Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Cytoplasmic डीएनए सेंसिंग रास्ते की उत्तेजना doi: 10.3791/51593 Published: September 18, 2014

Summary

प्रोटोकॉल के उद्देश्य कोशिकाओं में और vivo में cytoplasmic डीएनए संवेदन रास्ते उत्तेजक के लिए इष्टतम तरीकों का उपयोग करने के लिए है. इस कुंद अंत बंधाव दौरान लंबे, डबल असहाय डीएनए की पीढ़ी में सुधार के द्वारा हासिल की है. कोशिकाओं या चूहे तो एक लिपिड अभिकर्मक अभिकर्मक का उपयोग ट्रांसफ़ेक्ट हैं.

Abstract

कुशलतापूर्वक एक सहज प्रतिरक्षा प्रतिक्रिया को प्रोत्साहित करने के लिए, डीएनए पर्याप्त लंबाई और पवित्रता का होना चाहिए. हम अपेक्षित विशेषताओं है जो डबल असहाय डीएनए (dsDNA) संवेदन रास्ते सस्ते और आसानी से उत्पन्न किया जा सकता cytoplasmic डीएनए को प्रोत्साहित करने के लिए जहां एक विधि प्रस्तुत करते हैं. संक्षेप में, सिंथेटिक oligonucleotides (CPG रूपांकनों जो कमी) की concatemerization करके, dsDNA साइटोसोलिक डीएनए संवेदन मार्ग को सक्रिय करने के लिए पर्याप्त लंबाई का होना उत्पन्न किया जा सकता. इस प्रोटोकॉल कुशल बंधाव घटित करने के लिए एक वातावरण प्रदान करता है, जो पॉलीथीन ग्लाइकोल की उपस्थिति (खूंटी), में oligonucleotides की कुंद अंत बंधाव शामिल है. dsDNA concatemers मानक अभिकर्मक प्रोटोकॉल द्वारा इन विट्रो में सहज प्रतिरक्षा प्रतिक्रिया अनुकरण, फिनोल / क्लोरोफॉर्म निष्कर्षण द्वारा शुद्धि के बाद, इस्तेमाल किया जा सकता है. यह डीएनए भी उदाहरण के लिए, एक माउस के कान पंख में अंतर्त्वचीय इंजेक्शन द्वारा vivo में सहज प्रतिरक्षा को प्रोत्साहित करने के लिए इस्तेमाल किया जा सकता है. तकconcatemerization प्रक्रिया और बाद में उत्तेजना प्रोटोकॉल का मानकीकरण, सहज प्रतिरक्षा प्रणाली का एक विश्वसनीय और प्रतिलिपि प्रस्तुत करने योग्य सक्रियण का उत्पादन किया जा सकता है.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

डीएनए यूकैर्योसाइटों विशिष्ट डिब्बों में रखने के जो सब जीवों और कोशिकाओं का एक महत्वपूर्ण घटक है. ऐसे compartmentalization टूट जाती है या जब सहज प्रतिरक्षा प्रणाली के एक समारोह की पहचान है विदेशी सामग्री शारीरिक, बाहरी बाधाओं का उल्लंघन के माध्यम से जीव में पेश किया जाता है. मानव शरीर में सही compartmentalization बच सकता है जो डीएनए की छोटी मात्रा में नीचा मदद के लिए मौजूद हैं कि प्रोटीन के एक नंबर रहे हैं; DNase मैं, द्वितीय, और तृतीय क्रमशः, प्लाज्मा, endosome, और cytosol में डीएनए टूट. हालांकि, यह सहज प्रतिरक्षा प्रणाली अतिरिक्त परमाणु डीएनए का जवाब है कि DNase द्वितीय कमी चूहों सुझाव इंटरफेरॉन 1 के अत्यधिक उत्पादन की वजह से गंभीर एनीमिया से मर जाते हैं कि दिखाया गया है. यह प्रतिक्रिया भी टोल की तरह रिसेप्टर संकेतन क्षमता में पूरी तरह से कमी है, जो चूहों में पाया जाता है. कई अध्ययनों से अब इंटरफेरॉन जीन (डंक) 2 और टैंक बाध्यकारी काइनेज 1 (टीबी की कि उत्तेजक पता चला हैK1) 3 कोशिका द्रव्य में डीएनए का पता लगाने में और इस संकेतन मार्ग इंटरफेरॉन विनियामक कारक (आईआरएफ) -3 4 सक्रिय करता है शामिल हैं. साइटोकाइन, केमोकाइन, और इंटरफेरॉन जीन के बाद IRF3 निर्भर प्रतिलेखन एक रोगज़नक़ या खतरे जुड़े आणविक पैटर्न (PAMP या नम) 5 या तो एक सहज प्रतिरक्षा प्रतिक्रिया की विशेषता है.

intracellular न्यूक्लिक एसिड संवेदन रास्ते का अध्ययन करने की इच्छा अन्य सहज प्रतिरक्षा प्रतिक्रिया को सक्रिय करने के बिना कोशिकाओं में डीएनए या आरएनए शुरू करने से कोशिकाओं उत्तेजक के लिए मजबूत और प्रतिलिपि प्रस्तुत करने के तरीकों को विकसित करने की आवश्यकता के लिए प्रेरित किया. डंक / TBK1 / IRF3 मार्ग प्रेरित किया जा सकता है जिसके द्वारा एक विधि यह इस तरह के डीएनए पी, IFI16, और CGAS 6-8 के रूप में डीएनए सेंसर से पहुँचा जा सकता है जहां कोशिका द्रव्य में न्यूक्लिक एसिड देने के लिए cationic लिपिड अभिकर्मक अभिकर्मकों उपयोग कर रहा है.

वर्तमान में EFF अनुमति देने के लिए समझ रहे हैं, जो डीएनए की विशेषताओंअन्य रास्ते की उत्तेजना के बिना cytoplasmic सहज प्रतिरक्षा प्रतिक्रिया के icient सक्रियण CPG की इसकी लंबाई, जन, पवित्रता, और कमी 4,7,9 रूपांकनों हैं. सिंथेटिक oligonucleotides वे डीएनए अनुक्रम अनुकूलित और एक शुद्ध रासायनिक प्रजाति के रूप में तैयार करने की अनुमति के रूप में एक सहज प्रतिरक्षा प्रतिक्रिया पैदा करने के उद्देश्य के लिए अत्यधिक उपयुक्त हैं. एक 45 आधार जोड़ी इम्युनो उत्तेजक डीएनए (आईएसडी) अनुक्रम इस उद्देश्य के लिए एक उपयुक्त, CPG मुक्त अनुक्रम होने के रूप में स्टेटसन एट अल. 4 द्वारा की पहचान की थी. इस dsDNA अनुक्रम अन्यथा यादृच्छिक है और CPG रूपांकनों की कमी से परे कोई विशेष सुविधाओं की है. हम काफी लंबे समय तक किस्में में आईएसडी oligonucleotide concatemerizing द्वारा उत्तेजना 7 की भयावहता बढ़ जाती है कि मिल गया है. Concatemerized आईएसडी की पीढ़ी के एक cytoplasmic सहज प्रतिरक्षा प्रतिक्रिया उत्तेजक के लिए इसलिए भी उपयोगी है. यहाँ हम इस अभिकर्मक की तैयारी के लिए प्रोटोकॉल के वर्तमान और उस में डीएनए संवेदन मार्ग को सक्रिय करने के लिए इस्तेमाल किया जा सकता हैvivo में के रूप में अच्छी तरह से इन विट्रो.

नोट: सभी जानवरों के अध्ययन अनुमोदित संस्थागत प्रोटोकॉल और जानवरों की देखभाल के दिशा निर्देशों के तहत प्रदर्शन कर रहे हैं.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1 Concatemerization

  1. Resuspend प्राइमरों परिवार कल्याण और आर.वी. आणविक जीव विज्ञान ग्रेड एच 2 ओ में 10 माइक्रोग्राम / μl के एक एकाग्रता के लिए (प्राइमर दृश्यों के लिए सामग्री की तालिका देखें) तो, परिवार कल्याण के 5 μl और एक 1.5 मिलीलीटर microcentrifuge ट्यूब में आर.वी. प्राइमर के 5 μl मिश्रण.
  2. 15 मिनट के लिए (यहाँ वर्णित प्राइमरों के लिए 75 डिग्री सेल्सियस) सही annealing तापमान को गर्म करने से पानी रखना प्राइमर मिश्रण. कमरे के तापमान (आर टी) पर नीचे शांत करने के लिए बेंच पर छोड़ दें. DDH 2 ओ में भंग करके इस ऊष्मायन के दौरान 60% PEG8000 तैयार
  3. 60% PEG8000 के 50 μl जोड़ें, 10x polynucleotide kinase (पी एन) बफर, एच 2 ओ के 27 μl, और प्राइमर मिश्रण करने के लिए पी एन के 3 μl के 10 μl (30% की एक अंतिम एकाग्रता को प्राप्त करने के लिए). 2 घंटे के लिए 37 डिग्री सेल्सियस पर सेते हैं.
  4. आरटी पर शांत हो जाओ और डीएनए ligase बफर के 11 μl जोड़ें. फिर डीएनए ligase के 3 यू जोड़ने और रातोंरात 37 डिग्री सेल्सियस पर सेते हैं.

2 डीएनए शुद्धिऔर विश्लेषण

  1. बंधाव मिश्रण की मात्रा बढ़ाने के लिए एच 2 ओ के 300 μl जोड़ें. नोट: क्लोरोफॉर्म वाष्प: कारण फिनोल की विषाक्तता के लिए एक धूआं हुड में आगे बढ़ें.
  2. फिनोल की 1 मात्रा (400 μl) जोड़ें: क्लोरोफॉर्म और सख्ती झटकों से मिश्रण.
  3. एक tabletop microcentrifuge में 1 मिनट के लिए अधिकतम गति पर अपकेंद्रित्र. जलीय और विलायक परतों शीर्ष पर जलीय परत और दो परतों के बीच उपजी प्रोटीन की एक सफेद परत के साथ अलग कर देगा.
  4. सावधान pipetting द्वारा एक नया ट्यूब ऊपर परत स्थानांतरण (मध्य स्थानांतरित बचने, सफेद परत)
  5. दोहराएँ 2.2 और 2.3 कम से कम दो बार या नहीं उपजी प्रोटीन centrifugation के बाद जब तक वहाँ कदम.
  6. क्लोरोफॉर्म की 1 मात्रा (400 μl) जोड़ें और दोहराने 2.3-2.4 कदम.
  7. 100% prechilled इथेनॉल के 2 संस्करणों (800 μl) जोड़ें और कम से कम 1 घंटे के लिए या रात भर -20 डिग्री सेल्सियस पर सेते हैं. नोट: इस कदम डीएनए concatemers precipitates.
  8. अधिकतम गति और महाप्राण supe पर स्पिनrnatant. 70% इथेनॉल के 1 मिलीलीटर जोड़कर एक बार धोएं और धूआं हुड में शुष्क हवा की अनुमति देते हैं.
  9. Endotoxin मुक्त DDH 2 ओ के 50 μl में Resuspend डीएनए नोट: endotoxin मुक्त अभिकर्मकों का उपयोग कोशिकाओं में और vivo में एक डीएनए विशिष्ट सहज प्रतिरक्षा प्रतिक्रिया पैदा करने के लिए महत्वपूर्ण है.
  10. एक ताजा ट्यूब में concatemerized डीएनए के 2 μl विभाज्य निकालें और 1 मिलीलीटर डीएनए जेल लोडिंग बफर जोड़ें.
  11. (ओवन और मात्रा की शक्ति के लिए उपयुक्त है जो या समय) 2 मिनट के लिए एक माइक्रोवेव ओवन में पूरी शक्ति पर हीटिंग द्वारा TAE बफर में 1% agarose भंग.
  12. कास्टिंग तंत्र में जेल डालो फ्लोरोसेंट डीएनए chelating डाई के 4 μl जोड़ने के लिए, एक कंघी डालें, और जेल सेट करने के लिए लगभग 20 मिनट के लिए कमरे अस्थायी पर छोड़ दें.
  13. सेट एक बार, Tae बफर युक्त वैद्युतकणसंचलन टैंक में कंघी और जगह जेल को हटा दें. लोड कुओं में डीएनए नमूना या आकार मार्कर के 3 μl.
  14. निरंतर वर्तमान के साथ 90 वी में 30-40 मिनट के लिए जेल वैद्युतकणसंचलन चलाएँ. Visualiज़ी अल्ट्रा वायलेट प्रकाश के तहत डीएनए concatemerization (चित्रा 1 ए) का निरीक्षण करने के लिए.
  15. यूवी absorbance स्पेक्ट्रोस्कोपी द्वारा नमूना के शेष में डीएनए एकाग्रता उपाय. डीएनए resuspend और 200-300 एनएम से absorbance स्पेक्ट्रम को मापने के लिए इस्तेमाल किया गया था कि एक ही DDH 2 ओ के साथ खाली स्पेक्ट्रोमीटर. नोट: डीएनए एकाग्रता एक absorbance है जहां बीयर-Lambert कानून, एक = ई * ग * एल, उपयोग कर की गणना की जा सकती है, प्रकाश पथ की दूरी विलुप्त होने गुणांक ई, और एल. डीएनए को मापने के लिए मापा जाना चाहिए 260 एनएम पर absorbance और 0.027 (माइक्रोग्राम / एमएल) की एक विलुप्त होने गुणांक -1 सेमी -1 इस्तेमाल किया सांद्रता. प्रकाश पथ दूरी, एल, स्पेक्ट्रोफोटोमीटर के आधार पर अलग अलग होंगे. एकाग्रता को मापने जबकि, डीएनए पवित्रता का एक संकेत के रूप में 260/280 एनएम absorbance के अनुपात का ध्यान रखना; ऊपर 2.00 की इस अनुपात के लिए एक मूल्य की सिफारिश की है.

छठी में dsDNA concatemers के 3 अभिकर्मकtro

  1. एक टिशू कल्चर पकवान या थाली में बीज कोशिकाओं उत्तेजना के समय में 70% मिला हुआ हो.
  2. 1-10 ग्राम / मिलीलीटर की एक अंतिम एकाग्रता का उपयोग कोशिकाओं की उत्तेजना के लिए आवश्यक डीएनए के द्रव्यमान की गणना. डीएनए की बड़े पैमाने पर नीचे एक्स के रूप में उल्लेख किया जाएगा. उदाहरण के लिए तो 5 माइक्रोग्राम / एमएल के डीएनए की एकाग्रता डीएनए के 2 * 5 = 10 ग्राम के एक बड़े पैमाने पर मध्यम 2 मिलीलीटर के साथ 6 अच्छी तरह से थाली का एक भी कुएं में कोशिकाओं उत्तेजक आवश्यक है, तो.
  3. एक उपयुक्त आकार बाँझ ट्यूब में सीरम मुक्त माध्यम से 50 * एक्स μl जोड़ें. पिपेट ध्यान से मध्यम के केंद्र में, ट्यूब, 2 * एक्स cationic लिपिड अभिकर्मक अभिकर्मक के μl और 5 मिनट के लिए छोड़ के पक्ष बिना छुए.
  4. ट्यूब और भंवर संक्षिप्त करने के लिए डीएनए की एक्स माइक्रोग्राम जोड़ें. कम से कम 20 मिनट के लिए आरटी पर छोड़ दें. इन विट्रो अभिकर्मक के लिए cytoplasmic डीएनए संवेदन रास्ते को प्रोत्साहित करने के लिए कोशिकाओं को सीधे इस मिश्रण जोड़ें.

DsDNA concatemers मैं के 4 अभिकर्मकएन विवो

  1. 3.1-3.5 1 ग्राम डीएनए, 2 μl लिपिड अभिकर्मक अभिकर्मक, और 18 μl सीरम माउस कान प्रति मुक्त मध्यम प्रेरित किया जा करने के लिए उपयोग कर के रूप में वर्णित अभिकर्मक मिश्रण तैयार करें. एक बाँझ 30 जी सुई के साथ एक बाँझ 20 μl हैमिल्टन सिरिंज, टोपी तैयार है, और डीएनए अभिकर्मक मिश्रण के साथ लोड.
  2. 1-2 isoflurane% का उपयोग कर एक C57BL 6 / माउस anesthetize. आंदोलन और लगातार सांस की दर के नुकसान से और यदि आवश्यक हो तो चुटकी पलटा परीक्षण द्वारा संज्ञाहरण की पुष्टि करें. संज्ञाहरण के दौरान पशु की आंखों पर नजर रखने और अत्यधिक सूखापन से बचने के लिए आवश्यक के रूप में मरहम का उपयोग करें.
  3. बाँझ तकनीक का उपयोग करना, कान पंख में देखभाल के साथ तरल पदार्थ की एक एकल 'बुलबुला' कान की त्वचीय परतों के बीच में बनाई है ताकि अभिकर्मक मिश्रण की 10 μl इंजेक्षन. नोट: सुई कान पंख की त्वचा की केवल पहली परत प्रवेश सुनिश्चित करने के लिए एक तीव्र कोण पर, अपने अंगूठे या तर्जनी पर एक रबर नोक का प्रयोग करें इस पर कान खिंचाव, और इंजेक्षन.
  4. लगामtroduce माउस वापस पिंजरे में और नियमित रूप से बाद के संवेदनाहारी वसूली की निगरानी. Anesthetized चूहों के अत्यधिक ठंडा बचने के लिए एक हीटिंग दीपक का प्रयोग करें. वे sternal अवलंबन बनाए रखने के लिए पर्याप्त होश आ गया है जब तक नायाब चूहों मत छोड़ो.
  5. फ्लैश 2 मिनट के लिए तरल नाइट्रोजन में डुबो कर एक microcentrifuge ट्यूब में पूरे कान पंख फ्रीज.

मात्रात्मक पीसीआर द्वारा डीएनए प्रेरित नमूने और विश्लेषण के 5 प्रसंस्करण (qPCR)

  1. महाप्राण एक विंदुक के साथ मध्यम और अपशिष्ट त्यागें: सेल संस्कृति से.
  2. बाँझ पीबीएस के 1 मिलीलीटर जोड़ें. 5.1 और 5.2 में दो बार दोहराएँ और 5.3 कदम आगे बढ़ना
  3. कान के ऊतकों से:, बाँझ सिरेमिक मूसल और मोर्टार का उपयोग कर तरल नाइट्रोजन के तहत ऊतक पीस एक बाँझ रंग का उपयोग एक microcentrifuge ट्यूब जमीन ऊतक हस्तांतरण, और 5.4 कदम आगे बढ़ना
  4. 350 μl lysis बफर जोड़ें और वाणिज्यिक शाही सेना निकासी किट प्रोटोकॉल के साथ आगे बढ़ना. निकासी किट शुद्धि से Elute शाही सेना40 μl DDH 2 ओ में स्तंभ नोट: वाणिज्यिक शाही सेना निकासी किट बहुत अच्छी तरह से काम करता है (सामग्री / उपकरण तालिका देखें); अन्य तकनीक subpar परिणाम के साथ परीक्षण किया गया है.
  5. (खंड 2.13) ऊपर डीएनए के लिए वर्णित के रूप में यूवी स्पेक्ट्रोस्कोपी द्वारा शाही सेना यों. नोट: शाही सेना के लिए विलुप्त होने गुणांक 0.025 (माइक्रोग्राम / एमएल) -1 सेमी -1 है.
  6. Oligo (डीटी) प्राइमर की एक बाँझ पीसीआर ट्यूब 1 μl जोड़ें, 10 मिमी dNTP की 1 उल मिश्रण, और 250 माइक्रोग्राम आरएनए. बाँझ DDH 2 ओ के साथ 11 μl के लिए मात्रा बनाओ
  7. 65 डिग्री सेल्सियस पर 5 मिनट के लिए सेते हैं. तब 4 μl पहले Strand बफर, 1 μl 0.1 एम dithiothreitol जोड़ने, 0.25 μl ट्यूब ट्रांसक्रिपटेस और 1.75 μl DDH 2 हे रिवर्स. 15 मिनट के लिए 72 डिग्री सेल्सियस के द्वारा पीछा 1 घंटे के लिए 50 डिग्री सेल्सियस पर सेते हैं. ओ DDH 2 का उपयोग 5: वैकल्पिक रूप से, सीडीएनए उत्पाद 1 पतला
  8. मात्रात्मक पीसीआर उपयोग 2 μl सीडीएनए, 2 μl DDH 2 हे, 5 μl qPCR मास्टर मिश्रण, और 1 के लिएआगे 10 उम के प्रत्येक μl और पसंद के जीन (ओं) बढ़ाना प्राइमर शेयरों रिवर्स. एक 96 अच्छी तरह से थाली में मिलाएं और एक मात्रात्मक पीसीआर मशीन (आंकड़े 1 बी और 1 सी) का उपयोग का विश्लेषण.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

नीचे दिए गए परिणामों concatemerized डीएनए रिश्तेदार आसानी से उत्पन्न होता है और कोशिकाओं में और चूहों में एक मजबूत सहज प्रतिरक्षा प्रतिक्रिया उत्तेजक में सक्षम है किया जा सकता है कि संकेत मिलता है. PEG8000 के उपयोग के साथ, यह स्पष्ट रूप से उत्पन्न किया जा रहा डीएनए की लंबाई काफी लंबे समय तक और Cxcl10 का प्रतिलेखन उत्प्रेरण का समान रूप से सक्षम है कि देखा जा सकता है. Agarose जेल विश्लेषण के रूप में देखा PEG8000 साथ नमूना के लिए, डीएनए की लंबाई 10,000 बीपी (चित्रा 1 ए) से अधिक किस्में शामिल हैं, जबकि मानक concatemerization, अप करने के लिए 800 आधार जोड़े (बीपी) के डीएनए की लंबाई है. Murine भ्रूण fibroblasts (MEFs) या चूहों में इन DNAs के अभिकर्मक सहज प्रतिरक्षा डीएनए संवेदन मशीनरी (आंकड़े 1 बी और 1 सी) की उत्तेजना का संकेत qPCR द्वारा मापा जा सकता है जो साइटोकिन्स और chemokines के एक मजबूत प्रतिलेखन लाती है.

विज्ञापन / 51593 / 51593fig1highres.jpg "/>
Fibroblasts और चूहों की concatemerized आईएसडी डीएनए (conDNA) के उत्पादन और उत्तेजना का संकेत चित्रा 1 प्रतिनिधि डेटा. (ए) concatemerized डीएनए के एक नमूने के साथ या agarose जेल वैद्युतकणसंचलन द्वारा विश्लेषण PEG8000 बिना या तो उत्पादन किया. (बी) MEFs मिलीलीटर 10 माइक्रोग्राम / पर विभिन्न DNAs के साथ प्रेरित और CXCL10 और आईएल -6 mRNAs का स्तर 6 घंटा बाद qPCR द्वारा मापा गया. (सी) चूहे 12 घंटे बाद qPCR द्वारा मापा conDNA और CXCL10 के स्तर और आईएल -6 mRNAs साथ कान pinnae में इंजेक्शन थे. डाटा HPRT (RQ) और त्रुटि सलाखों के स्तर तक गुना वृद्धि रिश्तेदार के रूप में दिखाया गया है +/- SEM (एन = 3).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

यहाँ वर्णित प्रोटोकॉल सेल प्रकार की एक विस्तृत रेंज में और vivo में प्रतिलिपि प्रस्तुत करने योग्य परिणामों के साथ साइटोसोलिक सहज प्रतिरक्षा प्रतिक्रिया को प्रोत्साहित करने के लिए dsDNA उत्पन्न करने के लिए उपयोग किया जाता है. इस्तेमाल सब्सट्रेट अभिकर्मक एक सिंथेटिक oligonucleotide है, वैकल्पिक डीएनए दृश्यों या रासायनिक संशोधनों प्रयोग करने के लिए इस प्रणाली में लचीलापन है. यह उदाहरण के लिए, एक फ्लोरोसेंट लेबल या स्थानीयकरण ट्रैक या अन्य biomolecules के साथ बातचीत का आकलन करने के लिए एक बायोटिन आधा भाग होता है कि एक साथ इस प्रोटोकॉल में वर्णित आगे कतरा oligonucleotide को बदलने के लिए संभव है.

डीएनए concatemerization का मुख्य लाभ में से एक अनुक्रम नियंत्रित किया जा सकता है कि एक तरह से dsDNA की लंबी किस्में का उत्पादन होता है. सी: इस प्रतिक्रिया के उत्पाद वाणिज्यिक आरएनए अनुरूप पाली (मैं करने के लिए इसी तरह के अलग अलग लंबाई की डीएनए (का एक मिश्रण हमेशा होता है ताकि डीएनए लंबाई ठीक से निगरानी नहीं की जा सकती है, जो कि यहाँ एक सीमा है)). इस तकनीक का एक और लाभ यह (मात्रा मिलीग्राम तक) इम्युनो उत्तेजक डीएनए की बड़ी मात्रा में बड़े पैमाने के उत्पादन की अनुमति देता है. आवश्यकता के रूप में यह बाद की शुद्धि कदम तो प्रोटोकॉल में उल्लिखित पैमाने की aliquots में बाहर किया जाना चाहिए कि ध्यान दिया जाना चाहिए, हालांकि concatemerization कदम है, आसानी से बढ़ाया जा सकता है.

डीएनए concatemerizing के अन्य तरीकों की तुलना में, मुख्य अलावा बंधाव दक्षता में सुधार करने के बंधाव मिश्रण करने के लिए PEG8000 का इस्तेमाल होता है. PEG8000 एक 60% करने के लिए (डब्ल्यू / वी) शेयर भंग करने के लिए मुश्किल हो सकता है लेकिन vortexed और धीरे solubilization मदद करने के लिए गर्म किया जा सकता है ध्यान दें. बंधाव संकेत से लंबी अवधि के लिए सेते छोड़ा जा सकता है, लेकिन यह डीएनए की लंबाई उत्पन्न किया जा रहा प्रभावित करने के लिए प्रकट नहीं होता है. इन कैंसर और संक्षारक हो सकता है के रूप में फिनोल और क्लोरोफॉर्म से निपटने जब कुछ देखभाल की जरूरत भी मनाया जाना. हमारे हाथ में जीन दा (इस तरह के वाणिज्यिक पाली के रूप में अन्य सिंथेटिक DNAs (द्वारा upregulated: डीटी)) concatemerized आईएसडी द्वारा upregulated उन लोगों से अलग हैं. लेकिन, दूसरों प्रकार की कोशिकाओं के बीच भिन्नता का विश्लेषण किया जा रहा है प्रतिबिंबित कर सकते हैं, जो इस तरह के मतभेदों को 10, नहीं मिली है. इस तरह के संघर्ष के होते हुए भी, concatemerized आईएसडी क्रय पाली की तुलना में जब उत्पन्न करने के लिए काफी सस्ता है: एक वाणिज्यिक स्रोत से (डीए डीटी) और अनुक्रम और संशोधनों के चुनाव के माध्यम से अधिक से अधिक लचीलापन देता है.

के तहत अध्ययन किया है जो डीएनए संवेदन का एक पहलू उत्तेजना में विवो प्रतिक्रिया है. हम इस प्रोटोकॉल में विवो प्रयोगों 7 के लिए उपयुक्त डीएनए उत्पन्न करने के लिए इस्तेमाल किया जा सकता है कि पता चला है. dsDNA उत्पाद चूहों में इंजेक्शन और सहज प्रतिरक्षा संकेत प्रक्रियाओं के बाद माप अनुमति देने के लिए शुद्ध और पर्याप्त उच्च एकाग्रता की है. यहाँ वर्णित प्रोटोकॉल में, देखभाल endotoxin, RNase, और DNase मुक्त है अंतिम डीएनए गोली भंग करने के लिए उपयोग किए गए पानी सुनिश्चित करने के लिए लिया जाना चाहिए. मुक्त डीएनए या DNA- इंजेक्शनजैसे, डीएनए संवेदन प्रक्रियाओं की उम्मीद है और के रूप में एक इंटरफेरॉन प्रतिक्रिया में लिपिड परिसरों परिणाम, concatemerized डीएनए डीएनए संवेदन में विवो के कई पहलुओं की जांच के लिए इस्तेमाल किया जा सकता है.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

लेखकों कोई पावती है.

Materials

Name Company Catalog Number Comments
Forward primer Integrated DNA Technologies n/a TACAGATCTACTAGTGATCTATGA CTGATCTGTACATGATCTACA
Reverse primer Integrated DNA Technologies n/a TGTAGATCATGTACAGATCAGT CATAGATCACTAGTAGATCTGTA
PEG8000 Sigma-Aldrich P-4463
Molecular biology grade water Sigma-Aldrich W4502-1L
T4 polynucleotide kinase Promega M4101
T4 DNA ligase Promega M1801
Phenol:chloroform Fisher Chemical BPE1752p-400
Chloroform Fisher Chemical C/4960/PB08
Ethanol Sigma-Aldrich 32221-2.5L
DNA gel loading buffer New England Biolabs B7021S
Agarose Bioline BIO-41025
Optimem Life Technologies 11058021
TransIT-LT1  Mirus Bioscience MIR 2300
Hamilton syringe Hamilton 80901 Model 1705
30 G needles  BD Bioscience 304000
SYBR Safe DNA gel stain Life Technologies S33102
Rneasy Plus Mini Kit Qiagen 74134
Oligo(dT) primer Thermo Scientific SO131
dNTP mix Fermentas R0192
Super Script III reverse transcriptase Life Technologies 56575
First strand cDNA synthesis buffer Life Technologies y02321
SybrGreen qPCR Fast master mix Applied Biosystems 4385612
cxcl10 murine forward primer  Integrated DNA Technologies n/a ACTGCATCCATATCGATGAC
cxcl10 murine reverse primer Integrated DNA Technologies n/a TTCATCGTGGCAATGATCTC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC

DOWNLOAD MATERIALS LIST

References

  1. Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. Nat. Immunol. 6, 49-56 (2005).
  2. Ishikawa, H., Ma, Z., Barber, G. N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature. 461, 788-792 (2009).
  3. Ishii, K. J., et al. TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature. 451, 725-729 (2008).
  4. Stetson, D. B., Medzhitov, R. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity. 24, 93-103 (2006).
  5. Pichlmair, A., Reise Sousa, C. Innate recognition of viruses. Immunity. 27, 370-383 (2007).
  6. Unterholzner, L., et al. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997-1004 (2010).
  7. Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. DNA-PK is a DNA sensor for IRF-3-dependent innate immunity. Elife. 1, e00047 (2012).
  8. Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 339, 786-791 (2013).
  9. Honda, K., Taniguchi, T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6, 644-658 (2006).
  10. Karayel, E., et al. The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature. Eur. J. Immunol. 39, 1929-1936 (2009).
Cytoplasmic डीएनए सेंसिंग रास्ते की उत्तेजना<em&gt; इन विट्रो</em&gt; और<em&gt; इन विवो</em
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).More

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter