Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Stimulation der DNA-Sensing Zytoplasmatische Pathways doi: 10.3791/51593 Published: September 18, 2014

Summary

Das Ziel des Protokolls ist es, die optimalen Methoden zur Stimulierung der cytoplasmatischen DNA Erfassungswege in Zellen und in vivo zu verwenden. Dies wird durch die Verbesserung der Erzeugung von langen, doppelsträngigen DNA während blunt-end Ligation erreicht. Zellen oder Mäuse werden dann unter Verwendung einer Lipid Transfektionsreagenz transfiziert.

Abstract

Um effizient eine angeborene Immunantwort zu stimulieren, müssen DNA von ausreichender Länge und Reinheit sein. Wir stellen ein Verfahren, bei dem Doppelstrang-DNA (dsDNA), das die erforderlichen Eigenschaften hat, um die cytoplasmatischen DNA Erfassungswege kann kostengünstig und mit Leichtigkeit erzeugt werden stimulieren. Vom Concatemerisierungsreaktion von kurzen, synthetischen Oligonukleotiden (die CpG-Motive fehlen), können dsDNA erzeugt werden, um eine ausreichende Länge aufweisen, um die cytosolische DNA Erfassungspfad zu aktivieren. Dieses Protokoll beinhaltet Ligation stumpfer Enden der Oligonukleotide in Gegenwart von Polyethylenglykol (PEG), der eine Umgebung für effiziente Ligation statt bietet. Die dsDNA Concatemeren verwendet werden kann, nach der Reinigung durch Phenol / Chloroform-Extraktion, um die angeborene Immunantwort in vitro durch Standard Transfektionsprotokolle simulieren. Diese DNA kann auch verwendet werden, um angeborene Immunität in vivo durch intradermale Injektion in die Ohrmuschel der Maus zu stimulieren, zum Beispiel. DurchStandardisierung der Concatemerisierungsreaktion Prozess und die anschließende Stimulationsprotokolle kann eine zuverlässige und reproduzierbare Aktivierung des angeborenen Immunsystems produziert werden.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

DNA ist ein wichtiger Bestandteil aller Organismen und Zellen, die Eukaryoten halten in bestimmten Fächern. Eine Funktion des angeborenen Immunsystems ist es, festzustellen, wann solche Kompartimentierung bricht oder wenn Fremdkörper in den Organismus über eine Verletzung der körperlichen, externe Barrieren eingeführt. Im menschlichen Körper gibt es eine Reihe von Proteinen, zu helfen verschlechtern kleinen DNA-Mengen, die die korrekte Kompartimentierung entweichen kann existieren; DNAse I, II, und III brechen DNA im Plasma, Endosomen und Cytosol sind. Es hat sich jedoch gezeigt, dass Mäuse ohne DNAse II sterben an schweren Anämie, die durch übermäßige Produktion von Interferonen 1 was darauf hindeutet, dass verursacht das angeborene Immunsystem reagiert auf Extra-Kern-DNA. Diese Reaktion tritt auch in Mäusen, die in Toll-like-Rezeptor-Signal Kapazität völlig unzulänglich sind. Zahlreiche Studien haben jetzt, dass Stimulator der Interferon-Gene (STING) 2 und TANK-binding kinase 1 (TB gezeigtK1) 3 in der Detektion von DNA in das Cytoplasma und dass dieser Signalweg aktiviert, Interferon Regulatory Factor (IRF) -3 4 beteiligt. Die anschließende IRF3-abhängige Transkription von Zytokin-Chemokin-und Interferon-Gene ist charakteristisch für einen angeborenen Immunantwort, entweder einen Erreger oder Gefahr assoziierte molekulare Muster (PAMP oder DAMP) 5.

Der Wunsch, die intrazelluläre Signalwege Nucleinsäuredetektion Studie hat zu der Forderung geführt, um robuste und reproduzierbare Verfahren zur Stimulierung Zellen durch die Einführung von DNA oder RNA in Zellen ohne Aktivierung anderen angeborenen Immunantwort zu entwickeln. Eine Methode, durch die der Sting / TBK1 / IRF3 Wegs stimuliert werden kann durch Verwendung von kationischen Lipid-Transfektionsreagenzien Nukleinsäure in das Cytoplasma, wo sie von DNA-Sensoren, wie DNA-PK, IFI16 und CGAS 6-8 zugänglich zu liefern.

Die Eigenschaften der DNA, die derzeit verstanden werden eff ermöglicheniziente Aktivierung der cytoplasmatischen angeborenen Immunantwort ohne Stimulation anderer Wege sind die Länge, Masse, Reinheit und das Fehlen von CpG-Motiven 4,7,9. Synthetische Oligonukleotide eignen sich für die Zwecke der Erzeugung einer angeborenen Immunantwort, wie sie es dem DNA-Sequenz optimiert und als reine chemische Spezies hergestellt werden. Ein 45-Basenpaar-immunstimulatorischen DNA (ISD)-Sequenz wurde durch Stetson et al. 4 als geeignetes, CpG-freie Sequenz für diesen Zweck identifiziert. Diese dsDNA-Sequenz ist ansonsten zufällig und hat keine spezifischen Funktionen, die über ihren Mangel an CpG-Motive. Wir haben gefunden, daß durch concatemerizing ISD Oligonukleotids in deutlich längeren Stränge erhöht die Größe der Stimulations 7. Generation von concatemerized ISD ist daher nützlich für die Förderung einer zytoplasmatischen angeborenen Immunantwort. Hier präsentieren wir Protokolle zur Herstellung dieses Reagenz und wie sie verwendet werden, um die DNA Messweges in aktivierenvitro als auch in vivo.

HINWEIS: Alle Tierversuche genehmigt werden unter institutionellen Protokolle und Tierpflege-Richtlinien durchgeführt.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Concatemerisierungsreaktion

  1. Resuspendieren Primer Fw und Rv (siehe Tabelle der Materialien für die Primer-Sequenzen) zu einer Konzentration von 10 ug / ul in die Molekularbiologie H 2 O. Dann mischen 5 ul FW und 5 ul Primer Rv in einem 1,5 ml Mikrozentrifugenröhrchen.
  2. Glühen Zündmittelmischung durch Erhitzen auf die richtige Anlagerungstemperatur (75 ° C für die hier beschriebenen Primer) für 15 min. Lassen Sie auf der Bank, um bei Raumtemperatur (RT) abkühlen. Bereiten Sie den 60% PEG8000 während dieser Inkubationszeit durch Lösen in ddH 2 O.
  3. Dann werden 50 ul 60% PEG8000, 10 ul 10x-Polynukleotid-Kinase (PNK)-Puffer, 27 ul H 2 O und 3 ul PNK auf die Primergemisch (zu einer Endkonzentration von 30% zu erreichen). Bei 37 ° C für 2 Stunden.
  4. Abkühlen bei RT und fügen Sie 11 ul der DNA-Ligase-Puffer. Dann fügen Sie 3 U-DNA-Ligase und bei 37 ° C über Nacht.

2. DNA Purificationund Analyse

  1. Werden 300 ul H 2 O auf das Volumen des Ligationsgemisches zu erhöhen. Hinweis: Gehen Sie in einem Abzug wegen der Giftigkeit von Phenol: Chloroform Dampf.
  2. 1 Volumen (400 ul) Phenol: Chloroform und durch kräftiges Schütteln mischen.
  3. Zentrifuge bei max Geschwindigkeit für 1 min in einer Tischmikrozentrifuge. Die wässrigen und Lösungsmittelschichten mit der wässrigen Schicht auf der Oberseite und eine weiße Schicht des gefällten Proteins zwischen den zwei Schichten zu trennen.
  4. Übertragen obere Schicht in ein neues Röhrchen durch sorgfältige Pipettieren (Vermeidung der Übertragung Mitte, weiße Schicht)
  5. Wiederholen Sie die Schritte 2.2 und 2.3 mindestens zweimal oder bis keine ausgefällte Protein nach Zentrifugation.
  6. 1 Volumen (400 ul) von Chloroform und wiederholen Sie die Schritte 2.3-2.4.
  7. Add 2 Volumina (800 ul) von 100% vorgekühltem Ethanol und Inkubation bei -20 ° C für mindestens 1 h oder über Nacht. Hinweis: Dieser Schritt fällt die DNA Concatemeren.
  8. Spin-Down bei max Geschwindigkeit und saugen Supernatant. Einmal zu waschen durch Zugabe von 1 ml 70% Ethanol und an der Luft trocknen in Abzug.
  9. Resuspendieren DNA in 50 ul endotoxinfrei ddH 2 O. Anmerkung: Die Verwendung von Endotoxin freien Reagenzien ist für die Erzeugung eines DNA-spezifischen angeborene Immunantwort in Zellen und in vivo.
  10. Entfernen Sie ein 2 ul Aliquot der DNA in concatemerized ein frisches Röhrchen und 1 ml DNA-Gel-Ladepuffer.
  11. Man löst 1% Agarose in TAE-Puffer durch Erhitzen bei voller Leistung in einem Mikrowellenofen für 2 Minuten (oder die Zeit, die angemessen auf die Leistung des Ofens und Volumen).
  12. Gießen Gel in Gussvorrichtung, fügen Sie 4 ul fluoreszierenden DNA-Chelat-Farbstoff, legen Sie einen Kamm, und bei Raumtemperatur für ca. 20 min für das Gel gesetzt.
  13. Einmal eingestellt, nehmen Sie den Kamm und Ort Gel in Elektrophorese Tank mit TAE-Puffer. Last 3 ul DNA-Probe oder Größenmarker in die Vertiefungen.
  14. Führen Gelelektrophorese für 30-40 min bei 90 V mit Konstantstrom. Visualize die DNA unter UV-Licht, um Concatemerisierungsreaktion (Abbildung 1A) zu beobachten.
  15. Messung der DNA-Konzentration in dem Rest der Probe, die durch UV-Absorptionsspektroskopie. Blank das Spektrometer mit dem gleichen ddH2O, die verwendet wurde, um die DNA zu suspendieren und messen das Absorptionsspektrum von 200 bis 300 nm auf. HINWEIS: DNA-Konzentration kann mit Hilfe des Lambert-Beer-Gesetz, A = e * c * l, wobei A die Absorption berechnet werden, e die Extinktionskoeffizienten und l den Abstand des Lichtweges. Zur Messung der DNA-Konzentration die Absorption bei 260 nm zu messen und einen Extinktionskoeffizienten von 0,027 (g / ml) -1 cm -1 verwendet. Der Lichtweg Abstand L in Abhängigkeit von dem Spektrophotometer unterschiedlich. Während die Messung der Konzentration, nehmen die 260/280 nm Absorptionsverhältnis als Hinweis auf DNA-Reinheit; ein Wert für dieses Verhältnis von über 2,00 wird empfohlen.

3. Die Transfektion von dsDNA Concatemeren In Vitro

  1. Samenzellen in einer Gewebekulturschale oder eine Platte zu 70% konfluenten zum Zeitpunkt der Stimulation.
  2. Berechnen der Masse der DNA für die Stimulation der Zellen mit einer Endkonzentration von 1-10 ug / ml erforderlich. Die erforderliche Masse der DNA wird als X unten angegeben werden. Zum Beispiel, wenn stimulierenden Zellen in einer einzelnen Vertiefung einer Platte mit 6 Vertiefungen mit 2 ml Medium in einer Konzentration von 5 ug DNA / ml, dann einer Masse von 2 * 5 = 10 ug der DNA erforderlich ist.
  3. Geben Sie 50 * X ul Serum freien Medium in eine geeignete Größe sterilen Röhrchen. Pipette vorsichtig in der Mitte des Mediums, ohne Berührung der Seite des Rohres, 2 * X ul kationische Lipid Transfektionsreagenz und lassen für 5 min.
  4. Fügen X ug DNA in die Röhre und kurz vortexen. Lassen bei RT für mindestens 20 min. Für die in vitro-Transfektion diese Mischung direkt an Zellen zytoplasmatische DNA Messwege zu stimulieren.

4. Die Transfektion von dsDNA Concatemeren ichn Vivo

  1. Bereiten Transfektionsmischung wie in 3.1-3.5 mit 1 pg DNA, 2 ul Lipid Transfektionsreagenz und 18 ul Serum freien Medium pro Maus Ohr stimuliert werden beschrieben. Bereiten Sie eine sterile 20 ul Hamilton-Spritze, Kappe mit einer sterilen Nadel 30 G, und laden Sie mit der DNA-Transfektion Mix.
  2. Betäuben einen C57BL / 6 Maus mit 1-2% Isofluran. Anästhesie bestätigen Verlust der Bewegung und konstanter Atemfrequenz und durch Pinch-Reflex-Test, wenn nötig. Augen Tieres während der Narkose zu überwachen und zu verwenden Salbe wie erforderlich, um übermäßige Trockenheit zu vermeiden.
  3. Verwendung einer sterilen Technik injizieren vorsichtig in die Ohrmuschel 10 ul der Transfektionsgemisch so daß eine einzige "Blase" von Flüssigkeit zwischen den Hautschichten des Ohres gebildet ist. Hinweis: Verwenden Sie eine Gummihülse auf dem Daumen oder Zeigefinger strecken das Ohr über sie, und injizieren in einem spitzen Winkel, um sicherzustellen, die Nadel dringt nur die erste Schicht der Haut der Ohrmuschel.
  4. Reintroduce Maus wieder in den Käfig und regelmäßig zu überwachen Post-Aufwachraum. Verwenden Sie eine Wärmelampe, um übermäßige Kühlung der narkotisierten Mäusen zu vermeiden. Mäuse nicht unbeaufsichtigt lassen, bis sie das Bewusstsein wiedererlangt, um ausreichend Brustlage zu halten.
  5. Flash frieren die ganze Ohrmuschel in ein Mikrozentrifugenröhrchen durch in flüssigem Stickstoff für 2 Minuten eingetaucht.

5. Die Verarbeitung von DNA-Proben und Stimulated Analyse durch quantitative PCR (qPCR)

  1. Von der Zellkultur: absaugen Medium mit einer Pipette und entsorgen Abfälle.
  2. 1 ml sterilem PBS. 5.1 und 5.2 wiederholen zweimal und gehen Sie zu Schritt 5.3
  3. Von Ohrgewebe: schleifen Gewebe unter flüssigem Stickstoff mit sterilen Keramik Mörser und Stößel, Transfer Grundgewebe, um ein Mikrozentrifugenröhrchen mit einem sterilen Spatel und gehen Sie zu Schritt 5.4
  4. Fügen Sie 350 ul Lysepuffer und fahren mit kommerziellen RNA-Extraktions-Kits Protokoll. Eluieren RNA-Extraktions-Kits von ReinigungsSäule in 40 ul ddH 2 O. Hinweis: Die kommerzielle RNA-Extraktion-Kit (siehe Materialien / Geräte-Tabelle) funktioniert sehr gut; andere Techniken haben mit unterdurchschnittlich Ergebnissen getestet.
  5. Quantifizieren RNA durch UV-Spektroskopie, wie für die DNA-oben (Abschnitt 2.13) beschrieben. Hinweis: Der Extinktionskoeffizient für RNA 0,025 (g / ml) -1 cm -1.
  6. In den sterile PCR-Röhrchen 1 ul Oligo (dT)-Primer, 1 ul 10 mM dNTP-Mischung und 250 ug RNA. Stellen Sie die Lautstärke auf 11 ul mit sterilem ddH 2 O.
  7. Inkubation für 5 min bei 65 ° C aufweist. Dann fügen Sie 4 ul First Strand Buffer, 1 ul 0,1 M Dithiothreitol, 0,25 ul reverse Transkriptase und 1,75 ul ddH 2 O, um die Röhre. Inkubieren bei 50 ° C für 1 h, gefolgt von 72 ° C für 15 min. Optional, verdünnte cDNA Produkt 1: 5 mit ddH 2 O.
  8. Für die quantitative PCR Verwendung 2 ul cDNA, 2 ul ddH 2 O, 5 ul qPCR Master Mix, und 1ul jeweils von 10 uM vorwärts und rückwärts Primer Bestände Gen (e) der Wahl zu verstärken. Mix in eine 96-Well-Platte und analysieren mit Hilfe eines quantitativen PCR-Maschine (1B und 1C).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Die Ergebnisse zeigen, dass unter concatemerized DNA relativ leicht erzeugt werden kann und fähig ist, die Stimulierung eine robuste angeborene Immunantwort in Zellen und in Mäusen. Mit der Verwendung von PEG8000 ist deutlich zu sehen, daß die Länge der DNA erzeugt wird, wesentlich länger ist und gleich zu induzieren Transkription von CXCL10. Wie durch Agarose-Gel-Analyse ersichtlich, weist die Standard Concatemerisierungsreaktion Längen der DNA bis zu 800 Basenpaaren (bp), während bei der Probe mit PEG8000 umfasst die Länge der DNA-Stränge über 10.000 bp (Abbildung 1a). Transfektion dieser DNAs in murine embryonale Fibroblasten (MEF) und Mäusen induziert eine robuste Transkription von Zytokinen und Chemokinen, die durch qPCR gemessen werden kann, was die Stimulation der unspezifischen Immun DNA Messmaschinen (1B und 1C).

ad / 51593 / 51593fig1highres.jpg "/>
Abbildung 1. Repräsentative Daten, die die Produktion von concatemerized ISD DNA (conDNA) und die Stimulation von Fibroblasten und Maus. (A) eine Probe von concatemerized DNA hergestellt, mit oder ohne PEG8000 durch Agarose-Gelelektrophorese analysiert. (B) MEFs wurden mit verschiedenen DNAs mit 10 ug / ml stimuliert und die Höhe der CXCL10 und IL-6 mRNA durch qPCR 6 h später gemessen. (C) Die Mäuse wurden in der Ohrmuscheln mit conDNA und den Ebenen von CXCL10 und IL-6 mRNA durch qPCR 12 Stunden später gemessen injiziert. Daten werden als fachen Anstieg relativ zu der Ebene der HPRT (RQ) und Fehlerbalken dargestellt sind +/- SEM (n = 3).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Die hier beschriebenen Protokolle werden verwendet, um dsDNA zu erzeugen, um die cytosolische angeborenen Immunantwort mit reproduzierbaren Ergebnissen in einer Vielzahl von Zelltypen in vivo zu stimulieren. Da das Hauptsubstrat Reagenz verwendet wird, ist ein synthetisches Oligonukleotid, es ist die Flexibilität dieses Systems für die alternative DNA-Sequenzen oder chemische Modifikationen. Es ist möglich, zum Beispiel, um die in diesem Protokoll mit einem, der eine Fluoreszenzmarkierung oder ein Biotin-Einheit, um die Lokalisierung zu verfolgen oder zu beurteilen, Wechselwirkungen mit anderen Biomolekülen enthält zukunfts beschrieben Strang-Oligonukleotid ersetzen.

Einer der Hauptvorteile der DNA Concatemerisierungsreaktion ist die Herstellung von langen Strängen von dsDNA in einer Weise, die die Sequenz steuerbar ist. Es ist eine Beschränkung, die hier, dass die DNA-Länge nicht genau überwacht werden, damit das Produkt dieser Reaktion ist immer ein Gemisch von DNA unterschiedlicher Längen (ähnlich dem kommerziellen RNA analogen Poly (I ist: C)). Ein weiterer Vorteil dieser Technik ist, dass es die Herstellung von großen Mengen von Massenimmunstimulierende DNA (bis zu Mengen Mg). Die Concatemerisierungsreaktion Schritt kann leicht skaliert werden, wobei zu bemerken ist, dass nachfolgende Reinigungsschritte sollte dann in Aliquoten von der Skala in dem Protokoll beschrieben durchgeführt werden.

Im Vergleich zu anderen Methoden der concatemerizing DNA, die Haupt hinaus die Verwendung von PEG8000 zu der Ligationsmischung, um Ligationseffizienz zu verbessern. Beachten Sie, dass PEG8000 schwierig sein kann, zu lösen, um eine 60% bilden (w / v) Stamm sondern verwirbelt werden und leicht erhitzt, um die Solubilisierung zu helfen. Die Ligation kann belassen werden, um für einen längeren Zeitraum als angegeben inkubiert, aber dies scheint nicht beeinflussen die Länge der DNA erzeugt wird. Einige Pflegebedarf auch beim Umgang mit Phenol und Chloroform, da diese krebserregend und ätzend sein beobachtet werden. In unseren Händen die Gene hochreguliert durch andere synthetische DNAs (wie Werbe Poly (dA: DT)) unterscheiden sich von denen von concatemerized ISD hochreguliert. Allerdings haben andere nicht solche Unterschiede 10, die reflektieren Unterschiede zwischen den Zelltypen analysiert kann gefunden. Ungeachtet solcher Konflikte, die concatemerized ISD deutlich günstiger im Vergleich zum Erwerb Poly erzeugen (dA: dT) von einer kommerziellen Quelle und ermöglicht eine größere Flexibilität durch Wahl der Abfolge und Modifikationen.

Ein Aspekt der DNA-Erfassung, die unter untersuchte ist, ist die in-vivo-Reaktion auf Stimulation. Wir haben gezeigt, dass dieses Protokoll kann verwendet werden, um geeignet für in-vivo-Experimente 7-DNA zu erzeugen. Die dsDNA Produkt ist rein und von hoher Konzentration, um genug Injektion in Mäuse und die anschließende Messung der angeborenen Immunsignalprozesse zu ermöglichen. In dem hier beschriebenen Protokoll muss darauf geachtet werden, das Wasser verwendet, um die endgültige DNA-Pellet aufzulösen ist Endotoxin, RNase und DNase frei gewährleisten. Injektion von DNA oder DNA-freiLipid-Komplexen zu einer Interferonantwort als DNA Erfassungsverfahren erwartet, und als solche kann die concatemerized DNA verwendet, um verschiedene Aspekte der DNA-Erfassungs in vivo zu sondieren.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Die Autoren haben keine Bestätigungen.

Materials

Name Company Catalog Number Comments
Forward primer Integrated DNA Technologies n/a TACAGATCTACTAGTGATCTATGA CTGATCTGTACATGATCTACA
Reverse primer Integrated DNA Technologies n/a TGTAGATCATGTACAGATCAGT CATAGATCACTAGTAGATCTGTA
PEG8000 Sigma-Aldrich P-4463
Molecular biology grade water Sigma-Aldrich W4502-1L
T4 polynucleotide kinase Promega M4101
T4 DNA ligase Promega M1801
Phenol:chloroform Fisher Chemical BPE1752p-400
Chloroform Fisher Chemical C/4960/PB08
Ethanol Sigma-Aldrich 32221-2.5L
DNA gel loading buffer New England Biolabs B7021S
Agarose Bioline BIO-41025
Optimem Life Technologies 11058021
TransIT-LT1  Mirus Bioscience MIR 2300
Hamilton syringe Hamilton 80901 Model 1705
30 G needles  BD Bioscience 304000
SYBR Safe DNA gel stain Life Technologies S33102
Rneasy Plus Mini Kit Qiagen 74134
Oligo(dT) primer Thermo Scientific SO131
dNTP mix Fermentas R0192
Super Script III reverse transcriptase Life Technologies 56575
First strand cDNA synthesis buffer Life Technologies y02321
SybrGreen qPCR Fast master mix Applied Biosystems 4385612
cxcl10 murine forward primer  Integrated DNA Technologies n/a ACTGCATCCATATCGATGAC
cxcl10 murine reverse primer Integrated DNA Technologies n/a TTCATCGTGGCAATGATCTC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC

DOWNLOAD MATERIALS LIST

References

  1. Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. Nat. Immunol. 6, 49-56 (2005).
  2. Ishikawa, H., Ma, Z., Barber, G. N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature. 461, 788-792 (2009).
  3. Ishii, K. J., et al. TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature. 451, 725-729 (2008).
  4. Stetson, D. B., Medzhitov, R. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity. 24, 93-103 (2006).
  5. Pichlmair, A., Reise Sousa, C. Innate recognition of viruses. Immunity. 27, 370-383 (2007).
  6. Unterholzner, L., et al. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997-1004 (2010).
  7. Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. DNA-PK is a DNA sensor for IRF-3-dependent innate immunity. Elife. 1, e00047 (2012).
  8. Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 339, 786-791 (2013).
  9. Honda, K., Taniguchi, T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6, 644-658 (2006).
  10. Karayel, E., et al. The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature. Eur. J. Immunol. 39, 1929-1936 (2009).
Stimulation der DNA-Sensing Zytoplasmatische Pathways<em&gt; In-vitro-</em&gt; Und<em&gt; In Vivo</em
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).More

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter