Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

تحفيز حشوية DNA الاستشعار عن مسارات doi: 10.3791/51593 Published: September 18, 2014

Summary

الهدف من البروتوكول هو استخدام الأساليب المثلى لتحفيز مسارات الاستشعار عن الحمض النووي في خلايا حشوية والحية. ويتحقق ذلك من خلال تحسين توليد DNA طويلة، المزدوج تقطعت بهم السبل أثناء حادة في نهاية ربط. الخلايا أو الفئران ثم يتم transfected باستخدام كاشف ترنسفكأيشن الدهون.

Abstract

من أجل تحفيز كفاءة الاستجابة المناعية الفطرية، يجب أن يكون الحمض النووي من طول ونقاء كافية. نقدم طريقة حيث تقطعت بهم السبل الحمض النووي المزدوج (dsDNA) الذي له خصائص المطلوبة لتحفيز DNA حشوية يمكن أن تتولد مسارات الاستشعار بثمن بخس وبكل سهولة. قبل concatemerization من، أليغنوكليوتيد] الاصطناعية قصيرة (التي تفتقر إلى زخارف الدليل السياسي الشامل)، يمكن أن تتولد dsDNA أن يكون من طول كافية لتفعيل عصاري خلوي مسار الاستشعار DNA. هذا البروتوكول يتضمن ربط نهاية حادة من أليغنوكليوتيد] في وجود البولي ايثيلين جلايكول (PEG)، والذي يوفر بيئة للربط كفاءة تحدث. وconcatemers dsDNA يمكن استخدامها بعد تنقية عن طريق استخراج الفينول / الكلوروفورم، لمحاكاة الاستجابة المناعية الفطرية في المختبر بواسطة بروتوكولات ترنسفكأيشن القياسية. ويمكن أيضا أن تستخدم هذا الحمض النووي لتحفيز المناعة الفطرية في الجسم الحي عن طريق الحقن داخل الأدمة في الصيوان الأذن على فأرة الحاسوب، على سبيل المثال. بواسطةتوحيد عملية concatemerization والبروتوكولات التحفيز لاحقة، يمكن أن تنتج وتفعيل موثوقة وقابلة للتكرار للنظام المناعة الفطري.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

الحمض النووي هو مكون أساسي من مكونات كل الكائنات الحية والخلايا، والتي تبقي حقيقيات النوى في مقصورات محددة. واحد وظيفة الجهاز المناعي الفطري هي تحديد عندما يكسر هذا التقسيم لأسفل أو عند إدخال مواد غريبة في الحي عبر خرق والحواجز المادية الخارجية. في جسم الإنسان هناك عدد من البروتينات التي توجد للمساعدة تتحلل كميات صغيرة من الحمض النووي التي قد هربا من التقسيم الصحيح. الدناز I، II، III وتحطيم الحمض النووي في البلازما، دخلول؛ جسيم داخلي، والعصارة الخلوية، على التوالي. ومع ذلك، فقد تبين أن الفئران التي تفتقر إلى الدناز الثاني تموت من فقر الدم الشديد الناجم عن الإفراط في إنتاج إنترفيرون 1 مما يشير إلى أن نظام المناعة الفطري يستجيب لDNA خارج النووي. حدوث هذه الاستجابة حتى في الفئران التي تعاني من نقص تماما في قدرة مستقبلات الإشارات شبيهة عدد القتلى. وقد أظهرت العديد من الدراسات الآن أن مشجعا للجينات الانترفيرون (STING) 2 وملزم TANK كيناز 1 (TBوتشارك K1) 3 في الكشف عن الحمض النووي في السيتوبلازم وهذا يشير مسار ينشط عامل الانترفيرون التنظيمي (IRF) -3 4. والتي تعتمد على IRF3 النسخ اللاحقة من خلوى، chemokine، وجينات الانترفيرون هو سمة من الاستجابة المناعية الفطرية إما الممرض أو الخطر المرتبطة نمط الجزيئية (PAMP أو رطبة) 5.

وقد أدت الرغبة في دراسة مسارات الاستشعار الحمض النووي داخل الخلايا لمتطلبات لتطوير أساليب قوية وقابلة للتكرار لتحفيز الخلايا عن طريق إدخال DNA أو RNA في الخلايا من دون تنشيط الاستجابات المناعية الفطرية الأخرى. واحدة الطريقة التي يمكن حفز STING / TBK1 / IRF3 المسار هو باستخدام الكواشف ترنسفكأيشن الدهون الموجبة لتقديم حامض النووي في السيتوبلازم حيث يمكن الوصول إليها من قبل أجهزة الاستشعار DNA مثل DNA-PK، IFI16، وcGAS 6-8.

خصائص الحمض النووي التي تفهم حاليا للسماح للممثل المؤسسةتفعيل icient من الاستجابة المناعية الفطرية هيولي دون تحفيز مسارات غيرها من طوله والكتلة، والنقاء، وعدم وجود الدليل السياسي الشامل الزخارف 4،7،9. أليغنوكليوتيد] الاصطناعية هي مناسبة للغاية لغرض توليد استجابة مناعية فطرية لأنها تسمح تسلسل الحمض النووي ليكون الأمثل وإعداد كنوع كيميائية نقية. وحددت الحمض النووي (ISD) تسلسل المناعة تنشيطية 45 زوج قاعدة من القبعة وآخرون. 4 عن كونه مناسبة، تسلسل مجانا الدليل السياسي الشامل لهذا الغرض. هذا التسلسل dsDNA هو إلا عشوائية وليس لديه سمات محددة وراء افتقارها إلى زخارف الدليل السياسي الشامل. لقد وجدنا أن من concatemerizing قليل النوكليوتيد ISD إلى خيوط أطول بشكل ملحوظ يزيد من حجم التحفيز 7. جيل من ISD concatemerized بالتالي فهو مفيد لتحفيز الاستجابة المناعية الفطرية حشوية. هنا نقدم بروتوكولات لإعداد هذا كاشف وكيف يمكن استخدامها لتفعيل مسار الاستشعار عن الحمض النووي فيالمختبر كذلك في الجسم الحي.

ملاحظة: يتم تنفيذ كافة الدراسات على الحيوانات تحت بروتوكولات المؤسسية المعتمدة والمبادئ التوجيهية رعاية الحيوان.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Concatemerization

  1. الاشعال في resuspend مهاجم ورف (انظر جدول المواد للتسلسل التمهيدي) إلى تركيز 10 ميكروغرام / ميكرولتر في الصف البيولوجيا الجزيئية H 2 O. ثم، مزيج 5 ميكرولتر من مهاجم و5 ميكرولتر من رف التمهيدي في أنبوب microcentrifuge 1.5 مل.
  2. مزيج التمهيدي يصلب عن طريق التسخين لدرجة حرارة الصلب الصحيحة (75 درجة مئوية لمدة الاشعال الموصوفة هنا) لمدة 15 دقيقة. ترك على مقاعد البدلاء ليبرد في درجة حرارة الغرفة (RT). إعداد PEG8000 60٪ خلال هذه الحضانة عن طريق إذابة في DDH 2 O.
  3. إضافة 50 ميكرولتر من 60٪ PEG8000 (لتحقيق تركيز النهائي من 30٪)، و 10 ميكرولتر من 10X كيناز عديد النوكليوتيد (PNK) العازلة، 27 ميكرولتر من H 2 O، و 3 ميكرولتر من PNK إلى مزيج التمهيدي. احتضان عند 37 درجة مئوية لمدة 2 ساعة.
  4. تهدئة في RT وإضافة 11 ميكرولتر من العازلة يغاز DNA. ثم إضافة 3 U من يغاز DNA واحتضان عند 37 درجة مئوية خلال الليل.

2. تنقية DNAوتحليل

  1. إضافة 300 ميكرولتر من H 2 O لزيادة حجم المزيج ربط. ملاحظة: المضي قدما في غطاء الدخان بسبب سمية الفينول: بخار الكلوروفورم.
  2. إضافة 1 حجم (400 ميكرولتر) من الفينول: الكلوروفورم ومزيج من قبل تهز بقوة.
  3. الطرد المركزي في أقصى سرعة لمدة 1 دقيقة في microcentrifuge الطاولة. سوف الطبقات المائية والمذيبات منفصلة مع الطبقة المائية على رأس وطبقة بيضاء من البروتين عجلت بين طبقتين.
  4. تحويل الطبقة العليا إلى أنبوب جديد من قبل pipetting دقيق (تجنب نقل الوسط طبقة بيضاء)
  5. كرر الخطوات من 2.2 و 2.3 على الأقل مرتين أو حتى عدم وجود بروتين عجلت بعد الطرد المركزي.
  6. إضافة 1 حجم (400 ميكرولتر) من الكلوروفورم وكرر الخطوات من 2،3-2،4.
  7. إضافة 2 مجلدات (800 ميكرولتر) من الإيثانول بنسبة 100٪ prechilled واحتضان عند -20 درجة مئوية لمدة 1 ساعة على الأقل أو طوال الليل. ملاحظة: هذه الخطوة يترسب concatemers DNA.
  8. تدور باستمرار في سرعة قصوى ونضح سوبrnatant. يغسل مرة واحدة عن طريق إضافة 1 مل من الايثانول 70٪ والسماح للهواء الجاف في غطاء الدخان.
  9. DNA resuspend في 50 ميكرولتر من الذيفان الداخلي ده مجانا 2 O. ملاحظة: استخدام الذيفان الداخلي مجانا الكواشف أمر بالغ الأهمية لتوليد استجابة مناعية فطرية DNA محددة في الخلايا والحية.
  10. إزالة قسامة 2 ميكرولتر من الحمض النووي concatemerized في أنبوب جديد وإضافة 1 مل عازلة هلام DNA تحميل.
  11. حل 1٪ الاغاروز العازلة في TAE عن طريق التسخين على السلطة الكاملة في فرن الميكروويف لمدة 2 دقيقة (أو الساعة التي تتلاءم مع قوة الفرن والحجم).
  12. صب جل في جهاز الصب، وإضافة 4 ميكرولتر من الفلورسنت مخلبية DNA الصبغة، تضاف المشط، وترك في درجة حرارة الغرفة لحوالي 20 دقيقة للهلام لتعيين.
  13. مجموعة مرة واحدة، وإزالة المشط ومكان هلام الكهربائي في خزان يحتوي عازلة تاي. تحميل 3 ميكرولتر من عينة الحمض النووي أو حجم علامات في الآبار.
  14. تشغيل هلام الكهربائي لمدة 30-40 دقيقة في 90 V مع تيار مستمر. Visualiزي الحمض النووي تحت ضوء الأشعة فوق البنفسجية لمراقبة concatemerization (الشكل 1A).
  15. قياس تركيز الحمض النووي في ما تبقى من العينة بواسطة الأشعة فوق البنفسجية امتصاص الطيفي. فارغة مطياف مع نفس ده 2 O الذي تم استخدامه ل resuspend الحمض النووي وقياس الطيف الامتصاصية 200-300 نانومتر. ملاحظة: يمكن حساب تركيز الحمض النووي باستخدام قانون بير لامبرت، A = ه * ج * لتر، حيث A هو الامتصاصية، البريد معامل الانقراض، ول مسافة مسار الضوء. لقياس تركيزات DNA الامتصاصية في ينبغي قياس 260 نانومتر، ومعامل انقراض 0.027 (ميكروغرام / مل) -1 سم -1 المستخدمة. المسافة مسار الخفيفة، ل، سوف تختلف تبعا لطيفي. بينما قياس تركيز، علما أن نسبة امتصاص 260/280 نانومتر كمؤشر على نقاء DNA. يوصى قيمة لهذه النسبة من 2.00 أعلاه.

3. ترنسفكأيشن من dsDNA Concatemers وفي السادسTRO

  1. خلايا البذور في طبق زراعة الأنسجة أو لوحة لتكون 70٪ متكدسة في وقت التحفيز.
  2. حساب كتلة الحمض النووي المطلوبة لتحفيز الخلايا باستخدام تركيز النهائي من 1-10 ميكروغرام / مل. سيلاحظ كتلة المطلوب من الحمض النووي وX أدناه. على سبيل المثال إذا تحفيز الخلايا في بئر واحد من لوحة 6 جيدا مع 2 مل من المتوسط ​​في تركيز الحمض النووي من 5 ميكروغرام / مل ثم كتلة من 2 * 5 = 10 ميكروغرام من الحمض النووي هو مطلوب.
  3. إضافة 50 * X ميكرولتر من مصل المتوسطة مجانا في أنبوب معقم مناسبة الحجم. ماصة بعناية في وسط المتوسط، دون لمس الجانب من الأنبوب، 2 * X ميكرولتر من الدهون الموجبة كاشف ترنسفكأيشن ويترك لمدة 5 دقائق.
  4. إضافة X ميكروغرام من الحمض النووي للأنبوب ودوامة لفترة وجيزة. ترك في RT لمدة 20 دقيقة على الأقل. لفي المختبر ترنسفكأيشن إضافة هذا الخليط مباشرة إلى الخلايا لتحفيز مسارات الاستشعار DNA السيتوبلازمية.

4. ترنسفكأيشن من dsDNA Concatemers Iن فيفو

  1. إعداد مزيج ترنسفكأيشن كما هو موضح في 3،1-3،5 باستخدام 1 ميكروغرام DNA، 2 ميكرولتر كاشف ترنسفكأيشن الدهون، و 18 ميكرولتر مصل المتوسطة مجانا في الماوس الأذن إلى أن حفز. إعداد معقمة 20 ميكرولتر حقنة هاميلتون، وكأب مع G إبرة معقمة 30، وتحميل مع مزيج ترنسفكأيشن الحمض النووي.
  2. تخدير C57BL / 6 الماوس باستخدام 1-2٪ الأيزوفلورين. تأكيد التخدير بواسطة فقدان الحركة ومعدل التنفس المستمر وقرصة اختبار رد الفعل إذا لزم الأمر. مراقبة عيون الحيوان أثناء التخدير واستخدام مرهم كما هو مطلوب لتجنب جفاف المفرطة.
  3. باستخدام تقنية معقمة، وضخ بعناية في الصيوان الأذن 10 ميكرولتر من مزيج ترنسفكأيشن بحيث يتم تشكيل "فقاعة" واحدة من السائل بين طبقات الجلد من الأذن. ملاحظة: استخدام كشتبان المطاط على الإبهام أو السبابة، وتمتد الأذن أكثر من ذلك، وحقن في زاوية حادة لضمان الإبرة تخترق فقط الطبقة الأولى من جلد الصيوان الأذن.
  4. العنانtroduce في الماوس مرة أخرى إلى القفص بانتظام ورصد الانتعاش بعد مخدر. استخدام مصباح التدفئة لتجنب التبريد المفرط للتخدير الفئران. لا تترك الفئران غير المراقب إلا بعد أن استعاد وعيه كاف للحفاظ على الاستلقاء القصية.
  5. فلاش تجميد الصيوان الأذن كله في أنبوب microcentrifuge بغمر في النيتروجين السائل لمدة 2 دقيقة.

5. تجهيز عينات الحمض النووي محفز وتحليل أعده الكمية PCR (QPCR)

  1. من ثقافة الخلية: نضح المتوسطة مع ماصة وتجاهل النفايات.
  2. إضافة 1 مل من برنامج تلفزيوني العقيمة. كرر 5.1 و 5.2 مرتين وانتقل إلى الخطوة 5.3
  3. من أنسجة الأذن: طحن الأنسجة تحت النيتروجين السائل باستخدام مدقة العقيمة السيراميك وقذائف هاون، ونقل الأنسجة الأرض لأنبوب microcentrifuge باستخدام ملعقة معقمة، وانتقل إلى الخطوة 5.4
  4. إضافة 350 ميكرولتر تحلل العازلة والمضي قدما RNA التجاري بروتوكول عدة الاستخراج. أزل الحمض النووي الريبي من استخراج تنقية عدةالعمود في 40 ميكرولتر DDH 2 O. ملاحظة: هذه المجموعة استخراج الحمض النووي الريبي التجارية (انظر المواد / الجدول المعدات) يعمل بشكل جيد جدا. وقد تم اختبار تقنيات أخرى مع نتائج سوببر.
  5. قياس الطيفي للأشعة فوق البنفسجية التي كتبها RNA كما هو موضح أعلاه لDNA (القسم 2.13). ملاحظة: معامل الانقراض لRNA هو 0.025 (ميكروغرام / مل) -1 سم -1.
  6. أضف إلى العقيمة PCR أنبوب 1 ميكرولتر من جزئية (DT) التمهيدي، 1 ماي من 10 ملي dNTP المزيج، و 250 ميكروغرام RNA. جعل يصل حجم إلى 11 ميكرولتر DDH العقيمة مع 2 O.
  7. احتضان لمدة 5 دقائق عند 65 درجة مئوية. ثم إضافة 4 ميكرولتر الاحتياطي ستراند الأولى، 1 ميكرولتر 0.1 M dithiothreitol، 0.25 ميكرولتر عكس الناسخ و1.75 ميكرولتر DDH 2 O إلى الأنبوب. احتضان عند 50 درجة مئوية لمدة 1 ساعة تليها 72 درجة مئوية لمدة 15 دقيقة. اختياريا، تمييع [كدنا المنتج 1: 5 باستخدام DDH 2 O.
  8. لاستخدام PCR الكمي 2 ميكرولتر [كدنا]، 2 ميكرولتر DDH 2 O، 5 ميكرولتر QPCR مزيج الرئيسي، و1ميكرولتر من كل 10 أوقية إلى الأمام وعكس الأسهم التمهيدي لتضخيم الجين (ق) في الاختيار. خلط في لوحة 96 جيدا وتحليل باستخدام آلة PCR الكمي (الأرقام 1B و 1C).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

نتائج أدناه تشير إلى أن الحمض النووي concatemerized يمكن أن تتولد بسهولة نسبية، وقادر على تحفيز استجابة مناعية فطرية قوية في خلايا بشرية وفي فئران. مع استخدام PEG8000، يمكن أن نرى بوضوح أن طول الحمض النووي التي يتم توليدها بشكل ملحوظ أطول وقادرة على إحداث نفس القدر من النسخ Cxcl10. كما رأينا من خلال تحليل agarose هلام، وconcatemerization مستوى له أطوال DNA تصل إلى 800 زوج قاعدي (بي بي)، في حين لعينة مع PEG8000، وطول الحمض النووي يشمل فروع تزيد عن 10،000 سنة مضت (الشكل 1A). ترنسفكأيشن من هذه السلطات الوطنية المعينة في الخلايا الليفية الفئران الجنينية (MEFs) أو الفئران يؤدي الى النسخ قوي من السيتوكينات وكيموكينات التي يمكن قياسها بواسطة QPCR تشير تحفيز DNA المناعة الماكينات الاستشعار فطرية (الأرقام 1B و 1C).

إعلان / 51593 / 51593fig1highres.jpg "/>
أنتجت الرقم 1. بيانات تمثيلية تشير إلى إنتاج concatemerized ISD الحمض النووي (conDNA) وتحفيز الخلايا الليفية والفئران. (A) عينة من الحمض النووي concatemerized إما مع أو بدون PEG8000 تحليلها من قبل الاغاروز الكهربائي للهلام. وقد حفز (B) MEFs مع مختلف السلطات الوطنية المعينة في 10 ميكروغرام / مل ومستويات CXCL10 وIL-6 من mRNAs تقاس QPCR بعد 6 ساعة. تم حقن (C) في الفئران pinnae الأذن مع conDNA ومستويات CXCL10 وIL-6 من mRNAs تقاس QPCR بعد 12 ساعة. تظهر البيانات كما أضعاف نسبة إلى مستوى HPRT (RQ) وأشرطة الخطأ هي +/- SEM (ن = 3).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

وتستخدم بروتوكولات الموصوفة هنا إلى توليد dsDNA لتحفيز الاستجابة المناعية الفطرية عصاري خلوي مع نتائج استنساخه في مجموعة واسعة من أنواع الخلايا في الجسم الحي و. منذ كاشف الركيزة الرئيسي المستخدم هو قليل النوكليوتيد الاصطناعية، وهناك مرونة في هذا النظام لاستخدام تسلسل الحمض النووي بديلة أو التعديلات الكيميائية. فمن الممكن، على سبيل المثال، لتحل محل قليل النوكليوتيد حبلا إلى الأمام وصفها في هذا البروتوكول مع واحد يحتوي على تسمية الفلورسنت أو شاردة البيوتين لتتبع توطين أو تقييم التفاعلات مع الجزيئات الحيوية الأخرى.

واحدة من المزايا الرئيسية لconcatemerization الحمض النووي هو إنتاج سلاسل طويلة من dsDNA بطريقة تسلسل يمكن السيطرة عليها. هناك قيد واحد هنا وهو أن طول الحمض النووي لا يمكن رصدها بدقة لذلك المنتج من هذا التفاعل هو دائما مزيج من الحمض النووي من أطوال مختلفة (على غرار بولي RNA التناظرية التجاري (I: C)). ميزة أخرى لهذا الأسلوب هو أنه يتيح إنتاج كميات كبيرة من كتلة المناعة تنشيطية الحمض النووي (إلى كميات ملغ). يمكن زيادتها الخطوة concatemerization تصل بسهولة كما هو مطلوب، على الرغم من أنه تجدر الإشارة إلى أن الخطوات اللاحقة تنقية ثم ينبغي أن تنفذ في مأخوذة من الجدول الواردة في البروتوكول.

بالمقارنة مع غيرها من أساليب concatemerizing الحمض النووي، إضافة الرئيسي هو استخدام PEG8000 إلى المزيج ربط لتحسين كفاءة الربط. لاحظ أن PEG8000 قد يكون من الصعب حل لجعل 60٪ (ث / ت) الأسهم لكن يمكن vortexed ويسخن برفق للمساعدة في ذوبان. وربط يمكن ترك لاحتضان لفترات أطول مما هو مذكور، ولكن هذا لا يبدو أن تؤثر على طول الحمض النووي التي يتم توليدها. لوحظ أيضا أن بعض احتياجات الرعاية عند التعامل مع الفينول وكلوروفورم وهذه يمكن أن تكون مسببة للسرطان وتآكل. في أيدينا الجينات upregulated من السلطات الوطنية المعينة الاصطناعية الأخرى (مثل بولي التجاري (دا: DT)) تختلف عن تلك التي upregulated ISD concatemerized. إلا أن البعض الآخر لم يتم العثور على مثل هذه الاختلافات 10، والتي قد تعكس الاختلاف بين أنواع الخلايا التي يجري تحليلها. على الرغم من هذه الصراعات، وISD concatemerized هو أرخص بكثير لتوليد بالمقارنة مع شراء بولي (دا: DT) من مصدر تجاري ويسمح بمزيد من المرونة عن طريق اختيار تسلسل والتعديلات.

أحد جوانب الاستشعار عن الحمض النووي الذي هو قيد مدروسة هو الرد في الجسم الحي إلى التحفيز. لقد أثبتنا أن هذا البروتوكول يمكن استخدامها لتوليد الحمض النووي مناسبة لفي التجارب المجراة 7. المنتج dsDNA نقية وعالية التركيز بما فيه الكفاية للسماح للحقن في الفئران والقياس اللاحق للعمليات إشارات المناعية الفطرية. في البروتوكول وصفها هنا، يجب توخي الحذر لضمان المياه المستخدمة لإذابة بيليه DNA النهائي هو الذيفان الداخلي، ريبونوكلياز، والدناز مجانا. حقن الحمض النووي مجانا أو DNA-نتائج المجمعات الدهون في رد فيروسات كما هو متوقع من عمليات الاستشعار عن الحمض النووي، وعلى هذا النحو، وDNA concatemerized يمكن استخدامها لتحقيق جوانب متعددة من الحمض النووي الاستشعار في الجسم الحي.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

الكتاب ليس لديهم الاعترافات.

Materials

Name Company Catalog Number Comments
Forward primer Integrated DNA Technologies n/a TACAGATCTACTAGTGATCTATGA CTGATCTGTACATGATCTACA
Reverse primer Integrated DNA Technologies n/a TGTAGATCATGTACAGATCAGT CATAGATCACTAGTAGATCTGTA
PEG8000 Sigma-Aldrich P-4463
Molecular biology grade water Sigma-Aldrich W4502-1L
T4 polynucleotide kinase Promega M4101
T4 DNA ligase Promega M1801
Phenol:chloroform Fisher Chemical BPE1752p-400
Chloroform Fisher Chemical C/4960/PB08
Ethanol Sigma-Aldrich 32221-2.5L
DNA gel loading buffer New England Biolabs B7021S
Agarose Bioline BIO-41025
Optimem Life Technologies 11058021
TransIT-LT1  Mirus Bioscience MIR 2300
Hamilton syringe Hamilton 80901 Model 1705
30 G needles  BD Bioscience 304000
SYBR Safe DNA gel stain Life Technologies S33102
Rneasy Plus Mini Kit Qiagen 74134
Oligo(dT) primer Thermo Scientific SO131
dNTP mix Fermentas R0192
Super Script III reverse transcriptase Life Technologies 56575
First strand cDNA synthesis buffer Life Technologies y02321
SybrGreen qPCR Fast master mix Applied Biosystems 4385612
cxcl10 murine forward primer  Integrated DNA Technologies n/a ACTGCATCCATATCGATGAC
cxcl10 murine reverse primer Integrated DNA Technologies n/a TTCATCGTGGCAATGATCTC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC

DOWNLOAD MATERIALS LIST

References

  1. Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. Nat. Immunol. 6, 49-56 (2005).
  2. Ishikawa, H., Ma, Z., Barber, G. N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature. 461, 788-792 (2009).
  3. Ishii, K. J., et al. TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature. 451, 725-729 (2008).
  4. Stetson, D. B., Medzhitov, R. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity. 24, 93-103 (2006).
  5. Pichlmair, A., Reise Sousa, C. Innate recognition of viruses. Immunity. 27, 370-383 (2007).
  6. Unterholzner, L., et al. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997-1004 (2010).
  7. Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. DNA-PK is a DNA sensor for IRF-3-dependent innate immunity. Elife. 1, e00047 (2012).
  8. Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 339, 786-791 (2013).
  9. Honda, K., Taniguchi, T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6, 644-658 (2006).
  10. Karayel, E., et al. The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature. Eur. J. Immunol. 39, 1929-1936 (2009).
تحفيز حشوية DNA الاستشعار عن مسارات<em&gt; في المختبر</em&gt; و<em&gt; في فيفو</em
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).More

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter