTR do tipo selvagem MJ4 e do gene gag amplificada a partir do plasma do paciente são fundidos através de tala-PCR de extensão de sobreposição, e visualizado por separação electroforética. Lanes 2-5 retratam fundidas com sucesso amplicons que são aproximadamente 3.200 pb de tamanho, e que parecem um pouco acima do de 3000 bp marcador escada de DNA.

Figura 2
Figura 2 Imagem de gel representativas que descreve a separação eletroforética de restrição para clonagem de genes digere gag paciente em MJ4. De tipo selvagem e plasmídeo MJ4 LTR- produtos de fusão gag foram digeridas com Bell, durante 1,5 h a 50 ° C e NgoMIV durante 1 hora a 37 ° C. Vector de inserção e os fragmentos foram visualizados por meio de separação por electroforese em agarose a 1%-TAE gel suplementado com 1X SYBR segura DNA gel mancha a 100 V durante 2 horas e usando uma luz azul iluminador, a fim de reduzir os danos no ADN induzida por UV. Os fragmentos vetoriais e de inserção adequados para as etapas de clonagem subseqüentes aparecerão em aproximadamente 10.000 pb e 2.900 pb, respectivamente.

Figura 3
Figura 3. gel representativas que descreve a separação eletroforética de digestões de restrição de Gag-MJ4 plasmídeo de DNA quimérica purificada. Purificada Gag MJ4 quimera do plasmídeo de ADN foi duplamente digeridos com NgoMIV e enzimas de restrição Hpal durante 2 horas a 37 ° C. Digestões de restrição foram visualizados por meio de separação por electroforese em agarose a 1%-TAE gel suplementado com 1X mancha de gel de DNA SYBR segura a 120 V durante 45 min. Os plasmídeos sem grandes deleções resolverá a duas bandas distintas em cerca de 8.700 e 4.300 pb.


Figura 4 Replicação de MJ4 e NL4-3 isolados de HIV-1 na linha celular GXR25 em diferentes multiplicidades de infecção (MOI). 5 x 10 5 GXR25 células foram infectadas tal como descrito no protocolo do método com 5 vezes mais o aumento da MOI cada ação de vírus. Os sobrenadantes foram recolhidos nos dias 2, 4, 6, e infecção e virion produção 8 Post foi quantificada através de um ensaio de transcriptase reversa radiomarcado. As infecções foram executadas em triplicado e as barras de erro indicam o desvio padrão das três repetições. (A) MJ4 (B) NL4-3.

Figura 5
Figura 5 gama representativa de replicação para diferentes quimeras Gag-MJ4. 5 GXR25 células foram infectadas com o tipo selvagem ou MJ4 Gag MJ4 quimeras a uma MOI de 0,05, os sobrenadantes foram recolhidos a intervalos de dois dias após a infecção, e a produção de viriões de quantificada por um radiomarcado ensaio de RT. Inserção de vários genes gag derivado do subtipo C pode ter um impacto dramático sobre a capacidade de replicação de MJ4. Replicação MJ4 do tipo selvagem é indicado em vermelho.

Figura 6
Figura 6 Comparação de variação intra-ensaio no radiomarcado da transcriptase reversa (RT) do ensaio de quantificação. O gráfico mostra inerente variabilidade intra-ensaio traçando os valores DLU dos mesmos sobrenadantes de uma única infecção MJ4 de tipo selvagem no ensaio de RT de oito diferentes placas. A variação de curvas reflete as pequenas mudanças na aposta magnitude do sinalween placas, que podem ser corrigidas pela execução de um padrão em cada placa de RT, que pode ser subsequentemente utilizada para normalizar as pistas de quimeras Gag MJ4 ensaiadas na mesma placa.

Figura 7
Figura 7 A reprodutibilidade do ensaio de replicação ao longo do tempo na linha celular GXR25. Os mesmos vírus quiméricos Gag MJ4 foram usadas para infectar células GXR25 em duas experiências independentes realizadas aproximadamente um ano de intervalo. Contagens de replicação foram gerados através do cálculo da inclinação dos valores DLU transformação logarítmica e que se inclinam para a normalização do tipo selvagem MJ4. Quimeras Gag-MJ4 que se replicam de forma mais eficiente do que o de tipo selvagem MJ4 tem pontuações de replicação superior a 1, e aqueles que replicam de forma menos eficiente do que o de tipo selvagem de replicação MJ4 têm pontuações inferiores a 1 As duas medições independentes estão fortemente correlacionados (R 2 = 0,87, regressão linear) e destacar a reprodutibilidade dos ensaios realizados em diferentes épocas e com células em diferentes passagens.

Um)

Reagente Volume de reação 1x (ul)
Reação Mistura 2x (Invitrogen) 25
Livre de nuclease H2O 17
Adiante GOF iniciador (20 uM de concentração) 1
Iniciador inverso VIFOR (20 uM de concentração) 1
SuperScript III Um passo Mix Enzyme 1
Molde de ARN 5
O volume total 50

B)

Número de Ciclos Time (hr: min: seg) Temperatura (° C)
1 01:00:00 50
1 02:00 94
10 00:15 94
00:30 56
05:00 68
40 00:15 94
00:30 56
05:00 + 5 seg / ciclo 68
1 00:00 68
1 4
Fim

Tabela 1 A) mix Mestre e B) da mordaça amplificação. * Nota: seqüência GOF cartilha: 5'-ATTTGACTAGCGGAGGCTAGAA-3 '. VIFOR sequência de iniciador: 5'-TTCTACGGAGACTCCATGACCC-3 '.

Um)

Reagente Volume de reação 1x (ul)
Livre de nuclease H2O 35.5
5x Phusion HF tampão 10
dNTPs (40 mM) desoxinucleótidos 1
Iniciador directo GagInnerF1 (20 uM de concentração) 1
BclIDegRev2 iniciador inverso (20 uM de concentração) 1
Phusion Hot Start II Polimerase 0,5
PCR na primeira rodada como modelo 1
O volume total 50

B)

Número de Ciclos Time (hr: min: seg) Temperatura (° C)
1 00:30 98
29 00:10 98
00:30 53
01:00 72
1 10:00 72
1 4
Fim

Tabela 2 A) mix Mestre e B) condições termociclador para nested segunda rodada de amplificação da mordaça. * Nota: GagInnerF1 seqüência cartilha: 5'-AGGCTAGAAGGAGAGAGATG-3 '. BclIDegRev2 sequência de iniciador: 5'-AGTATTTGATCATAYTGYYTYACTTTR-3 '.

Um)

Reagente Volume de reação 1x (ul)
Livre de nuclease H2O 35.5
5x Phusion HF tampão 10
dNTPs (40 mM) desoxinucleótidos 1
Iniciador directo MJ4For1b (20 uM de concentração) 1
MJ4Rev iniciador inverso (20 uM de concentração) 1
Phusion Hot Start II Polimerase 0,5
MJ4 plasmídeo como molde (10 ng / ul) 1
O volume total 50

B)

Número de Ciclos Time (hr: min: seg) Temperatura (° C)
1 00:30 98
29 00:10 98
00:30 58
00:45 72
1 10:00 72
1 4
Fim

Tabela 3 A) mix Mestre e B) condições termociclador para 5 'LTR MJ4 amplificação. * Nota: seqüência MJ4For1b cartilha: 5'-CGAAATCGGCAAAATCCC-3 '. MJ4Rev sequência de iniciador: 5 '-CCCATCTCTCTCCTTCTAGC-3 '.

Um)

Reagente Volume de reação 1x (ul)
Livre de nuclease H2O 34.5
5x Phusion HF tampão 10
dNTPs (40 mM) desoxinucleótidos 1
Iniciador directo MJ4For1b (20 uM de concentração) 1
BclIRev iniciador inverso (20 uM de concentração) 1
MJ4 LTR fragmento amplificado de 1,3 kb (gel purificado, ~ 50 ng) 1
Phusion Hot Start II Polimerase 0,5
Amplicão Gag (gel purificado, ~ 100 ng) 1
O volume total 50

B)

Número de Ciclos Time (hr: min: seg) Temperatura (° C)
1 00:30 98
29 00:10 98
00:30 58
01:30 72
1 10:00 72
1 4
Fim

A Tabela 4) Mix Master e B) condições termociclador para emenda sobreposição de extensão de PCR para gerar LTR- inserções da mordaça. * Nota: seqüência BclIRev cartilha: 5'-TCTATAAGTATTTGATCATACTGTCTT-3 '

Um)

Reagente Volume de reação 1x (ul) Tempo de Incubação (h) A incubação de temperatura (° C)
1,5 ug de 3 kb LTR- amplicão mordaça ou MJ4 plasmídeo x ul de 1,5 ug
NEB CutSmart Buffer (anteriormente NEB Tampão # 4) 2
Enzima de restrição Bell 1
Livre de nuclease H2O x
O volume total 19 1.5 50
NgoMIV enzima de restrição 1
O volume total 20 1 37

B)

Reagente Volume de reação 1x (ul) Tempo de Incubação (h) A incubação de temperatura (° C)
50 ng corte MJ4 vector plasmídeo x ul para 50 ng
45 ng corte LTR- inserção gag (3: 1) x ul para 45 ng
De tampão ligase 10x Roche 2
Roche T4 ADN-ligase (5 U / uL) 1
Livre de nuclease H2O
O volume total 20 18 + (overnight) 4

C)

Reagente Volume de reação 1x (ul) Tempo de Incubação (h) A incubação de temperatura (° C)
450 ng de Gag-MJ4 plasmídeo x mL para 450 ng
NEB CutSmart Buffer (anteriormente NEB Tampão # 4) 2
NgoMIV enzima de restrição 0,5
Enzima de restrição Hpal 0,5
Livre de nuclease H2O x
O volume total 20 2 37

A Tabela 5) Restrição digerir mistura principal e B) reação de ligação para geração de C) restrição de diagnóstico pró-vírus quimérico Gag-MJ4. Digest para garantir Gag-MJ4 fidelidade clonagem.

Nome do iniciador Sequência de nucleótidos (5 '- 3')
GagInnerF1 AGGCTAGAAGGAGAGAGATG
GagF2 GGGACATCAAGCAGCCAT
For3 CTAGGAAAAAGGGCTGTTGGAAATG
GagR6 CTGTATCATCTGCTCCTG
Rev3 GACAGGGCTATACATTCTTACTAT
Rev1 AATTTTTCCAGCTCCCTGCTTGCCCA

Tabela 6 Lista de primers de seqüenciamento necessárias para confirmar LTR 5 'ea sequência gag identidade de Gag-MJ4 pró-vírus quimérico.

Bem A 8 vírus mL + 232 mL de 1% FBS em DMEM
Bem B 80 mL de Bem A + 160 mL de 1% FBS em DMEM
Bem C 80 mL de Bem B + 160 mL de 1% FBS em DMEM
Bem D 80 mL de Bem C + 160 mL de 1% FBS em DMEM
Bem E 80 mL de Bem D + 160 mL de 1% FBS em DMEM
Bem F 80 mL de Bem E + 160 mL de 1% FBS em DMEM

Tabela 7 esquema de diluição (3vezes) para a titulação de vírus infecciosos nas células TZM-bl.

Um)

Reagente Volume
PBS, sem Ca2 + ou Mg2 500 ml
Gluteraldeído 4 ml
Formaldeído 11 ml

* Nota: Armazenar a 4 ° C.

B)

Reagente Volume
PBS, sem Ca2 + ou Mg2 4,75 ml
Ferricianeto de potássio (0,2 M) 100 ul
Ferrocianeto de potássio (0,2 M) 100 ul
O cloreto de magnésio (1 M) 20 ul
X-gal (50 mg / ml) 40 ul

* Nota: Certifique fresco e armazenar afastado de luz até ser utilizado.


C.

Bem Diluição Original A B C D E F
Volume de vírus (ul) adicionou-se aos poços de uma placa de 24 poços seguidos 5 1,6667 0,5556 0,1852 0,06173 0,02057

Tabela 8 A) B) para a titulação de vírus quiméricos Gag MJ4 na linha celular indicadora TZM-bl. C) O volume de virus por poço para calcular unidades infecciosas / mL.

Reagente Volume
De soro fetal bovino (FBS), definida 55 ml
Penicilina, estreptomicina, Glutamina (100x) 6 ml
Tampão HEPES (1 M) 6 ml

Tabela 9 Receita de meio RPMI completo para a propagação de células GXR25.

Reagente Volume (ml)
NucleaseH 2 O -free 419,5
Tris-Cl, pH 7,8 (1 M) 30
O cloreto de potássio (1 M) 37.5
O cloreto de magnésio (1 M) 2,5
Nonidet P-40 (10%) 5
EDTA (0,5 M) 1.02
Ácido poliadenilico, sal de potássio (2 mg / ml) 1,25
Oligo-dT (25 ug / ml) 3.25
O volume total 500

Tabela 10 Recipe for radiomarcado da transcriptase reversa mistura principal do ensaio. * Nota: Loja como alíquotas de 1 ml a -20 ° C.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Devido à extensão e natureza técnica deste protocolo, há várias etapas que são fundamentais tanto para a construção bem sucedida de plasmídeos quiméricos Gag-MJ4, bem como para a quantificação da capacidade de replicação viral. Embora a estratégia de clonagem baseado enzima de restrição para a introdução de genes gag estrangeira em MJ4 descritas neste protocolo tem inúmeras vantagens sobre os métodos baseados recombinação utilizados anteriormente, o protocolo pode ser tecnicamente difícil, se as etapas críticas não são seguidas com precisão.

Em primeiro lugar, é absolutamente essencial para usar MJ4 plasmídeo de DNA que foi gerado de uma estirpe bacteriana competente falta DCM e barragens metilases de ADN. Isto é necessário porque a actividade enzimática da endonuclease de restrição Bell, o qual é usado para clonar os genes gag no esqueleto MJ4, é barragem / DCM metilação sensível. O JM110 e SCS110 (um derivado de JM110 negativo endA) E. coli umre adequada para gerar ADN de plasmídeo não metilado MJ4. Além disso, para a excisão de bandas vetoriais e de inserção, é altamente recomendável que a luz do iluminador azul ser utilizado para visualização. Isto irá reduzir o comprimento de onda UV dependente de danos no ADN e aumentar drasticamente a eficiência de clonagem. Se a luz do iluminador azul não estiver disponível, a clonagem de eficiência pode ser maximizada através da visualização de DNA com SYBR DNA Seguro mancha gel em vez de brometo de etídio e minimizando o tempo de exposição aos raios UV.

Por fim, clonagem molecular, com grande (> 10 kb) e / ou plasmídeos retrovirais tais como MJ4 tem sido tradicionalmente difíceis para uma variedade de razões. Grandes plasmídeos reduzir a eficiência de transformação das estirpes bacterianas competentes 42 enquanto inserções retrovirais, que contêm repetição terminal longa (LTR), reduzir a estabilidade do plasmídeo e compromisso fidelidade de replicação do ADN de plasmídeo no hospedeiro bacteriano que conduz a deleções do genoma retroviral 43 de E. estirpe de E. coli durante a estirpe DH5a, nas nossas mãos. Devido à natureza instável do plasmídeo, os produtos de plasmídeos purificados deve ser sempre verificado para o tamanho correcto de plasmídeo por digestão com enzimas de restrição; aqui, uma digestão dupla com as enzimas de restrição NgoMIV e Hpal a 37 ° C durante 2 horas.

Uma vez que a geração de sucesso de plasmídeos quiméricos Gag-MJ4 foi realizado, o vírus é gerado através de transfecção de 293T, titulado em células de uma linha de células indicadora, células TZM-bl, e capacidade de replicação é medida usando uma linha de células T baseia-CEM. A linha celular CEM-GXR25 base utilizado para estes estudos de replicação é uma das linhas de células T estabelecido alguns capazes de suportar a entrada e a replicação de estirpes de CCR5-tropic de HIV-1. Isto foi conseguido através de transdução retroviral para permitir expressão estável de CCR5 humano 37. Esta linha celular expressa naturalmente o CXCR4 e irá suportar a replicação de CXCR4-trópico HIV-1, tais como a estirpe adaptada em laboratório NL4-3. No entanto, a fim de suportar a replicação eficiente de estirpes CCR5-trópico, tal como MJ4, as células GXR25 deve ser propagado para não menos do que quatro meses antes da infecção. Adequadamente culturas passadas podem suportar a replicação mesmo após passaging durante até 1 ano. A monitorização cuidadosa da replicação do CCR5 em todo passaging é essencial para experiências bem sucedidas.

Como em qualquer técnica, existem limitações para o proprotocolo que tem de ser considerado. Devido à localização dos locais de restrição no plasmídeo MJ4, bem como a disponibilidade de locais de restrição que ocorrem naturalmente em conservadas do HIV-1 isolados, o sítio de restrição distal do 3 ', Bell, está localizado 137 nucleótidos a partir do codão de paragem de gag. Embora isso gera um gene protease quimérica, esta região é de 96,5% conservada nesta coorte, e não observamos uma grande quantidade de vírus quiméricos mortos ou defeituosos.

Uma das vantagens da utilização do clone molecular infeccioso MJ4 subtipo C com o subtipo C sequências derivadas é que reduz o risco de emparelhamento de genes sub-óptima entre os genes gag e vectores de esqueleto de diferentes subtipos. No entanto, uma certa quantidade de diversidade dentro-clado existe como evidenciado pelo agrupamento de sequências de HIV-1 com o país ou região, mesmo quando se encontram dentro do mesmo subtipo 31. Isso poderia contribuir para o emparelhamento abaixo do ideal entre os genes gag derIVED de zambianos intensivamente infectadas e do MJ4 infecciosa backbone clone molecular, que foi derivado de um indivíduo cronicamente infectados a partir de Botswana 38. No entanto, a maioria das construções analisadas produzida progenitura viral infecciosa. Como diferente do HIV-1 do subtipo C clones moleculares infecciosos tornou mais amplamente disponíveis, será importante para validar ainda mais este sistema de clonagem nestes genes gag de HIV-1 do subtipo C em outras colunas vertebrais, a fim de assegurar que há uma tendência mínima introduzida devido a incompatibilidades de backbone.

A linha celular é uma linha GXR25 célula única, especificamente devido à sua capacidade para suportar a CXCR4 e CCR5-tropic estirpes e sua HIV-1 induzível repórter GFP 37. No entanto, existem algumas limitações e devem ser cuidadosamente considerados antes de usar esta linha de células para experiências adaptadas a partir deste protocolo. A linha celular GXR25 não parecem suportar a entrada de uma maioria do subtipo C ou A, CCR5, primary isola nós testamos. Além disso, a linha celular CEM-mãe a partir da qual a linha celular foi derivada GXR25 exibe altos níveis de ciclofilina A, até 2 a 4 vezes mais elevada do que a expressão da linha de células Jurkat, 44. Devido aos elevados níveis de ciclofilina A, o defeito de replicação, normalmente associada com a canónica HLA-B * 57 associado fuga mutação, T242N, o que é atribuído a uma diminuição da capacidade de cápside de se ligar a ciclofilina A, não pode ser facilmente detectada nesta linha celular particular 25. Assim, a linha celular CEM-GXR25 base não é ideal para o estudo da replicação de defeitos associados com mutações no capsídeo laço de ligação de ciclofilina de HIV-1.

Finalmente, enquanto que este protocolo é ideal para analisar a capacidade de replicação de sequências gag de derivados a partir dos pontos de tempo agudas, modificações devem ser feitas, a fim de estudar a capacidade de replicação do gag genes derivados a partir de indivíduos infectados cronicamente. Este protocolo envolve a amplificação das sequências populacionais de momentos agudos (mediana 45 dias após data de infecção estimado) quando a diversidade viral é limitada. O gene gag de cada quimera é, em seguida, sequenciados e comparados com a população inicial de PCR amplicão para assegurar fidelidade de clonagem. Devido à diversidade seqüência limitada em momentos agudos, a clonagem de produtos de PCR da população é possível. No entanto, existe diversidade de sequência dentro da quasiespie viral de um indivíduo cronicamente infectado; por conseguinte, a fim de determinar com exactidão a capacidade de replicação da quasiespie crónicas, amplificação com uma única do genoma deve ser empregue para capturar várias variantes representativas. Cada uma destas variantes deve, então, ser ensaiadas quanto à replicação in vitro.

Esta técnica tem várias aplicações mais amplas, que derivam de suas vantagens sobre os métodos existentes. Uma vez que este processo resulta em uma replicação do plasmídeo competente clonal, é simples de usar construções para m adicionalestudos utagenesis, que podem ajudar a elucidar as contribuições de resíduos específicos para a replicação viral. Além disso, através da clonagem de genes gag de momentos longitudinais, pode-se avaliar a evolução da capacidade de replicação virai ao longo do tempo e de como estas alterações podem afectar a patogénese num indivíduo infectado com HIV-1.

Esta técnica pode ser modificado, a fim de expandir a sua utilidade para diferentes aplicações. Proteínas virais adicionais do HIV-1 pode ser manipulada no plasmídeo MJ4, a fim de avaliar os seus efeitos na replicação viral ou a sua interacção com as proteínas do hospedeiro. Isto pode ser realizado por engenharia restrições adicionais em regiões locais desejados no genoma, através da introdução de alterações de nucleótidos silenciosas. No entanto, uma atenção especial deve ser tomado quando a engenharia de novos sítios de restrição na metade 3 'do genoma do HIV-1, como muitas proteínas acessórias são codificados em quadros de leitura alternativos e mudanças silenciosas em umproteína poderia levar a substituições de aminoácidos na outra. Neste exemplo, os métodos de clonagem de locais de restrição independentes, tais como os discutidos por Dudley et al. 45 pode ultrapassar esta limitação. Sequências virais derivadas a partir de diferentes populações pode ter diferentes faixas de capacidades de replicação, e a MOI pode ser ajustada em conformidade, a fim de capturar a maioria dos isolados virais dentro da sua fase de crescimento logarítmico. Finalmente, a linha de células GXR25 foi estavelmente transfectadas com GFP sob uma LTR-dirigido, Tat promotor indutível, e propagação virai pode ser medida como uma função de células positivas para GFP por meio de citometria de fluxo 37, como uma alternativa ao ensaio de RT descrito aqui ou uma p24 tradicional ELISA.

Em conclusão, este protocolo proporciona uma técnica eficaz e poderosa para avaliar o HIV-1 como a replicação viral conferida pelo gene gag, que codifica uma proteína estrutural conservado necessário para a formação correcta do virião, Brotamento, maturação e desmontagem 46-48. Além disso, esta técnica gera um plasmídeo de replicação competente clonal, que é ideal para estudos de mutagénese e, portanto, proporciona um método para elucidar os determinantes de aminoácidos específicos de replicação viral. Estudos como estes são fundamentais para melhorar a compreensão de como a evolução viral imune-driven afeta patogênese e progressão da doença em pacientes HIV-1 de indivíduos infectados.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
PCR Reagents
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagF2: 5' GGGACATCAAGCAGCCAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagR6: 5' CTGTATCATCTGCTCCTG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
CoolRack PCR 96 XT Biocision BCS-529
CoolRack M15 Biocision BCS-125
Nuclease free water Fisher SH30538FS Manufactured by Hyclone
QIAamp Viral RNA Mini Kit Qiagen 52906
Simport PCR 8 Strip Tubes, Blue (Flat Cap) Daigger EF3647BX
SuperScript III one-step RT-PCR system Life Technologies/Invitrogen 12574035
Phusion Hot-start II DNA polymerase Fisher F-549L
PCR Nucleotide Mix Roche 4638956001
Agarose, high gel strength Fisher 50-213-128
TAE 10X Life Technologies/Invitrogen AM9869
Promega 1 kb DNA ladder Fisher PRG5711 Manufactured by Promega
Sybr Safe DNA Gel Stain, 10,000x Life Technologies/Invitrogen S33102
Wizard SV Gel and PCR Clean-Up System Promega A9282
Razor blades, single-edged Fisher 12-640 Manufactured by Surgical Design
Thermocycler, PTC-200 MJ Research
Microbiology & Cloning Reagents
LB Agar, Miller Fisher BP1425-2
LB Broth, Lennox Fisher BP1427-2
Sterile 100 x 15 mm polystyrene Petri dishes Fisher 08-757-12
Ampicillin sodium salt Sigma-Aldrich A9518-5G
Falcon 14 ml Polypropylene round-bottom tubes BD Biosciences 352059
NgoMIV restriction endonuclease New England BioLabs R0564L
BclI restriction endonuclease New England BioLabs R0160L
HpaI restriction endonuclease New England BioLabs R0105L
T4 DNA Ligase, 5 U/μl Roche 10799009001
JM109 competent cells, >108 cfu/μg Promega L2001
PureYield plasmid miniprep system Promega A1222
Safe Imager 2.0 Blue Light Transilluminator Invitrogen G6600
Microfuge 18 centrifuge Beckman Coulter 367160
Cell Culture Reagents
Amphyl cleaner/disinfectant Fisher 22-030-394
Fugene HD, 1 ml VWR PAE2311 Manufactured by Promega
Hexadimethrine bromide (Polybrene) Sigma-Aldrich H9268-5G
Costar Plates, 6-well, flat Fisher 07-200-83 Manufactured by Corning Life
Costar Plates, 24-well, flat Fisher 07-200-84 Manufactured by Corning Life
Costar Plates, 96-well, round Fisher 07-200-95 Manufactured by Corning Life
Flasks, Corning filter top/canted neck, 75 cm2 Fisher 10-126-37
Flasks, Corning filter top/canted neck, 150 cm2 Fisher 10-126-34 Manufactured by Corning Life
Conical Tubes, 50 ml, blue cap Fisher 14-432-22 Manufactured by BD Biosciences
Conical Tubes, 15 ml, blue cap Fisher 14-959-70C Manufactured by BD Biosciences
Trypsin-EDTA Fisher MT25052CI Manufactured by Mediatech
RPMI, 500 ml Life Technologies/Invitrogen 11875-119
DMEM, 500 ml Life Technologies/Invitrogen 11965-118
Penicillin/Streptomycin/Glutamine, 100x Life Technologies/Invitrogen 10378-016
PBS with magnesium and calcium, 500 ml Life Technologies/Invitrogen 14040-133
PBS without magnesium and calcium Life Technologies/Invitrogen 20012-050
Sarstedt tubes, assorted colors Sarstedt 72.694.996
Reservoir Trays for Multichannel, 55 ml Fisher 13-681-501
DEAE-Dextran Fisher NC9691007
Corning 96 well clear V bottom tissue culture treated microplate Fisher 07-200-96 Manufactured by Corning Life
HEPES, 1 M Buffer Solution Life Technologies/Invitrogen 15630-080
FBS, Defined, 500 ml Fisher SH30070 03
X-gal VWR PAV3941 Manufactured by Promega
Glutaraldehyde, Grade II, 25% in H2O Sigma-Aldrich G6257-100ML
1 M Magnesium chloride solution Sigma-Aldrich M1028-100ML
Formaldehyde solution, for molecular biology, 36.5% Sigma-Aldrich F8775-500ML
Potassium hexacyanoferrate(II) trihydrate Sigma-Aldrich P9387-100G
Potassium hexacyanoferrate(III) Sigma-Aldrich P8131-100G
Allegra X15-R centrifuge Beckman Coulter 392932
TC10 automated cell counter Bio-Rad 1450001
VistaVision inverted microscope VWR
Reverse-Transcriptase Quantification Assay Reagents
dTTP, [α-33P]- 3000 Ci/mmol, 10 mCi/ml, 1 mCi Perkin-Elmer NEG605H001MC
1 M Tris-Cl, pH 8.0 Life Technologies/Invitrogen 15568025 Must be adjusted to pH 7.8 with KOH
2 M Potassium chloride (KCl) Life Technologies/Invitrogen AM9640G Adjust to 1 M solution
0.5 M EDTA Life Technologies/Invitrogen 15575-020
Nonidet P40 Roche 11333941103
Polyadenylic acid (Poly rA) potassium salt  Midland Reagent Co. P-3001
Oligo d(T) primer Life Technologies/Invitrogen 18418-012
Dithiothreitol (DTT) Sigma-Aldrich 43815-1G
SR, Super Resolution Phosphor Screen, Small Perkin-Elmer 7001485
Corning Costar Thermowell 96-well plate model (M) Polycarbonate Fisher 07-200-245 Manufactured by Corning Life
Corning 96-well Microplate Aluminum Sealing Tape, Nonsterile Fisher 07-200-684 Manufactured by Corning Life
DE-81 anion exchange paper Whatman 3658-915
Trisodium citrate dihydrate Sigma-Aldrich S1804-1KG
Sodium Chloride Fisher S671-3
Autoradiography cassette Fisher FB-CA-810
Cyclone storage phoshpor screen Packard

DOWNLOAD MATERIALS LIST

References

  1. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., Oldstone, M. B. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. Journal of virology. 68, 6103-6110 (1994).
  2. Koup, R. A., et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. Journal of virology. 68, 4650-4655 (1994).
  3. Jin, X., et al. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. The Journal of experimental medicine. 189, 991-998 (1999).
  4. Schmitz, J. E., et al. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science. 283, 857-860 (1999).
  5. Brumme, Z. L., et al. Marked epitope- and allele-specific differences in rates of mutation in human immunodeficiency type 1 (HIV-1) Gag, Pol, and Nef cytotoxic T-lymphocyte epitopes in acute/early HIV-1 infection. Journal of virology. 82, 9216-9227 (2008).
  6. Leslie, A. J., et al. HIV evolution: CTL escape mutation and reversion after transmission. Nature medicine. 10, 282-289 (2004).
  7. Phillips, R. E., et al. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature. 354, 453-459 (1991).
  8. Price, D. A., et al. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proceedings of the National Academy of Sciences of the United States of America. 94, 1890-1895 (1997).
  9. Goulder, P. J., et al. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nature. 3, 212-217 (1997).
  10. Tang, J., et al. Favorable and unfavorable HLA class I alleles and haplotypes in Zambians predominantly infected with clade C human immunodeficiency virus type 1. Journal of virology. 76, 8276-8284 (2002).
  11. Prentice, H. A., et al. HLA-B*57 versus HLA-B*81 in HIV-1 infection: slow and steady wins the race. Journal of virology. 87, 4043-4051 (2013).
  12. Migueles, S. A., et al. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proceedings of the National Academy of Sciences of the United States of America. 97, 2709-2714 (2000).
  13. Leslie, A., et al. Additive contribution of HLA class I alleles in the immune control of HIV-1 infection. Journal of virology. 84, 9879-9888 (2010).
  14. Kaslow, R. A., et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nature medicine. 2, 405-411 (1996).
  15. Altfeld, M., et al. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS. 17, 2581-2591 (2003).
  16. Kiepiela, P., et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nature medicine. 13, 46-53 (2007).
  17. Mothe, B., et al. Definition of the viral targets of protective HIV-1-specific T cell responses. Journal of translational medicine. 9, 208 (2011).
  18. Peyerl, F. W., Barouch, D. H., Letvin, N. L. Structural constraints on viral escape from HIV- and SIV-specific cytotoxic T-lymphocytes. Viral immunology. 17, 144-151 (2004).
  19. Rolland, M., et al. Broad and Gag-biased HIV-1 epitope repertoires are associated with lower viral loads. PloS one. 3, e1424 (2008).
  20. Wagner, R., et al. Molecular and functional analysis of a conserved CTL epitope in HIV-1 p24 recognized from a long-term nonprogressor: constraints on immune escape associated with targeting a sequence essential for viral replication. J Immunol. 162, 3727-3734 (1999).
  21. Wang, Y. E., et al. Protective HLA class I alleles that restrict acute-phase CD8+ T-cell responses are associated with viral escape mutations located in highly conserved regions of human immunodeficiency virus type 1. Journal of virology. 83, 1845-1855 (2009).
  22. Chopera, D. R., et al. Transmission of HIV-1 CTL escape variants provides HLA-mismatched recipients with a survival advantage. PLoS pathogens. 4, e1000033 (2008).
  23. Crawford, H., et al. Evolution of HLA-B*5703 HIV-1 escape mutations in HLA-B*5703-positive individuals and their transmission recipients. The Journal of experimental medicine. 206, 909-921 (2009).
  24. Boutwell, C. L., et al. Frequent and variable cytotoxic-T-lymphocyte escape-associated fitness costs in the human immunodeficiency virus type 1 subtype B Gag proteins. Journal of virology. 87, 3952-3965 (2013).
  25. Brockman, M. A., et al. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. Journal of virology. 81, 12608-12618 (2007).
  26. Crawford, H., et al. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. Journal of virology. 81, 8346-8351 (2007).
  27. Martinez-Picado, J., et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. Journal of virology. 80, 3617-3623 (2006).
  28. Schneidewind, A., et al. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. Journal of virology. 81, 12382-12393 (2007).
  29. Wright, J. K., et al. Impact of HLA-B*81-associated mutations in HIV-1 Gag on viral replication capacity. Journal of virology. 86, 3193-3199 (2012).
  30. Kawashima, Y., et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature. 458, 641-645 (2009).
  31. Goepfert, P. A., et al. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. The Journal of experimental medicine. 205, 1009-1017 (2008).
  32. Brockman, M. A., et al. Early selection in Gag by protective HLA alleles contributes to reduced HIV-1 replication capacity that may be largely compensated for in chronic infection. Journal of virology. 84, 11937-11949 (2010).
  33. Huang, K. H., et al. Progression to AIDS in South Africa is associated with both reverting and compensatory viral mutations. PloS one. 6, e19018 (2011).
  34. Wright, J. K., et al. Gag-protease-mediated replication capacity in HIV-1 subtype C chronic infection: associations with HLA type and clinical parameters. Journal of virology. 84, 10820-10831 (2010).
  35. Wright, J. K., et al. Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype. C. Journal of virology. 85, 3996-4006 (2011).
  36. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of virology. 59, 284-291 (1986).
  37. Brockman, M. A., Tanzi, G. O., Walker, B. D., Allen, T. M. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. Journal of virology. 131, 134-142 (2006).
  38. Ndung'u, T., Renjifo, B., Essex, M. Construction and analysis of an infectious human Immunodeficiency virus type 1 subtype C molecular clone. Journal of virology. 75, 4964-4972 (2001).
  39. Prince, J. L., et al. Role of transmitted Gag CTL polymorphisms in defining replicative capacity and early HIV-1 pathogenesis. PLoS pathogens. 8, e1003041 (2012).
  40. Ostrowski, M. A., Chun, T. W., Cheseboro, B., Stanley, S. K., Tremblay, M., et al. Detection assays for HIV proteins. Current protocols in immunology / edited by John E. Coligan ... [et al.]. 12, (Unit 12 15), Forthcoming.
  41. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, 61-68 (1989).
  42. Inoue, H., Nojima, H., Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene. 96, 23-28 (1990).
  43. Bichara, M., Pinet, I., Schumacher, S., Fuchs, R. P. Mechanisms of dinucleotide repeat instability in Escherichia coli. Genetics. 154, 533-542 (2000).
  44. Ackerson, B., Rey, O., Canon, J., Krogstad, P. Cells with high cyclophilin A content support replication of human immunodeficiency virus type 1 Gag mutants with decreased ability to incorporate cyclophilin A. Journal of virology. 72, 303-308 (1998).
  45. Dudley, D. M., et al. A novel yeast-based recombination method to clone and propagate diverse HIV-1 isolates. BioTechniques. 46, 458-467 (2009).
  46. Ganser-Pornillos, B. K., von Schwedler, U. K., Stray, K. M., Aiken, C., Sundquist, W. I. Assembly properties of the human immunodeficiency virus type 1 CA protein. Journal of virology. 78, 2545-2552 (2004).
  47. Forshey, B. M., von Schwedler, U., Sundquist, W. I., Aiken, C. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. Journal of virology. 76, 5667-5677 (2002).
  48. Gottlinger, H. G., Dorfman, T., Sodroski, J. G., Haseltine, W. A. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proceedings of the National Academy of Sciences of the United States of America. 88, 3195-3199 (1991).
A Enzima de Restrição método baseado Clonagem para avaliar a<em&gt; In vitro</em&gt; Replicação Capacidade de HIV-1 do subtipo C gag-MJ4 quiméricos Vírus
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).More

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter