Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Рестриктазой основе Клонирование метод оценки doi: 10.3791/51506 Published: August 31, 2014
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Определение хоста и вирусные характеристики, которые влияют на ВИЧ-1 патогенез и прогрессирование заболевания имеет первостепенное значение для рационального проектирования вакцины. Клеточный иммунный ответ является ключевым компонентом человеческого иммунного ответа на ВИЧ-1 инфекции. Цитотоксических Т-лимфоцитов (CTL) необходимы для первоначального контроля острой виремии, и позволяют с хозяином, чтобы создать устойчивое состояние (уставка) вирусной нагрузки 1,2. Экспериментальный истощение этих эффекторных клеток приводит к потере вирусных управления 3,4. Несмотря на это, избежать мутации возникают в вирусном геноме, что подорвать CTL признание инфицированных вирусом клеток 5-9.

Некоторые аллели HLA были связаны с более низким уровнем вирусной нагрузки и более медленными прогрессирования заболевания в том числе B * 57, B * 27 и B * 81 10-15. Часть защитного благо аллелей HLA класса I может быть связано с тем, что они ориентированы на функционально ограниченных областей генома, такие как Gagи выберите для эвакуации мутаций, которые снижают способность вируса к репликации в пробирке 16-21. Хотя побег из клеточной иммунной системы полезно для вируса в контексте класса выбора HLA Я аллель, эффект этих мутаций может иметь дифференциальные последствия для хозяина при передаче на HLA-несоответствие индивидуального 22,23. Таким образом, понимание последствий передаваемых HLA-ассоциированных эвакуации мутаций на вирусной мощностью репликации будет важно углубить наше понимание ранней ВИЧ-1 патогенезе.

Несмотря на значительный прогресс был достигнут, чтобы идентифицировать и охарактеризовать фитнес дефекты отдельных мутаций эвакуации, связанных с конкретной HLA класса I аллелей 24-29, естественным штаммы ВИЧ-1 были уникальные и сложные следы HLA-ассоциированного полиморфизма, вероятно, возникающие в связи с HLA -опосредованной иммунная давление различных иммуногенетических фоны 30. В арrevious анализ, Goepfert др. показал, что накопление HLA-ассоциированных мутаций в передаваемых Gag последовательностей, полученных из 88 остро инфицированных Замбии было связано со снижением уставки вирусной нагрузки 31. Это позволило предположить, что передача вредных мутаций эвакуации, в частности, в Gag, чтобы HLA-получателей несоответствие обеспечивает клинический эффект, и могут быть ослаблены вследствие вирусной репликации. Двигаясь вперед, необходимо изучить, насколько сложным комбинации Gag полиморфизмов в природе изолятов работать согласованно определить характеристики передаваемого вируса, таких как емкости репликации, и как рано репликация может в свою очередь влияет на ВИЧ-1 клинические параметры и поздней стадии Патогенез.

Брокман и др. Впервые показали связь между способностью репликации кляп-про последовательностей, выделенных во время хронической инфекции стадии и вирусной нагрузки в обоих подтипа C и B инфекций32-35. Экспериментальный подход представлены в этих исследованиях, хотя подходящими для изучения возможностей репликации в пробирке последовательностей, полученных из хронически инфицированных лиц, имеет несколько технических предостережений и ограничений, которые делают изучающих ВИЧ-1 репликативной способности в подтипа C остро инфицированных трудно. Этот метод основан на рекомбинации основе население ПЦР-амплифицированных последовательностей в подтипа B NL4-3 провирусом, производного частично от LAV, лаборатория адаптированы вирусов запас 36. Вирус поколение было достигнуто путем ко-трансфекции с СЕМ на основе линии Т-клеток 37 с ПЦР-ампликонов и расщепляли дельта-GAG-Pro NL4-3 ДНК. Этот метод требует вырост вируса в течение нескольких недель или месяцев, потенциально перекоса природу выделенного вируса складе в отношении вирусных квазивидов в живом организме, и, следовательно, изменения измерение мощности репликации в пробирке. Этот метод яS больше подходит для изучения хронически инфицированных индивидуумов, где он эффективно выбирает на вирус с самой высокой репликативной способности, и где клонирование многочисленные различные вирусные варианты с большим количеством хронически инфицированных лиц довольно трудоемким и, следовательно, не представляется возможным. Тем не менее, в рамках остро инфицированным человеком, там, как правило, 1:59 варианты присутствуют, и, таким образом, устраняя риск перекоса природу восстановленного вируса складе, через в пробирке давлений отбора, позволяет для более точной оценки в пробирке емкостью репликации. Во-вторых, этот метод требует рекомбинации подтип C кляп-про последовательности в подтип B полученной позвоночника, и может ввести магистральных несовместимости предубеждения в анализ. Вследствие этих ограничений, большое количество последовательностей должны быть проанализированы с целью преодоления любых потенциальных предубеждений, введенные.

Здесь мы опишем альтернативный экспериментальный APPROACH подходит для изучения последовательности, полученные из подтипов C остро инфицированных. Мы используем рестрикции стратегию, основанную клонирования ввести ген рвотный полученный из острых моментов времени инфекция ВИЧ-1 подтипа С инфицированных лиц в подтип C провирусного позвоночника, MJ4. Использование MJ4 в качестве общего позвоночника в которой клонировать гены кляп имеет решающее значение для анализа подтипа C полученных последовательностей. MJ4 является производным от первичного изолята 38, и, таким образом, менее вероятно, чтобы ввести смещение вследствие несовместимости между подтипа позвоночника и рвотным гена. Кроме того, подход с использованием фермента рестрикции на основе клонирование позволяет провирусной конструкции для трансфекции непосредственно в клетки 293Т, и для восстановления клонального вирусного штамма, идентичной последовательности клонированного затычки.

Метод, представленный ниже, является высокая метод пропускная способность для оценки способности репликации подтипа C происходит Gag-MJ4химерные вирусы. Трансфекцию в клетках 293Т является простым и восстановление вируса занимает всего три дня. В пробирке емкость репликации анализируют на той же CEM-CCR5 основе линии Т-клеток, созданной Брокман соавт. 37, но с использованием важные изменения протокола необходимо для успешного тиражирования из подтипов C MJ4 химерных вирусов. Использование соответствующей линии Т-клеток, а не МНПК позволяет для большого числа подтип С MJ4-химерных вирусов, которые будут протестированы с высокой анализа воспроизводимости. Наконец, с помощью меченого обратной транскриптазы анализа для количественного определения вируса в супернатанте является более экономически эффективным, чем с использованием коммерчески доступного p24 ELISA комплектов. Это также дает более широкий динамический диапазон, который был важен для обнаружения как плохо и очень реплицирующиеся вирусы внутри же анализе и для обнаружения тонкие различия в репликации между изолятов.

В заключение, метод, представленный здесь позволилоуглубленное изучение способности репликации кляп последовательностей, взятых у ВИЧ-1 подтипа C остро инфицированных лиц из Замбии, и как написано, может также быть расширен для изучения другой подтип C зараженный населения. Наблюдался высокая степень изменчивости в емкостях репликации между различными изолятов Gag. Кроме того, мы смогли показать статистическую связь между мощностью репликации передаваемого Gag и установить точки вирусной нагрузки, а также с CD4 + упадка в течение 39 три года. Такие результаты указывают на важность изучения как передаются вирусные характеристики, такие как емкости репликации, взаимодействуют с иммунной системой хозяина влиять патогенеза в начале инфекции и будет неотъемлемой частью для разработки эффективных мер вакцины, а также лечение.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1 Усиление ВИЧ-1 кляп гена от Infected, Frozen Plasma

  1. Выделите вирусную РНК из 140 мкл талых инфицированных ВИЧ-1 в плазме с использованием набора для экстракции.
    1. Когда это возможно, незамедлительно приступить к синтеза кДНК после экстракции РНК как разморожены вирусная РНК дает наилучшие результаты амплификации. Если это возможно, установить ПЦР основной смеси для первого раунда амплификации ДНК и хранить при температуре 4 ° С до вирусного выделения РНК.
  2. Обратный-транскрибировать кДНК из РНК и амплификации ДНК-продукты в первом раунде с помощью обратной транскриптазы и термостабильной ДНК-полимеразы в одностадийном RT-PCR.
    1. Возьмите РНК из -80 ° C морозильник (если было необходимо замораживание) и кратко оттепели при комнатной температуре, затем поместить в холодную блока. Передача 5 мкл РНК в каждую ПЦР-пробирку, содержащую 45 мкл мастер-смеси с получением конечного объема 50 мкл. Сразу же место оставшиеся образцы РНК в -80 ° C морозильник.
    2. После ферментdded в первом раунде ПЦР мастер-микс (Таблица 1А), аликвотной 45 мкл в каждую тонкостенной ПЦР-амплификации трубки для ряда реакций желаемых. Обязательно используйте ПЦР пробирок с отдельными крышками, а не лишить колпачки для обеспечения минимального перекрестного загрязнения между образцами. Поместите ПЦР трубы в холодном блоке, чтобы защитить чувствительный RT фермента РНК-шаблон и температуры. Примечание: Образцы должны быть запущены в трех экземплярах для того, чтобы адекватно отведать вирусные квазивидов. Кроме того, важно, чтобы использовать продукт с высокой точностью фермента ДНК-полимеразы с целью минимизации ПЦР-введенную основанных на ошибке включени. Пожалуйста, обратитесь к списку реагентов для рекомендуемого продукта.
    3. После матрицы РНК была добавлена ​​всех реакционных труб, передачи ПЦР пробирок в амплификатор для амплификации с помощью программы Cycler, описанный в таблице 1В. Примечание: Продукт этой усиления будет использоваться во втором раунде ПЦР.
  3. Выполните вложенными себеусл-тур ПЦР-амплификации, используя 1 мкл первого раунда ПЦР-амплификации (1.2) в качестве матрицы ДНК.
    1. Алиготе 49 мкл второго круга ПЦР мастер-микс (Таблица 2A) к каждой тонкостенной ПЦР-пробирку для ряда реакций желаемых. Передача 1 мкл из первого раунда ПЦР-амплификации с каждой реакционной трубы, чтобы дать конечного объема 50 мкл. Примечание: Это будет служить матричной ДНК для второго круга усиления. Важно также использовать ДНК-полимеразы с очень высокой точностью и корректура возможностей для того, чтобы свести к минимуму ПЦР-введенный основанных на ошибке включени. Пожалуйста, обратитесь к списку реагентов для рекомендуемого продукта.
    2. Трансфер второго круга ПЦР реакции микс Термоциклеры и программу запуска, описанную в таблице 2B. Примечание: После завершения программы, продукты этой реакции будут работать на агарозном геле, чтобы подтвердить получение продукта.
  4. Добавить 3 мкл 5х загрузки красителя 5 и #181; л из 50 мкл второго раунда реакционного объема и работать при 120 В на 1% агарозном ТАЕ-геле, содержащем УФ-флуоресцентным красителем ДНК, пока полосы не будут решены. Визуализация 1,6 кб полосы на синем света осветителя (рисунок 1А).
  5. Запустите оставшиеся 45 мкл реакционного объема на 1% агарозном-TAE геля, содержащего пятно ДНК, и вырезать соответствующие полосы с чистым лезвием бритвы.
    1. Извлечение ДНК из геля среза с использованием набора для очистки гель, элюируют в нуклеазы без воды, объединить три положительные реакции на человека, и заморозить продукт при -20 ° С для последующего использования.

2. Подготовка кляп Ампликоны для клонирования по внесение необходимых сайтов рестрикции

  1. Amplify длинного концевого повтора (LTR) / 5 'UTR часть плазмиды MJ4 (таблица 3).
  2. Представьте 1.3 кб продуктов ПЦР на осветителя, акцизные положительные ампликоны, гель для очистки и заморозить как ранееописано (1.4,1.5; рис 1В).
  3. Создать слиты MJ4 LTR- кляп ампликоны через "сплайсинга перекрытия-расширения" ПЦР (таблица 4).
  4. Представьте, акциз, очистить и заморозить 3,2 кб ампликоны как в 1.4,1.5 (смотрите рисунок 1С).

3. Клонирование Усиленный кляп гены в MJ4, подтип C, инфекционных молекулярной Clone

  1. Дайджест 1,5 мкг MJ4 плазмиды и 1,5 мкг очищенного продукта LTR- кляп ПЦР с BclI (метилирование чувствительны) рестриктазы для 1,5 ч при 50 ° С (см таблицу 5A).
  2. Добавить 1 мкл NgoMIV к реакции переваривания и инкубируют при 37 ° С в течение 1 часа.
  3. Добавить 5x красителем к ограничению переварить реакции и медленно electrophorese общий объем на 1% агарозном ТАЕ-геле, содержащем ДНК из геля пятно в течение 1-2 ч при 100 В. визуализации, акциза и очистить указанные полосы для клонирования, как ранее алфавитуribed (рисунок 2).
  4. Подготовьте перевязки реакции с использованием очищенного LTR- рвотный вставку и MJ4 векторной ДНК в 3: 1 вставки соотношения вектора. Инкубируйте реакции лигирования в течение ночи при 4 ° С (таблица 5B).
  5. Преобразование JM109 химически компетентные бактерии с лигирования продуктов и выкладывают на LB чашках с агаром с 100 мкг / мл ампициллина и расти при 30 ° С в течение 22+ часов.
    1. Оттепель JM109 компетентных клеток на льду в течение 15 мин. Этикетка 1,5 мл микроцентрифужных пробирок и охладить на льду.
    2. Алиготе 50-100 мкл JM109 клеток предварительно охлажденной 1,5 мл микроцентрифужных пробирок. Добавить 2,5-5 мкл реакции связывания в JM109 клеток, стряхивая трубку слегка перемешать и сразу же возвращаются на лед. Инкубируйте компетентных клеток с продуктом лигирования на льду в течение 30 мин.
    3. Тепловой удар 1,5 мл микроцентрифужных пробирок, содержащих JM109 компетентных клеток и реакцию лигирования в 42 ° C тепла блока в течение 45 с и вернуться на лед в течение не менее 3 мин.
    4. Добавить 50 мкл SOC сред к каждому микроцентрифужных трубки и пластины всю реакцию на преобразование при комнатной температуре LB-агаром с добавлением 100 мкг / мл ампициллина.
    5. Передача пластины до 30 ° С инкубатор и оставить на 20 часов, или до тех пор, колонии не будут четко сформированы.
  6. Выбор изолированных колоний и расти в 4 мл LB с 100 мкг / мл ампициллина, при 30 ° С в течение 22+ часов.
  7. Спин вниз культур в 3200 мкг в течение 15 мин, слить бульон, и извлечь ДНК плазмиды.
  8. Для подтверждения клонирования верность, сократить минипрепаративную ДНК с NgoMIV и HpaI ферментов рестрикции в двойной переварить при 37 ° С в течение 2 часов. Анализ на 1% агарозном ТАЕ-геле (таблица 5, в).
  9. Последовательность LTR-GAG вставка область каждой плазмиды с использованием следующих праймеров: GagInnerF1, GagF2, REV1, rev3 и GagR6 (Таблица 6), чтобы подтвердить идентичность последовательности.
  10. Сравнение клонированных последовательностей, полученных с последовательностями населения дерived от первоначального очищенной ампликоне от 1.5.1. Примечание: Важно, в конечном счете оценить потенциал репликации двух независимых клонов, чтобы гарантировать, что любые в пробирке фенотипы репликации не связаны с магистральных ошибок, вносимых в процессе клонирования.

4 поколение и титрование репликации компетентных Gag-MJ4 химерных вирусов

  1. Генерация репликации компетентного вируса путем трансфекции 1,5 мкг химерного MJ4 плазмиды ДНК минипрепаративную в клетках 293Т с использованием 4: соотношение Fugene HD 1, как описано в Prince соавт 39.
  2. Титр собирают вирусные акции на ТЗМ-BL клеток, как описано ниже и в Принс и соавторы 39.
    1. Пластинчатые ТЗМ-бл клетки 24 часа в сутки до заражения вирусом, чтобы иметь на 30-40% монослоя сливающийся клеток на следующий день. Это обычно может быть достигнуто путем добавления 5 × 10 4 клеток в общем объеме 800 мкл на лунку в 24-луночный планшет.
    2. После добавления клеток в лунку, слегка перемещать 24-луночного планшета вперед и назад, а затем из стороны в сторону для того, чтобы эффективно распределить клетки. Никогда не циркулируют - это приведет к клеток, накапливающихся в центре пластины.
    3. На следующий день, подготовить 1% FBS в DMEM; это будет использоваться для разбавления DEAE-декстрана и для разбавления вируса натуральной оспы. Со DEAE-декстран 10 мг / мл или 125x, и конечная концентрация 80 мкг / мл или 1x желательно.
    4. Выньте вирусов запас для тестирования от -80 ° C морозильник и место на шейкере таять при комнатной температуре.
    5. Использование многоканальную пипетку, последовательно разбавленной запасами вируса в культуре круглым дном ткани обрабатывают 96-луночный планшет с крышкой. Это протокол разведения в 3 раза. Смотреть таблицу 7 для схемы разбавления.
    6. Удалить носитель из посеянных 24-луночных планшетах ТЗМ-бл при помощи вакуумного аспиратора решений, чтобы не нарушить клеточный монослой. Только извлекайте носитель из одного 24-луночного планшета в то время, так что клетки делаютне высыхают.
    7. Добавить 150 мкл 1х DEAE-декстрана + 1% FBS в DMEM смеси в каждую лунку с использованием 1000 мкл пипетки. Не использовать повторное пипетки, так как это нарушает монослой.
    8. Добавить 150 мкл каждого разведения вируса в соответствующую лунку. Добавить вирус в центре скважины и вихревой нежно, чтобы равномерно распределить вирус через клеточный монослой. Инфицированные клетки инкубируют в течение 2 ч в инкубаторе для тканевых культур при 37 ° С и 5% СО 2.
    9. После 2 ч инкубации, добавление 0,5 мл 10% FBS в DMEM в каждую лунку и возврата пластин в инкубаторе в течение еще 48 часов.
    10. Через 48 ч клетки должны быть на 100% сливной. Потому MJ4 является репликация компетентный вирус, будет некоторое гибель клеток, но это и следовало ожидать.
    11. Удалить СМИ из каждой лунки и добавить 400 мкл / лунку фиксации решение (см Таблицу 8A для рецепта). Закрепить только одна пластина одновременно. Добавить фиксации решение с использованием 1000 мкл пипетки, и оставьте на 5 мин припри комнатной температуре.
    12. Удалить крепежный решение и промыть 3 раза с PBS с Са 2 + / Mg 2 +. Используйте шприц бутылку осторожно добавить PBS в сторону колодца, чтобы избежать нарушения монослой. После третьего промывания, промокните знак сухой на впитывающую бумагу.
    13. Добавить 400 мкл / лунку окрашивание раствора (таблица 8B для рецепта) в каждую лунку 24-луночного планшета и инкубировать при 37 ° С в течение по крайней мере 2 часов. Более длительное время инкубации являются приемлемыми, но время инкубации должны храниться в соответствии между титрованием экспериментов.
    14. Вымойте 2x с PBS с Са 2 + / Mg 2 + и забить на инфекции, или добавить PBS и хранят при температуре 4 ° С для озвучивания позже. Плиты можно хранить при 4 ° С в течение до четырех дней, до тех пор, монослой хранится гидратированный.
    15. Забить на инфекции, использовать постоянный маркер разделить лунки пластины 24-а на сектора. Подсчет всех синих клеток в поле зрения, используя общее увеличение порядка 200Х, один раз вкаждого из четырех квадрантов скважины.
    16. Вычислить инфекционных единиц на мкл следующим образом: [(# синий клеток / 4) × 67] / (мкл вирус, добавленный) = МЕ / мкл. В Таблице 8C по объему в мкл вируса в каждую лунку добавляли. Средние несколько скважин вместе; цифры должны быть относительно одинаковы для точного титрования.

5 приготовления питательных сред и распространении GXR25 клеток для экстракорпорального репликации Пробирной

  1. Подготовить всю RPMI (cRPMI) для распространения GXR25 клеток. ПРИМЕЧАНИЕ: Это чрезвычайно важно, чтобы культура GXR25 клеток не менее 4 месяцев до запланированных экспериментов репликации (таблица 9).
  2. Разбить ячейки 1:10 два раза в неделю и поддерживать плотность клеток между 1 х 10 5 до 2 × 10 6 клеток / мл.

6. Экстракорпоральное тиражирования Gag-MJ4 химерами в GXR25 (CEM-CCR5-GFP) Клетки

  1. Накануне Infection, разделить клетки в концентрации между 2-3 × 10 5 клеток / мл таким образом, что они находятся в логарифмической фазе роста в день инфекции.
  2. В день инфицирования, удалить с запасами вируса от -80 ° C морозильник и оттепели. Рассчитать объем необходимой вируса от каждого складе на основе МЕ / мкл титра от ПЗМ-BL анализе клеток для того, чтобы инфицировать 5 х 10 5 клеток GXR25 при множественности заражения 0,05, используя формулу:
    Объем вируса для заражения (мкл) = 1 мкл / X МЕ х 0,05 х 500000
    ПРИМЕЧАНИЕ: Мы выбрали МВД 0,05, как это приводит к логарифмической фазе роста для всех вирусов, которые мы проверили. Важно провести начальные эксперименты, чтобы определить оптимальный MOI, чтобы захватить логарифмический рост на вирус, подлежащего испытанию.
  3. Развести вирус в cRPMI до объема 100 мкл (для того, чтобы достичь 0,05 MOI) и добавить в лунку культуры V-Нижний ткани обрабатывают 96-луночного планшета. Примечание: включать как positiве (MJ4 WT зараженный) и отрицательный (макет инфицированные клетки) контроль в каждой серии экспериментов репликации. Настройте пластину таким образом, что каждый второй столбец пустой ограничить перекрестное загрязнение между скважинами. Положительный контроль является обязательным, так как он будет использоваться в дальнейшем в качестве стандарта для нормализации склоны репликации, которые мерой скорости репликации экспериментальных повторах.
  4. Количество GXR25 клеток с использованием автоматизированной счетчика клеток. Подсчитайте количество клеток, необходимых в общей для всех инфекций (5 х 10 5 х # инфекции). Алиготе необходимый объем в 50 мл коническую трубку и центрифуги для осаждения клеток. Всегда рассчитывать на 25% больше инфекций, чем нужно.
  5. Аспирируйте СМИ тщательно и ресуспендируют в cRPMI в концентрации 5 × 10 5 клеток / 100 мкл.
  6. Внесите клеток в стерильной корыто и тщательно перемешать. Использование пипетки многоканальный, добавьте 100 мкл клеток в каждую лунку 96-луночного планшета, содержащего разбавленный вирус. Мих тщательно.
  7. Добавить 2 мкл 5 мг / мл (100x) раствору полибрена в каждую лунку и смешать клетки тщательно.
  8. Инкубируют при 37 ° С в культуре ткани инкубаторе с 5% CO 2 в течение 3 часов.
  9. Для того, чтобы вымыть инфицированные клетки, центрифуги 96-луночный V-нижняя пластина для осаждения клеток. Затем осторожно удалить 150 мкл среды и заменить свежими 150 мкл cRPMI не нарушая осадок клеток. Повторите еще 2 раза (в том числе центрифугирования), чтобы достаточно мыть клетки.
  10. После последнего центрифугирования и добавлением 150 мкл cRPMI, ресуспендируют осадок клеток с помощью многоканальной пипетки и добавить весь клеток / вируса смесь (примерно 200 мкл) из каждой лунки независимо друг от друга до 800 мкл cRPMI в лунку 24-луночного культура пластины.
  11. Место пластины в 5% CO 2 культуре ткани инкубаторе при температуре 37 ° C.
  12. Каждые два дня, удалить 100 мкл надосадочной жидкости с поверхности культуры хорошо и передать 96-луночный U-bottom пластины и хранить в замороженном виде при -80 ° С до запуска вируса количественный анализ. Примечание: Тщательное размещение супернатантах в 96-луночных планшетах позволит для передачи пипетки многоканального из культуральных супернатантов в течение вириона количественного через меченного обратной транскриптазы (RT) анализа. Каждая тарелка должна содержать образцы из стандарта инфекции с целью нормализации изменение между пластины в аналитическом считывания РТ.
  13. После удаления каждого образца 100 мкл, разбить ячейки 1: 2, тщательно ресуспендированием клеток и удаления половину оставшегося объема (450 мкл). Восстановление первоначального объема (1 мл), добавляя 550 мкл свежей cRPMI в каждую лунку.

7 Анализ обратной транскриптазы (RT) в надосадочной жидкости культуры клеток

Протокол адаптировано из Островского и др 40.

  1. Настройка биологический защитный кожух в BSL-3 объекта для использования с радиоактивными материалами.
    1. Поместите фильтровальной бумагой в ого-год и заменить аспиратор для аспиратора предназначен для радиоактивных использования. Примечание: Все радиоактивные отходы должны быть утилизированы неправильно с согласно правилам техники безопасности.
  2. Добавить 1-2 мкл 10 мКи / мл [α- 33 P] дТТФ и 4 мкл 1 М дитиотреитола (DTT) в каждую 1 мл аликвоты RT мастер-смеси (таблица 10 и Ostrowski и соавт. 40).
  3. Тщательно перемешать каждый 1,5 мл микроцентрифужную трубку РТ мастер-микс, DTT, и [α- 33 P] дТТФ с 1000 мкл пипетки и переносят в стерильную корыта.
  4. 25 мкл меченого комнатной температуре смешивают в каждую лунку 96-луночного тонкостенной пластины ПЦР. Примечание: Включите пространство для положительного контроля (MJ4 WT инфекции) и отрицательного контроля (Мок инфекции).
  5. Добавить 5 мкл каждого супернатанта к пластине ПЦР, содержащего основной смеси RT.
  6. Уплотнение ПЦР пластины с покрытием из фольги клей и инкубируют в течение 2 ч при 37 ° С в амплификатор. По соображениям безопасности, РинSE наконечники с Amphyl и распоряжаться советы в небольшой контейнер, содержащих Amphyl отходов, которые в дальнейшем будут утилизировать в радиоактивных отходов.
  7. После инкубации, сделать маленькие отверстия в крышке из фольги с использованием 200 мкл многоканальный пипетки. Примечание: Если наконечники трогать жидкости в хорошо, заменить советы, прежде чем перейти к следующему строки или столбца.
  8. Mix образцы 5x и передача 5 мкл каждого образца к DE-81 бумаги. Воздух сухой 10 мин.
  9. Wash блоты 5x с 1х SSC (хлорид натрия, цитрат натрия), а затем 2x с 90% этанола в 5 мин на каждую промывку. Дайте высохнуть на воздухе.
    1. Место каждого кляксу в отдельном стиральной контейнер, например, ящик для хранения сэндвич, добавить достаточно промывочный буфер (1x SSC или 90% этанол), чтобы покрыть кляксу, и встряхивают в течение 5 мин.
    2. Вылейте промывочного буфера в отдельном контейнере и повторите. Примечание: первые 3 моет считаются радиоактивными и должны быть утилизированы должным образом. Последние 2 моющие средства могут быть утилизированы регулярно.
  10. После высыхания, автомобильefully обернуть пятном в Саран обернуть и выставить на phosphoscreen в плотно закрытой кассеты в течение ночи при комнатной температуре.
  11. Анализ phosphoscreens с Phosphorimager и количественно радиоактивные стенограммы.
  12. Нарисуйте круг вокруг каждого радиоактивного сигнала с использованием OptiQuant программного обеспечения. Графике Digital Light Unit (DLU) величины для построения кривых репликации.
  13. В целях получения оценки потенциала репликации, значения DLU были журнал 10 -transformed и склоны были рассчитаны с использованием день 2, 4, и 6 временных точек. Репликация склоны затем делится на склоне WT MJ4 в порядок генерировать десятки мощности репликации. Важно, чтобы нормализовать на основе значений MJ4 WT, полученных из того же RT пластины, чтобы уменьшить вариабельность внутри теста.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Для того чтобы правильно выполнить этот протокол, который создает провирусную плазмиды, способной сборки полностью функциональные, инфекционные химеры Gag-MJ4, большое внимание должно быть принято, чтобы генерировать соответствующие ампликоны ПЦР. Определение ПЦР породила ли соответствующего размера рвотный ампликон имеет решающее значение. Продукция должна быть в пределах 100 пар оснований (п.о.) от примерно 1700 б.п. ампликона, изображенной на рисунке 1а. Точная длина этого фрагмента будет варьироваться в зависимости от гена рвотного изучаемого. Далее, 5 'длинный концевой повтор (LTR) часть молекулярного клона MJ4 должен быть усилен и сращены с рвотного ампликона, чтобы сделать его пригодным для последующего клонирования. MJ4 LTR ампликон должно быть 1474 п.н.. Рисунок 1В показана репрезентативная изображение геля для которых правильные размеры группы, отмечаются. После сращивания-перекрытия-расширения ПЦР 41, объединенные LTR- кляп продукты должны бытьприблизительно 3200 п.н., как показано на рисунке 1В.

После того, как ген GAG был достигнут подходит для клонирования путем слияния с 5 'LTR от MJ4, который содержит сайт рестрикции надо NgoMIV, как вектора и вставки GAG должны быть расщепляли NgoMIV и BclI ферментами рестрикции, и вырезали из агарозного гел после электрофореза разделение. Крайне важно, чтобы вырезать соответствующие вектора и вводимых полосы. Представитель гель показано на рисунке 2. Вектор часть плазмиды MJ4 должна быть приблизительно 10000 пар оснований в длину, в то время как затычка вставка LTR- должно оставаться приблизительно 3000 п.н., так как сайты рестрикции расположены на крайних концах ампликон. Любое значительное уменьшение размеров укажет дополнительный вырез-сайт в рамках гена кляп в исследовании.

После лигирования двух фрагментов, бактериальный преобразования,й изоляция ДНК плазмиды, химеры Gag-MJ4 должны быть проверены на соответствующего размера, выполняя двойной переварить с NgoMIV и HpaI ферментов рестрикции. Полнометражный Gag-MJ4 химеры, которые не понесенные форме удаление события во бактериальной репликации должны иметь узор ограничения, подобный изображенному на рисунке 3, с двумя полосами примерно 8700 и 4300 б.п..

Важным отличием этого протокола по сравнению с предыдущими подходами, является использование в ВИЧ-1 подтипа C инфекционного молекулярной клона, MJ4, а не более обычный лабораторный адаптированный вируса NL4-3. Тем не менее, подходы, описанные в предыдущем разделе, могут быть модифицированы для клонирования подтипа В затычки последовательностей в pNL4-3.

Оптимизация кратности инфекции (МВД) для использования в последующих экспериментах проводили для того, чтобы выбрать идеальный МВД, который показал логарифмический рост большинства вирусов протестированных.На рисунке 4 показаны кривые репрезентативные репликации из трех различных множественностью инфекции (0,01, 0,05 и 0,25) для MJ4 (фиг.4А), а также для NL4.3 (фиг.4В). MJ4 повторяет значительно менее эффективно в GXR25 клеток, чем NL4-3, что важно учитывать, как соответствующий МВД для NL4-3 репликации, вероятно, будет слишком низким, чтобы обнаружить эффективную репликацию MJ4. Как видно на рисунке 4A, в МВД 0,05 в отличие от 0,01 или 0,25, был идеальным выбором, потому что логарифмический рост наблюдался между дней 2-6 для MJ4. Для нижней МВД, 0,01, день 6 значения DLU являются едва уловимым, и мы ожидали генерацию Gag-MJ4 химерных вирусов, которые воспроизведены ниже MJ4. Поэтому этот МВД не захватить рост более ослабленных Gag-MJ4 химер, которые также могут быть наиболее биологически критическим. Кроме того, МВД 0.25 не был идеальным, потому что быстрые кинетика вирусной репликации убит существенное AmouNT клеток даже 4 день Это приводит к кривой репликации плато, и вычисление на основе наклон кривой, такие как это будет недооценивать способность репликации. На основе кривых, полученных для NL4-3, даже при МВД 0,01, доступные целевые клеточные были заметно исчерпывается 6 день после инфицирования. В заключение, МВД 0,05 Было установлено, что оптимальным для большой панели GAG-MJ4 химерных вирусов, все из которых имели различные последовательности Gag и различную степень репликации.

В общей сложности 149 Gag-MJ4 химерных вирусов, полученных из острой подтипа C Gag последовательностей были протестированы для репликации в пробирке с использованием этого теста. Нормированные значения RC в диапазоне от 0,01 до более чем 3,5 с некоторыми вирусами тиражирование более чем в 100 раз более эффективно, чем дикого типа MJ4. Рисунок 5 показаны кривые репликации из девяти представительных GAG-MJ4 химерных вирусов, с дикого типа MJ4, изображенные на красный, и демонстрирует широкий спектр репликации сapacities наблюдается. Таким образом, последовательность разнообразие внутри гена рвотного только может существенно влиять на способность вируса к репликации в пробирке. Хотя это представитель Gag-MJ4 химерных вирусов, полученных из остро инфицированных Замбии, другие последовательности подтипа C не были тщательно протестированы, и могут проявлять различные кинетики репликации. Поэтому большое внимание должно быть принято для оптимизации МВД, чтобы удовлетворить конкретные репликацию вирусов конкретного исследования, потому что не может быть широкий спектр в уровнях репликации между различными ВИЧ-1 магистралей и Gag изолирует.

Одним из преимуществ использования Т-клеточной линии, такие как линии клеток GXR25, который поддерживает репликацию MJ4, является уровень воспроизводимости наблюдается по сравнению с экспериментами с использованием репликации стимулировали мононуклеарные клетки периферической крови в качестве мишеней. В начальных экспериментах оптимизации, MJ4 дикого типа проявляли изменчивость внутри анализа 8,7%, и differeNT клоны то же Gag-MJ4 химерный вирус выставлены изменчивости в репликации 8,5%. Поскольку различные мастер-смеси и воздействие phosphoscreen может дать значения Dlu что немного отличаются по величине, изменчивость внутри анализ может быть дополнительно контролируется управлением той же вируса стандарт (в нашем случае дикого типа MJ4) в каждом аналитическом планшете РТ. Рисунок 6 графики Значения DLU получают из того же MJ4 инфекции, количественно в восьми различных пластин RT. Нормализация к вирусу, который является общим для всех анализов RT может помочь смягчить потенциальную ошибку, вызванную этими незначительными изменениями в величине сигнала между анализов.

Межсерийная переменно был также испытан и репликатах повторяется в разные дни были тесно взаимосвязаны. Рисунок 7 участков нормированные значения оценка RC от двух независимых экспериментов, проведенных примерно в один год. Высокая степень корреляции с отсутствием крупных выбросов (R 2 = 0,873) наблюдалось ВрEEN два независимых повторов.

Хотя сильно коррелируют, есть некоторые различия в общей величине кинетики репликации между двумя независимыми экспериментами. Это может быть связано отчасти с разницей в численности прохода между GXR25 клеточного сырья, используемых в каждом эксперименте. В общем, GXR25 клетки запасы, которые были пассированные в течение периода времени, превышающего 6 месяцев, как правило, более эффективно поддерживать репликацию GAG-MJ4 химер. Поэтому, желательно, чтобы оценить возможности репликации между группами химер в месячный срок с. Когда предыдущие шаги будут тесно, этот анализ способен производить очень надежные и воспроизводимые результаты, которые применимы для широкого круга исследований.

Рисунок 1
Рис.1 представитель гель мнимойES, изображающие электрофоретического разделения продуктов ПЦР. Для всех продуктов ПЦР 5 мкл каждой реакционной смеси 50 мкл, смешивали с 3 мкл 5х загрузки красителя, загружают в 1% агарозном ТАЕ-геле с добавлением 1X SYBR-безопасной пятна гель ДНК, и разделяли электрофорезом при 120 V в течение 45 мин. Promega 1 кб ДНК лестницы (дорожка 1) был использован для приблизительные размеры ампликона. А) ген GAG был амплифицирован из вирусной РНК с помощью вложенной ПЦР подход. Благодаря вставки и удаления, кляп ампликон может варьироваться от 1600-1700 б.п. в длину и слегка появляется над 1500 б.п. фрагментация ДНК маркера. Дорожки 2-5 показывают успешной амплификации гена GAG. B) 5 'LTR из MJ4 амплифицировали из дикого типа MJ4 плазмиды и визуализировали с помощью электрофоретического разделения. Дорожки 2-5 изображают успешное усиление 1474 б.п. LTR продукта, который появляется чуть ниже 1500 б.п. фрагментация ДНК маркера. C) 5R17; LTR получены из дикого типа MJ4 и ген амплифицирован из GAG плазме пациента соединяются вместе с помощью сплайсинга перекрытия-расширения ПЦР и визуализировали с помощью электрофоретического разделения. Дорожки 2-5 изображены успешно слитые ампликоны, которые примерно 3200 б.п. по размеру, и которые появляются чуть выше 3000 б.п. фрагментация ДНК маркера.

Рисунок 2
Рисунок 2 представитель гель Изображение изображением электрофореза разделение ограничения переваривает для клонирования гена пациента кляп в MJ4. Дикого типа MJ4 плазмиду и LTR- продукты GAG слитые расщепляли BclI в течение 1,5 ч при температуре 50 ° С и NgoMIV в течение 1 часа при 37 ° C. Вектора и вводимых фрагментов были визуализированы с помощью электрофоретического разделения на 1% агарозном-TAE геля с добавлением 1X SYBR-безопасной ДНК гEL пятна при 100 V в течение 2 часов, и с помощью синий свет подсветки для того, чтобы уменьшить УФ-индуцированного повреждения ДНК. Вектор и вставки фрагментов, пригодных для последующих стадий клонирования появляются примерно в 10 000 б.п. и 2900 б.п. соответственно.

Рисунок 3
Рисунок 3 представитель гель Изображение изображением электрофоретического разделения рестрикционных переваров очищенной GAG-MJ4 химера плазмидной ДНК. Очищенный GAG-MJ4 химера плазмидной ДНК была дважды расщепляли NgoMIV и ограничение HpaI ферментами в течение 2 ч при 37 ° С. Ограничение дайджесты были визуализированы с помощью электрофоретического разделения на 1% агарозном ТАЕ-геле с добавлением 1X SYBR-безопасно ДНК из геля пятна при 120 V в течение 45 мин. Плазмиды без больших удалений будет решать две отдельные полосы примерно в 8700 и 4300 б.п..


Рисунок 4 Репликация MJ4 и NL4-3 изолятов ВИЧ-1 в клеточной линии GXR25 при различных кратности инфекции (MOI). 5 × 10 5 GXR25 клетки были инфицированы, как описано в протоколе метод с 5-кратным увеличением МВД каждый вирус складе. Супернатанты собирали в дни 2, 4, 6, 8 и после инфекции и вириона производство количественно с помощью радиоактивно меченного обратной транскриптазы. Инфекции были проведены в трех экземплярах и ошибок полосы обозначают стандартное отклонение для трех повторов. (A) MJ4 (B) NL4-3.

Рисунок 5
Рисунок 5 Представитель диапазон репликации для различных химер Gag-MJ4. 5 GXR25 клетки инфицировали диким типом MJ4 или GAG-MJ4 химер на МВД 0,05, супернатанты собирали в две дневные интервалы после инфекции, и производство вириона количественно с помощью меченого RT анализ. Введение различных генов получены кляп подтип C может иметь огромное влияние на способность репликации MJ4. Дикого типа MJ4 репликации обозначается красным цветом.

Рисунок 6
Рисунок 6 Сравнение вариации внутри анализа в радиоактивной меткой обратной транскриптазы (RT) количественное анализ. График изображает значение вариативности внутри анализа путем построения значения Dlu тех же супернатантами из одного дикого типа MJ4 инфекции в восьми различных РТ анализа пластины. Изменение кривых отражает незначительные изменения сигнала магнитудой ставкиWEEN пластины, которые могут быть исправлены для запустив стандарт на каждом РТ пластины, которые могут быть впоследствии используется для нормализации склоны Gag-MJ4 химер анализировали на той же пластинке.

Рисунок 7
Рисунок 7 Воспроизводимость анализа с течением времени репликации в клетках линии GXR25. Те же GAG-MJ4 химерные вирусы были использованы для инфицирования клеток GXR25 в двух независимых экспериментах, выполненных примерно один год друг от друга. Оценки репликации были получены путем вычисления наклон логарифмически преобразованных значений DLU и нормализации, что наклон дикого типа MJ4. Gag-MJ4 химеры, которые копируют более эффективно, чем дикого типа MJ4 есть счеты репликации больше 1, и те, которые повторить менее эффективно, чем дикого типа MJ4 есть счеты репликации менее 1. два независимых измерения сильно коррелируют (R 2 = 0,87, линейная регрессия) и выделите воспроизводимость анализов, проведенных в разное время и с клетками на разных отрывков.

)

Реагент Объем для реакции 1x (мкл)
2x Реакция Mix (Invitrogen) 25
Нуклеазы без Н 2 О 17
Прямой праймер GOF (20 мкМ концентрация) 1
Обратный праймер Вифор (20 мкМ концентрации) 1
SuperScript III Один шаг смеси ферментов 1
Шаблон РНК 5
Общий объем 50

Б)

Количество циклов Время (часы: минуты: секунды) Температура (° C)
1 1:00:00 50
1 2:00 94
10 0:15 94
0:30 56
5:00 68
40 0:15 94
0:30 56
5:00 + 5 сек / цикл 68
1 12:00 68
1 4
КОНЕЦ

Таблица 1) Мастер микс и B) кляп в первом раунде. * Примечание: последовательность GOF праймер: 5'-ATTTGACTAGCGGAGGCTAGAA-3 '. Вифор последовательность праймера: 5'-TTCTACGGAGACTCCATGACCC-3 '.

)

Реагент Объем для реакции 1x (мкл)
Нуклеазы без Н 2 О 35.5
5x Phusion HF буфера 10
дНТФ (40 мм дезоксинуклеотиды) 1
Прямой праймер GagInnerF1 (20 мкМ концентрации) 1
Обратный праймер BclIDegRev2 (20 мкМ концентрации) 1
Phusion Горячий старт II полимеразной 0.5
Первый тур ПЦР в качестве матрицы 1
Общий объем 50

Б)

Количество циклов Время (часы: минуты: секунды) Температура (° C)
1 0:30 98
29 0:10 98
0:30 53
1:00 72
1 10:00 72
1 4
КОНЕЦ

Таблица 2) Мастер микс и B) Термоциклеры условия для вложенного усиления второго круга кляп. * NПРИМЕЧАНИЕ: GagInnerF1 последовательность праймера 5'-AGGCTAGAAGGAGAGAGATG-3 '. BclIDegRev2 последовательность праймера: 5'-AGTATTTGATCATAYTGYYTYACTTTR-3 '.

)

Реагент Объем для реакции 1x (мкл)
Нуклеазы без Н 2 О 35.5
5x Phusion HF буфера 10
дНТФ (40 мм дезоксинуклеотиды) 1
Прямой праймер MJ4For1b (20 мкМ концентрации) 1
Обратный праймер MJ4Rev (20 мкМ концентрации) 1
Phusion Горячий старт II полимеразной 0.5
MJ4 плазмиды в качестве матрицы (10 нг / мкл) 1
Общий объем 50

Б)

Количество циклов Время (часы: минуты: секунды) Температура (° C)
1 0:30 98
29 0:10 98
0:30 58
0:45 72
1 10:00 72
1 4
КОНЕЦ

Таблица 3) Мастер микс и B) Термоциклеры условия для 5 'MJ4 LTR усиления. * Примечание: последовательность MJ4For1b праймер: 5'-CGAAATCGGCAAAATCCC-3 '. MJ4Rev последовательность праймера: 5 '-CCCATCTCTCTCCTTCTAGC-3 '.

)

Реагент Объем для реакции 1x (мкл)
Нуклеазы без Н 2 О 34.5
5x Phusion HF буфера 10
дНТФ (40 мм дезоксинуклеотиды) 1
Прямой праймер MJ4For1b (20 мкМ концентрации) 1
Обратный праймер BclIRev (20 мкМ концентрации) 1
MJ4 LTR 1,3 кб ампликона (гель-очистке, ~ 50 нг) 1
Phusion Горячий старт II полимеразной 0.5
Затычка ампликона (гель-очистке, ~ 100 нг) 1
Общий объем 50

Б)

Количество циклов Время (часы: минуты: секунды) Температура (° C)
1 0:30 98
29 0:10 98
0:30 58
1:30 72
1 10:00 72
1 4
КОНЕЦ

Таблица 4) Мастер микс и B) Термоциклеры условия для сплайсинга перекрытия удлинения ПЦР для генерации LTR- кляп вставки. * Примечание: BclIRev праймера 5'-TCTATAAGTATTTGATCATACTGTCTT-3 '

)

Реагент Объем для реакции 1x (мкл) Инкубационный (часы) Инкубационный температура (° C)
1.5 мкг 3 кб LTR- кляп ампликоне или MJ4 плазмиды х мкл 1,5 мкг
NEB CutSmart буфера (ранее NEB буфер # 4) 2
BclI рестриктазы 1
Нуклеазы без Н 2 О х
Общий объем 19 1.5 50
NgoMIV рестриктазы 1
Общий объем 20 1 37

Б)

Реагент Объем для реакции 1x (мкл) Инкубационный (часы) Инкубационный температура (° C)
50 нг вырезать MJ4 плазмиды вектор х мкл 50 нг
45 нг вырезать LTR- кляп вставка (отношение 3: 1) х мкл в течение 45 нг
Roche 10x лигазного буфера 2
Рош ДНК-лигазы Т4 (5 ед / мкл) 1
Нуклеазы без Н 2 О
Общий объем 20 18 + (на ночь) 4

С)

Реагент Объем для реакции 1x (мкл) Инкубационный (часы) Инкубационный температура (° C)
450 нг Gag-MJ4 плазмиды х мкл для 450 нг
NEB CutSmart буфера (ранее NEB буфер # 4) 2
NgoMIV рестриктазы 0.5
HpaI рестриктазы 0.5
Нуклеазы без Н 2 О х
Общий объем 20 2 37

Таблица 5) Ограничение переварить основной смеси и В) реакцию лигирования для генерации Gag-MJ4 химерный провирус. C) Диагностический ограничения дайджеста обеспечения Gag-MJ4 клонирования верность.

Грунтовка Имя Нуклеотидной последовательности (5 '- 3')
GagInnerF1 AGGCTAGAAGGAGAGAGATG
GagF2 GGGACATCAAGCAGCCAT
For3 CTAGGAAAAAGGGCTGTTGGAAATG
GagR6 CTGTATCATCTGCTCCTG
Rev3 GACAGGGCTATACATTCTTACTAT
Rev1 AATTTTTCCAGCTCCCTGCTTGCCCA

Таблица 6 Список секвенирования праймеров, необходимых для подтверждения 5 'LTR и последовательность кляп личность Gag-MJ4 химерных провирусом.

Ну 8 вирус мкл + 232 мкл 1% FBS в DMEM
Ну B 80 мкл от Well A + 160 мкл 1% FBS в DMEM
Ну C 80 мкл от Well B + 160 мкл 1% FBS в DMEM
Ну D 80 мкл от Well C + 160 мкл 1% FBS в DMEM
Ну E 80 мкл от Well D + 160 мкл 1% FBS в DMEM
Ну F 80 мкл от Well E + 160 мкл 1% FBS в DMEM

Таблица 7 Схема разведения (3раза) для титрованием инфекционные вирусы на ТЗМ-бл клеток.

)

Реагент Объем
PBS без Ca 2 + или Mg 2 + 500 мл
Глютаральдегида оболочки 4 мл
Формальдегид 11 мл

* Примечание: Хранить при 4 ° С.

Б)

Реагент Объем
PBS без Ca 2 + или Mg 2 + 4,75 мл
Калий феррицианид (0,2 М) 100 мкл
Калий ферроцианид (0,2 М) 100 мкл
Хлорид магния (1 М) 20 мкл
X-Gal (50 мг / мл) 40 мкл

* Примечание: Убедитесь, свежий и не хранить вдали от света до использования.


C.

Оригинал Разведение хорошо B C D E F
Объем вируса (мкл) добавляли в лунки пластины ряду 24-луночного 5 1.6667 0,5556 0,1852 0,06173 0,02057

Таблица 8) B) крепления решения для титрованием из Gag-MJ4 химерных вирусов на ПЗМ-бл линии индикатор клеток. C) Объем вируса на лунку для расчета инфекционных единиц / мкл.

Реагент Объем
Фетальной бычьей сыворотки (FBS), определяется 55 мл
Пенициллин, стрептомицин, глутамин (100x) 6 мл
HEPES буфера (1 М) 6 мл

Таблица 9 Рецепт для полного RPMI средой для распространения GXR25 клеток.

Реагент Объем (мл)
Nuclease-бесплатный H 2 O 419,5
Трис-Cl, рН 7,8 (1 М) 30
Хлорид калия (1 М) 37.5
Хлорид магния (1 М) 2.5
Nonidet P-40 (10%) 5
ЭДТА (0,5 М) 1.02
Полиадениловая кислоты, соли калия (2 мг / мл) 1.25
Олиго-дТ грунтовки (25 мкг / мл) 3.25
Общий объем 500

Таблица 10 Рецепт для радиоактивно обратной транскриптазы пробирного мастера микса. * Примечание: магазин, как 1 мл аликвоты при -20 ° С.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Благодаря длине и технического характера этого протокола, есть несколько шагов, которые имеют решающее значение как для успешного строительства химерных Gag-MJ4 плазмид, а также для количественного определения вирусной мощностью репликации. Хотя на основе стратегии клонирования рестриктазы для введения генов в иностранной кляп в MJ4, изложенной в настоящем протоколе имеет целый ряд преимуществ перед ранее используемых методов рекомбинации основе, протокол может быть технически сложным, если критические шаги не следуют точно.

Во-первых, это абсолютно необходимо, чтобы использовать MJ4 ДНК плазмиды, что был сгенерирован в компетентном бактериального штамма, не удовлетворяющих DCM и дамб метилаз ДНК. Это необходимо, поскольку ферментативной активности рестриктазой BclI, который используется, чтобы клонировать гены кляп в MJ4 позвоночника, является плотина / DCM метилирование чувствительным. JM110 и SCS110 (Энда отрицательный JM110 производная) Е. штаммы палочкиповторно подходит для генерации неметилированную MJ4 плазмидной ДНК. Кроме того, для удаления векторных и вставки диапазонах, то настоятельно рекомендуется синий свет осветителя использоваться для визуализации. Это позволит уменьшить УФ зависит от длины волны повреждение ДНК и резко увеличить эффективность клонирования. Если синий свет осветителя недоступен, клонирования, эффективности можно увеличить путем визуализации ДНК с SYBR Сейф ДНК гель пятно вместо этидийбромидом и минимизации времени УФ-облучения.

Наконец, Molecular Cloning с большим (> 10 КБ) и / или ретровирусных плазмиды, такие как MJ4 традиционно трудным для множества причин. Большие плазмиды снизить эффективность трансформации компетентных бактериальных штаммов 42, а ретровирусные вставки, которые содержат длинный концевой повтор (LTR) последовательности, снизить стабильность плазмиды и компромисса репликации верности плазмидной ДНК в бактериальной хозяина, ведущей к делеции ретровирусного генома 43 E. Штамм над штамма DH5 &, в наших руках. В связи с нестабильной природы плазмиды, очищенные продукты плазмиды всегда должны быть проверены на правильный размер плазмид с помощью рестриктазой; Здесь, двойной переварить с рестрикционных эндонуклеаз NgoMIV и HPAI при 37 ° С в течение 2 часов.

После успешной генерации химерных Gag-MJ4 плазмид было достигнуто, вирус генерируется с помощью трансфекции 293T клетки, титровали на линии индикаторного элемента, ПЗМ-BL клеток и способности репликации измеряют с использованием СЕМ на основе линии Т-клеток. СЕМ на основе клеточной линии GXR25 используется для репликации этих исследований является одним из нескольких строк установлено Т-клеток, способных поддерживать запись и репликацию CCR5-тропные штаммы ВИЧ-1. Это было достигнуто за счет ретровирусной трансдукции, чтобы позволить стабильной экспрессии CCR5 человека 37. Эта клеточная линия, естественно, выражает CXCR4 и будет поддерживать репликацию CXCR4-тропных ВИЧ-1, такие как лаборатории приспособлены деформации NL4-3. Тем не менее, для того, чтобы поддерживать эффективную репликацию CCR5-тропные штаммы, такие как MJ4, клетки GXR25 должны быть размножены в течение не менее 4 месяцев до заражения. Правильно пассировать культуры может поддерживать репликацию даже после пассажей на срок до 1 года. Тщательный мониторинг CCR5-тропического репликации всей пассажей имеет важное значение для успешных экспериментов.

Как и в любой технике, существуют ограничения на протокол, который необходимо учитывать. Благодаря расположению сайтов рестрикции в плазмиде MJ4, а также наличия консервативных сайтов рестрикции в природе штаммы ВИЧ-1, дистальный сайт рестрикции 3', BclI, находится 137 нуклеотидов от GAG стоп-кодона. Хотя это порождает химерный ген протеазы, этот регион является 96,5% сохраняется в этой когорте, и мы не наблюдали обилие мертвых или дефектных химерных вирусов.

Одним из преимуществ использования MJ4 подтипа C инфекционный молекулярную клон с подтипом C полученных последовательностей в том, что он снижает риск неоптимального гена спаривания между генами и затычки магистральных векторов различных подтипов. Тем не менее, определенное количество в-клады разнообразия существует, о чем свидетельствует кластеризации ВИЧ-1 последовательностей от страны или региона, даже когда нашли в том же подтипа 31. Это может способствовать неоптимального спаривания между гены кляп дерived от остро инфицированных Замбии и MJ4 инфекционного молекулярной клона позвоночника, которая была получена на основе хронически инфицированного человека из Ботсваны 38. Тем не менее, большинство анализируемых конструкций производится инфекционного вируса потомства. В отличие ВИЧ-1 подтипа C инфекционные молекулярные клоны стали более широко доступны, это будет важно для дальнейшей проверки этой системы путем клонирования в этих ВИЧ-1 клады C генов кляп в другие магистралей в целях обеспечения того, существует минимальный уклон введены в связи в магистральных несовместимости.

Клеточная линия GXR25 является уникальным клеточная линия, специально в связи с его способностью поддерживать как CXCR4 и CCR5-Тропик штаммов и его ВИЧ-1 индуцибельный GFP репортер 37. Тем не менее, существуют некоторые ограничения и должны быть тщательно продуманы, прежде чем использовать эту линию клеток для экспериментов, адаптированных с этим протоколом. Клеточная линия GXR25, кажется, не поддерживает вступление большинством подтипа C или A, CCR5-тропик, прimary изолирует мы проверили. Кроме того, родитель СЕМ клеточной линии, из которой клеточная линия получена GXR25 обладает высокой уровни циклоспорин А, до 2 до 4 раз выше, чем выражение Jurkat клеточной линии 44. В связи с высоким уровнем циклоспорин А, дефект репликации, обычно связанные с каноническим HLA-B * 57, связанного побега мутации, T242N, что связано с уменьшением способности капсида, чтобы связать циклоспорин А, не могут быть легко обнаружены в этой конкретной клеточной линии 25. Таким образом CEM основе линия GXR25 клеток не является идеальным для изучения дефектов репликации, связанные с мутациями в ВИЧ-1 капсида циклофилином связывания петли.

Наконец, в то время как этот протокол идеально подходит для анализа потенциала репликации кляп последовательностей, полученных из острых моментов времени, изменения должны быть сделаны для того, чтобы изучить возможности репликации кляп гены, полученные из хронически инфицированных лиц. Этот протокол предполагает утраplification последовательностей населения от острых моментов времени (медиана 45 дней после даты инфекции оценивается), когда вирусная разнообразие ограничено. Ген GAG из каждой химеры затем секвенировали и сравнивали с начальной популяции ПЦР ампликона, чтобы обеспечить точность клонирования. В связи с ограниченным разнообразием последовательности при острых моментов времени, клонирование от населения продуктов ПЦР можно. Тем не менее, последовательность разнообразие существует в вирусных квазивидов хронически инфицированным человеком; Поэтому, для того, чтобы точно оценить способность репликации хронических квазивидов, одного амплификации генома должны быть использованы, чтобы захватить несколько представительные варианты. Каждый из этих вариантов должны быть проанализированы для репликации в пробирке.

Этот метод имеет несколько более широкое применение, которые вытекают из ее преимуществ по сравнению с существующими методами. Так как этот процесс приводит к клонального к репликации плазмиды, это простой в использовании конструкции для дополнительной мutagenesis исследования, которые могут помочь выяснить вклад конкретных остатков в репликации вируса. Кроме того, путем клонирования генов кляп из продольных моменты времени, можно оценить эволюцию вирусной мощностью репликации с течением времени и как эти изменения могут повлиять на патогенез в ВИЧ-1 инфицированным человеком.

Эта техника может быть изменен с целью расширения его полезность для различных приложений. Дополнительные ВИЧ-1 вирусные белки могут быть сконструированы в плазмиду MJ4 того, чтобы оценить их воздействие на репликацию вируса или их взаимодействия с хост-белков. Это может быть достигнуто путем инженерно дополнительные ограничения сайтов в требуемых регионах в геноме путем введения молчащих нуклеотидных замен. Тем не менее, особое внимание должно быть принято при проектировании новых сайтов рестрикции в «половине ВИЧ-1 генома как многие вспомогательные белки кодируются в альтернативных рамок считывания 3 и скрытых изменений в одинБелок может привести к аминокислотных замен в другой. В этом случае, сайт рестрикции независимые методы клонирования, такие как те, которые обсуждались на Дадли и соавт. 45 может преодолеть это ограничение. Вирусные последовательности, полученные из разных популяций могут иметь различные диапазоны мощностей репликации, и МВД может быть соответствующим образом скорректированы с целью захвата большинство вирусных изолятов в пределах своей логарифмической фазе роста. И, наконец, линия клеток GXR25 был стабильно трансфицированных GFP под LTR-ведомый, Tat-индуцируемого промотора, и распространение вируса может быть измерена как функция GFP-положительных клеток с помощью проточной цитометрии 37 в качестве альтернативы анализа RT, описанной здесь, или традиционный p24 ELISA.

В заключение, этот протокол обеспечивает эффективную и мощную технику для оценки ВИЧ-1 репликации вируса, как присвоено геном кляп, который кодирует консервативный структурный белок необходим для правильного формирования вириона, Подающий надежды, созревание, и демонтаж 46-48. Кроме того, этот метод генерирует репликации компетентного клонального плазмиды, который идеально подходит для исследований мутагенеза и, таким образом, обеспечивает способ для выяснения конкретных аминокислотных детерминанты вирусного пригодности. Исследования, подобные этим, являются обязательными для повышения понимания того, как вирусная эволюция иммунной приводом влияет патогенез и прогрессирование заболевания у ВИЧ-1-инфицированных лиц.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
PCR Reagents
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagF2: 5' GGGACATCAAGCAGCCAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagR6: 5' CTGTATCATCTGCTCCTG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
CoolRack PCR 96 XT Biocision BCS-529
CoolRack M15 Biocision BCS-125
Nuclease free water Fisher SH30538FS Manufactured by Hyclone
QIAamp Viral RNA Mini Kit Qiagen 52906
Simport PCR 8 Strip Tubes, Blue (Flat Cap) Daigger EF3647BX
SuperScript III one-step RT-PCR system Life Technologies/Invitrogen 12574035
Phusion Hot-start II DNA polymerase Fisher F-549L
PCR Nucleotide Mix Roche 4638956001
Agarose, high gel strength Fisher 50-213-128
TAE 10X Life Technologies/Invitrogen AM9869
Promega 1 kb DNA ladder Fisher PRG5711 Manufactured by Promega
Sybr Safe DNA Gel Stain, 10,000x Life Technologies/Invitrogen S33102
Wizard SV Gel and PCR Clean-Up System Promega A9282
Razor blades, single-edged Fisher 12-640 Manufactured by Surgical Design
Thermocycler, PTC-200 MJ Research
Microbiology & Cloning Reagents
LB Agar, Miller Fisher BP1425-2
LB Broth, Lennox Fisher BP1427-2
Sterile 100 x 15 mm polystyrene Petri dishes Fisher 08-757-12
Ampicillin sodium salt Sigma-Aldrich A9518-5G
Falcon 14 ml Polypropylene round-bottom tubes BD Biosciences 352059
NgoMIV restriction endonuclease New England BioLabs R0564L
BclI restriction endonuclease New England BioLabs R0160L
HpaI restriction endonuclease New England BioLabs R0105L
T4 DNA Ligase, 5 U/μl Roche 10799009001
JM109 competent cells, >108 cfu/μg Promega L2001
PureYield plasmid miniprep system Promega A1222
Safe Imager 2.0 Blue Light Transilluminator Invitrogen G6600
Microfuge 18 centrifuge Beckman Coulter 367160
Cell Culture Reagents
Amphyl cleaner/disinfectant Fisher 22-030-394
Fugene HD, 1 ml VWR PAE2311 Manufactured by Promega
Hexadimethrine bromide (Polybrene) Sigma-Aldrich H9268-5G
Costar Plates, 6-well, flat Fisher 07-200-83 Manufactured by Corning Life
Costar Plates, 24-well, flat Fisher 07-200-84 Manufactured by Corning Life
Costar Plates, 96-well, round Fisher 07-200-95 Manufactured by Corning Life
Flasks, Corning filter top/canted neck, 75 cm2 Fisher 10-126-37
Flasks, Corning filter top/canted neck, 150 cm2 Fisher 10-126-34 Manufactured by Corning Life
Conical Tubes, 50 ml, blue cap Fisher 14-432-22 Manufactured by BD Biosciences
Conical Tubes, 15 ml, blue cap Fisher 14-959-70C Manufactured by BD Biosciences
Trypsin-EDTA Fisher MT25052CI Manufactured by Mediatech
RPMI, 500 ml Life Technologies/Invitrogen 11875-119
DMEM, 500 ml Life Technologies/Invitrogen 11965-118
Penicillin/Streptomycin/Glutamine, 100x Life Technologies/Invitrogen 10378-016
PBS with magnesium and calcium, 500 ml Life Technologies/Invitrogen 14040-133
PBS without magnesium and calcium Life Technologies/Invitrogen 20012-050
Sarstedt tubes, assorted colors Sarstedt 72.694.996
Reservoir Trays for Multichannel, 55 ml Fisher 13-681-501
DEAE-Dextran Fisher NC9691007
Corning 96 well clear V bottom tissue culture treated microplate Fisher 07-200-96 Manufactured by Corning Life
HEPES, 1 M Buffer Solution Life Technologies/Invitrogen 15630-080
FBS, Defined, 500 ml Fisher SH30070 03
X-gal VWR PAV3941 Manufactured by Promega
Glutaraldehyde, Grade II, 25% in H2O Sigma-Aldrich G6257-100ML
1 M Magnesium chloride solution Sigma-Aldrich M1028-100ML
Formaldehyde solution, for molecular biology, 36.5% Sigma-Aldrich F8775-500ML
Potassium hexacyanoferrate(II) trihydrate Sigma-Aldrich P9387-100G
Potassium hexacyanoferrate(III) Sigma-Aldrich P8131-100G
Allegra X15-R centrifuge Beckman Coulter 392932
TC10 automated cell counter Bio-Rad 1450001
VistaVision inverted microscope VWR
Reverse-Transcriptase Quantification Assay Reagents
dTTP, [α-33P]- 3000 Ci/mmol, 10 mCi/ml, 1 mCi Perkin-Elmer NEG605H001MC
1 M Tris-Cl, pH 8.0 Life Technologies/Invitrogen 15568025 Must be adjusted to pH 7.8 with KOH
2 M Potassium chloride (KCl) Life Technologies/Invitrogen AM9640G Adjust to 1 M solution
0.5 M EDTA Life Technologies/Invitrogen 15575-020
Nonidet P40 Roche 11333941103
Polyadenylic acid (Poly rA) potassium salt  Midland Reagent Co. P-3001
Oligo d(T) primer Life Technologies/Invitrogen 18418-012
Dithiothreitol (DTT) Sigma-Aldrich 43815-1G
SR, Super Resolution Phosphor Screen, Small Perkin-Elmer 7001485
Corning Costar Thermowell 96-well plate model (M) Polycarbonate Fisher 07-200-245 Manufactured by Corning Life
Corning 96-well Microplate Aluminum Sealing Tape, Nonsterile Fisher 07-200-684 Manufactured by Corning Life
DE-81 anion exchange paper Whatman 3658-915
Trisodium citrate dihydrate Sigma-Aldrich S1804-1KG
Sodium Chloride Fisher S671-3
Autoradiography cassette Fisher FB-CA-810
Cyclone storage phoshpor screen Packard

DOWNLOAD MATERIALS LIST

References

  1. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., Oldstone, M. B. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. Journal of virology. 68, 6103-6110 (1994).
  2. Koup, R. A., et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. Journal of virology. 68, 4650-4655 (1994).
  3. Jin, X., et al. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. The Journal of experimental medicine. 189, 991-998 (1999).
  4. Schmitz, J. E., et al. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science. 283, 857-860 (1999).
  5. Brumme, Z. L., et al. Marked epitope- and allele-specific differences in rates of mutation in human immunodeficiency type 1 (HIV-1) Gag, Pol, and Nef cytotoxic T-lymphocyte epitopes in acute/early HIV-1 infection. Journal of virology. 82, 9216-9227 (2008).
  6. Leslie, A. J., et al. HIV evolution: CTL escape mutation and reversion after transmission. Nature medicine. 10, 282-289 (2004).
  7. Phillips, R. E., et al. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature. 354, 453-459 (1991).
  8. Price, D. A., et al. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proceedings of the National Academy of Sciences of the United States of America. 94, 1890-1895 (1997).
  9. Goulder, P. J., et al. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nature. 3, 212-217 (1997).
  10. Tang, J., et al. Favorable and unfavorable HLA class I alleles and haplotypes in Zambians predominantly infected with clade C human immunodeficiency virus type 1. Journal of virology. 76, 8276-8284 (2002).
  11. Prentice, H. A., et al. HLA-B*57 versus HLA-B*81 in HIV-1 infection: slow and steady wins the race. Journal of virology. 87, 4043-4051 (2013).
  12. Migueles, S. A., et al. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proceedings of the National Academy of Sciences of the United States of America. 97, 2709-2714 (2000).
  13. Leslie, A., et al. Additive contribution of HLA class I alleles in the immune control of HIV-1 infection. Journal of virology. 84, 9879-9888 (2010).
  14. Kaslow, R. A., et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nature medicine. 2, 405-411 (1996).
  15. Altfeld, M., et al. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS. 17, 2581-2591 (2003).
  16. Kiepiela, P., et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nature medicine. 13, 46-53 (2007).
  17. Mothe, B., et al. Definition of the viral targets of protective HIV-1-specific T cell responses. Journal of translational medicine. 9, 208 (2011).
  18. Peyerl, F. W., Barouch, D. H., Letvin, N. L. Structural constraints on viral escape from HIV- and SIV-specific cytotoxic T-lymphocytes. Viral immunology. 17, 144-151 (2004).
  19. Rolland, M., et al. Broad and Gag-biased HIV-1 epitope repertoires are associated with lower viral loads. PloS one. 3, e1424 (2008).
  20. Wagner, R., et al. Molecular and functional analysis of a conserved CTL epitope in HIV-1 p24 recognized from a long-term nonprogressor: constraints on immune escape associated with targeting a sequence essential for viral replication. J Immunol. 162, 3727-3734 (1999).
  21. Wang, Y. E., et al. Protective HLA class I alleles that restrict acute-phase CD8+ T-cell responses are associated with viral escape mutations located in highly conserved regions of human immunodeficiency virus type 1. Journal of virology. 83, 1845-1855 (2009).
  22. Chopera, D. R., et al. Transmission of HIV-1 CTL escape variants provides HLA-mismatched recipients with a survival advantage. PLoS pathogens. 4, e1000033 (2008).
  23. Crawford, H., et al. Evolution of HLA-B*5703 HIV-1 escape mutations in HLA-B*5703-positive individuals and their transmission recipients. The Journal of experimental medicine. 206, 909-921 (2009).
  24. Boutwell, C. L., et al. Frequent and variable cytotoxic-T-lymphocyte escape-associated fitness costs in the human immunodeficiency virus type 1 subtype B Gag proteins. Journal of virology. 87, 3952-3965 (2013).
  25. Brockman, M. A., et al. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. Journal of virology. 81, 12608-12618 (2007).
  26. Crawford, H., et al. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. Journal of virology. 81, 8346-8351 (2007).
  27. Martinez-Picado, J., et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. Journal of virology. 80, 3617-3623 (2006).
  28. Schneidewind, A., et al. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. Journal of virology. 81, 12382-12393 (2007).
  29. Wright, J. K., et al. Impact of HLA-B*81-associated mutations in HIV-1 Gag on viral replication capacity. Journal of virology. 86, 3193-3199 (2012).
  30. Kawashima, Y., et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature. 458, 641-645 (2009).
  31. Goepfert, P. A., et al. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. The Journal of experimental medicine. 205, 1009-1017 (2008).
  32. Brockman, M. A., et al. Early selection in Gag by protective HLA alleles contributes to reduced HIV-1 replication capacity that may be largely compensated for in chronic infection. Journal of virology. 84, 11937-11949 (2010).
  33. Huang, K. H., et al. Progression to AIDS in South Africa is associated with both reverting and compensatory viral mutations. PloS one. 6, e19018 (2011).
  34. Wright, J. K., et al. Gag-protease-mediated replication capacity in HIV-1 subtype C chronic infection: associations with HLA type and clinical parameters. Journal of virology. 84, 10820-10831 (2010).
  35. Wright, J. K., et al. Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype. C. Journal of virology. 85, 3996-4006 (2011).
  36. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of virology. 59, 284-291 (1986).
  37. Brockman, M. A., Tanzi, G. O., Walker, B. D., Allen, T. M. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. Journal of virology. 131, 134-142 (2006).
  38. Ndung'u, T., Renjifo, B., Essex, M. Construction and analysis of an infectious human Immunodeficiency virus type 1 subtype C molecular clone. Journal of virology. 75, 4964-4972 (2001).
  39. Prince, J. L., et al. Role of transmitted Gag CTL polymorphisms in defining replicative capacity and early HIV-1 pathogenesis. PLoS pathogens. 8, e1003041 (2012).
  40. Ostrowski, M. A., Chun, T. W., Cheseboro, B., Stanley, S. K., Tremblay, M., et al. Detection assays for HIV proteins. Current protocols in immunology / edited by John E. Coligan ... [et al.]. 12, (Unit 12 15), Forthcoming.
  41. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, 61-68 (1989).
  42. Inoue, H., Nojima, H., Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene. 96, 23-28 (1990).
  43. Bichara, M., Pinet, I., Schumacher, S., Fuchs, R. P. Mechanisms of dinucleotide repeat instability in Escherichia coli. Genetics. 154, 533-542 (2000).
  44. Ackerson, B., Rey, O., Canon, J., Krogstad, P. Cells with high cyclophilin A content support replication of human immunodeficiency virus type 1 Gag mutants with decreased ability to incorporate cyclophilin A. Journal of virology. 72, 303-308 (1998).
  45. Dudley, D. M., et al. A novel yeast-based recombination method to clone and propagate diverse HIV-1 isolates. BioTechniques. 46, 458-467 (2009).
  46. Ganser-Pornillos, B. K., von Schwedler, U. K., Stray, K. M., Aiken, C., Sundquist, W. I. Assembly properties of the human immunodeficiency virus type 1 CA protein. Journal of virology. 78, 2545-2552 (2004).
  47. Forshey, B. M., von Schwedler, U., Sundquist, W. I., Aiken, C. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. Journal of virology. 76, 5667-5677 (2002).
  48. Gottlinger, H. G., Dorfman, T., Sodroski, J. G., Haseltine, W. A. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proceedings of the National Academy of Sciences of the United States of America. 88, 3195-3199 (1991).
Рестриктазой основе Клонирование метод оценки<em&gt; В пробирке</em&gt; Репликация Емкость ВИЧ-1 подтипа С Gag-MJ4 химерных вирусов
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).More

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter