Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

세포질 DNA 검출 진학의 자극 doi: 10.3791/51593 Published: September 18, 2014

Summary

프로토콜의 목적은 세포 및 생체 내에서 세포 내 DNA의 촬상 경로를 자극하는 최적의 방법을 사용하는 것이다. 이것은 블런트 엔드 라이 게이션시 긴 이중 가닥 DNA의 생성을 향상시킴으로써 달성된다. 세포 또는 마우스는 지질 형질 감염 시약을 이용하여 형질 전환된다.

Abstract

효율적 선천성 면역 반응을 자극하기 위해, DNA는 충분한 길이 여야 순도. 우리는 필요한 특성을 갖는 이중 가닥 DNA (dsDNA)를 검출 경로가 저렴하고 용이하게 생성 할 수있는 세포 내 DNA를 자극하는 방법을 제시한다. 단, 합성 올리고 뉴클레오티드 (않은 CpG 모티프를 결여한다)의 concatemerization으로 dsDNA는 세포질 DNA 감지 경로를 활성화하기에 충분한 길이로 생성 될 수있다. 이 프로토콜은 효율적인 결찰 발생하기위한 환경을 제공하는 폴리에틸렌 글리콜의 존재 (PEG)의 올리고 뉴클레오티드의 블런트 엔드 라이 게이션을 포함한다. dsDNA concatemers의 표준 프로토콜에 의해 형질 전환 체외에서 선천성 면역 반응을 시뮬레이션하기 위해, 페놀 / 클로로포름 추출에 의해 정제하여 다음을 사용할 수있다. 이 DNA는 또한 예를 들어, 마우스의 귀에 귓바퀴에 피내 주사함으로써 생체 내에서의 선천성 면역을 자극하는 데 사용될 수있다. 으로concatemerization 프로세스 및 후속 자극 프로토콜을 표준화하고, 선천성 면역계의 신뢰성 및 재현성 활성화가 제조 될 수있다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

DNA는 진핵 생물이 특정 구획 유지 모든 생물 세포의 중요한 구성 요소입니다. 이러한 구획화가 고장 경우 또는 선천성 면역 시스템의 한 기능을 확인하는 것입니다 이물질은 실제 외부 장벽의 위반을 통해 생물체에 도입 될 때. 인체 올바른 구획화 벗어날 수도 DNA의 소량이 저하 돕기 위해 존재하는 단백질들이있다; DNase의 I, II 및 III는 각각, 플라즈마, 엔도 솜 및 세포질에서 DNA를 분해. 그러나, 선천성 면역 시스템이 추가 핵 DNA에 응답하는지 DNase의 II를 결핍 된 마우스는 제안 인터페론 하나의 과도한 생산으로 인한 심한 빈혈 죽는 것이 보였다. 이 응답은 심지어 수신자 같은 수용체 신호 용량을 완전히 결핍 아르 쥐에서 발생합니다. 많은 연구는 지금 인터페론 유전자 (STING) 2 TANK 결합 키나제 1 (TB의 자극을 보여 주었다K1) 3은 세포질에서 DNA의 검출에이 신호 전달 경로는 인터페론 조절 인자 (IRF) -3 사를 활성화하는 것이 포함된다. 사이토 카인, 케모카인, 및 인터페론 유전자의 후속 IRF3 의존적 전사가 병원체 또는 위험 관련 분자 패턴 (PAMP 또는 DAMP) (5) 중 하나에 대한 선천성 면역 반응의 특징이다.

세포 내 핵산 검출 경로를 연구하는 욕구는 다른 선천성 면역 반응을 활성화하지 않고 세포 내로 DNA 또는 RNA를 도입하여 세포를 자극 견고하고 재생 가능한 방법을 개발할 필요하게되었다. STING / TBK1 / IRF3 경로를 자극 할 수있는 한 가지 방법은이 같은 DNA-PK, IFI16 및 CGAS 6-8로 DNA 센서에 의해 액세스 할 수있는 세포질로 핵산을 제공하는 양이온 성 지질 형질 전환 시약을 사용하는 것입니다.

현재 EFF을 허용하는 것으로 이해되는 DNA의 특성다른 경로의 자극없이 세포질 선천성 면역 반응의 icient 활성화 된 CpG의 길이, 질량, 순도, 및 부족 4,7,9 모티프입니다. 합성 올리고 뉴클레오티드가 DNA 서열 최적화 및 순수한 화학 종으로 제조 할 수 있도록 같은 선천성 면역 반응을 생성하는 목적에 매우 적합하다. 45 염기쌍 면역 자극 DNA (ISD) 서열은 이러한 목적에 적합 된 CpG 서열이없는 것으로 홍길동 외. (4)에 의해 확인되었다. 이 dsDNA 순서는, 그렇지 않으면 무작위와의 CpG 모티프의 부족을 넘어 특별한 기능이 없습니다. 우리는 훨씬 더 긴 가닥으로 ISD 올리고 뉴클레오타이드를 concatemerizing 의해 자극 (7)의 크기를 증가 시킨다는 것을 발견 하였다. concatemerized ISD의 세대는 세포질 선천성 면역 반응을 자극하므로 유용합니다. 여기에서는이 시약을 제조하는 프로토콜을 제시하고는 DNA에서 감지 경로를 활성화 할 수있는 방법생체 내에서뿐만 아니라 체외.

참고 : 모든 동물 연구 승인 기관 프로토콜 및 동물 관리 지침에 따라 수행된다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1 Concatemerization

  1. 재현 탁 프라이머의 Fw 및 오락 용 차 (RV)은 분자 생물학 학년 H 2 O에서 10 μg / μL의 농도로 (프라이머 서열 재료의 표 참조) 그런 다음의 Fw의 5 μL와 1.5 ㎖의 microcentrifuge 관에서, 계 프라이머의 5 μl를 섞는다.
  2. 15 분 (여기에 설명 된 프라이머 75 ° C) 정확한 열처리 온도에 가열하여 단련 프라이머 믹스. 실온 (RT)에서 냉각 벤치에 둡니다. DDH 2 O.에 용해하여 배양 중에 60 % PEG8000 준비
  3. 60 % PEG8000의 50 μL를 추가 배 폴리 뉴클레오티드 키나제 (PNK) 버퍼, H 2 O 27 μL 및 프라이머 믹스 PNK 3 μL의 10 μL (30 %의 최종 농도를 달성하기 위해). 2 시간 동안 37 ° C에서 품어.
  4. 실온에서 냉각 및 DNA 리가 아제 버퍼의 11 μl를 추가합니다. 그런 다음 DNA 리가 아제의 3 U를 추가하고 밤새 37 ° C에서 배양.

2 DNA 정제및 분석

  1. 결찰 믹스의 볼륨을 높이는 H 2 O의 300 μl를 추가합니다. 참고 : 클로로포름 증기 : 인해 페놀의 독성 흄 후드에서 진행합니다.
  2. 페놀 1 볼륨 (400 μL) 추가 : 클로로포름을 힘차게 흔들어 섞는다.
  3. 탁상의 microcentrifuge에서 1 분 동안 최대 속도로 원심 분리기. 수성 및 솔벤트 층 위에 수성 층 두 층 사이에 침전 된 단백질의 흰색 층으로 분리됩니다.
  4. 주의 피펫 팅하여 새 튜브에 상위 레이어로 이동 (중간 묻지 않도록, 흰색 층)
  5. 반복 2.2과 2.3의 두 배 이상이나 더 침전 된 단백질을 원심 분리 한 후이 없을 때까지 단계를 반복합니다.
  6. 클로로포름 1 볼륨 (400 μl를) 추가를 반복 2.3-2.4 단계를 반복합니다.
  7. 백퍼센트 미리 냉각 에탄올이 볼륨 (800 μL)를 추가하고 적어도 1 시간 또는 하룻​​밤 -20 ° C에서 배양한다. 참고 :이 단계는 DNA의 concatemers을 침전.
  8. 최대 속도와 대기음 공중으로에 스핀 다운rnatant. 70 % 에탄올 1 ㎖를 추가하여 한 번 세척하고 흄 후드에서 자연 건조 할 수 있습니다.
  9. 독소 무료 DDH 2 O.의 50 μL에서 재현 탁의 DNA 주 : 엔도톡신 자유 시약의 사용은 세포와 생체 내에서 특정 DNA 선천성 면역 반응을 생성하기에 중요하다.
  10. 신선한 튜브에 concatemerized DNA의 2 μL 나누어지는를 제거하고 1 ml의 DNA 젤 로딩 버퍼를 추가합니다.
  11. (오븐과 볼륨의 전력에 적합한 또는 시간) 2 분 동안 전자 레인지에서 최대 전력에 의해 가열 TAE 버퍼의 1 % 아가로 오스를 녹인다.
  12. , 주조 장치에 젤을 부어 형광 DNA 킬레이트 염료의 4 μl를 추가, 빗 삽입 한 겔 설정하는 약 20 분 동안 실온에 둡니다.
  13. 일단 설정되면, TAE 버퍼를 포함하는 전기 영동 탱크에 빗과 장소 젤을 제거합니다. 부하의 우물에 DNA 샘플 또는 크기 마커의 3 μL.
  14. 정전류 90 V에서 30 ~ 40 분 동안 전기 영동을 실행합니다. Visuali'제 자외선 아래에있는 DNA는 concatemerization (그림 1A)를 준수합니다.
  15. UV 흡광 분광법에 의한 샘플의 나머지 부분에서의 DNA 농도를 측정한다. DNA를 재현 탁하고 200-300 nm 내지 흡광도 스펙트럼을 측정하는 데 사용 된 동일한 DDH 2 O 빈 분광계. 주 : DNA 농도는 흡광도 인 맥주 램버트 법칙, A = 전자 * C 형 * 리터를 사용하여 계산 될 수 있고, 광 경로의 거리를 흡광 계수를 E 및 L. DNA를 측정하기위한 측정해야 260 nm에서 흡광도 0.027 (μg / ㎖)의 흡광 계수 -1 cm -1을 사용 농도. 광경 거리, 난, 분광 광도계에 따라 달라질 수 있습니다. 농도를 측정하는 동안, DNA 순도의 표시로 280 분의 260 nm의 흡광도 비율의 주를 가지고; 위의 2.00의이 비율의 값을 권장합니다.

바이올렛에서 dsDNA Concatemers의 3 형질접근 금지

  1. 조직 배양 접시 또는 접시에 씨앗 세포는 자극의 시간에 70 % 합류한다.
  2. 1-10 μg / ML의 최종 농도를 이용하여 세포의 자극에 필요한 DNA의 질량을 계산한다. DNA의 요구 질량은 다음과 X로 기록 될 것입니다. 예를 들어 다음, 5 ㎍ / ㎖가 DNA의 DNA의 농도가 2 * 5 = 10 μg의 질량에 배지 2 ㎖과 함께 6 - 웰 플레이트 중 하나의 잘 세포를 자극하는 것이 요구되는 경우.
  3. 적당한 크기의 멸균 튜브에 혈청 배지의 50 * X μl를 추가합니다. 피펫 조심스럽게 매체의 중심에, 튜브, 2 * X 양이온 성 지질 형질 전환 시약 ㎕의 5 분간 방치의면을 만지지 않고.
  4. 튜브와 소용돌이 살짝 DNA의 X의 μg을 추가합니다. 적어도 20 분 동안 실온에서 둡니다. 체외 형질은 세포질 DNA 감지 경로를 자극하는 세포에 직접 혼합물을 추가합니다.

dsDNA Concatemers I의 4 형질N 비보

  1. 3.1-3.5가 1 μg의 DNA, 2 ㎕의 지질 형질 전환 시약 및 18 ㎕의 혈청 마우스 귀 당 배지를 자극 할을 사용하여 설명에 따라 형질 믹스를 준비합니다. 멸균 된 30 G 바늘 멸균 20 μL 해밀턴 주사기, 모자를 준비하고, DNA 형질 믹스로드합니다.
  2. 1 ~ 2 % 이소 플루 란 (isoflurane)을 이용 C57BL / 6 마​​우스를 마취. 운동과 일정한 호흡의 손실에 의해 필요한 경우 핀치 반사 검사로 마취를 확인합니다. 마취 중에 동물의 눈을 모니터링하고 과도한 건조를 방지하기 위해 필요에 따라 연고를 사용합니다.
  3. 멸균 기법을 사용하여 귀 귓바퀴에주의 액체의 단일 '기포'귀의 피부 층 사이에 형성되도록 형질 전환 혼합물의 10 μl를 주입. 주 : 바늘 귀 귓바퀴의 피부의 첫 층을 관통되도록 예각, 엄지 손가락 또는 인덱스에 고무 골무를 사용하여 그 위에 귀를 스트레칭하고, 주사.
  4. 고삐가 생깁니다 마우스가 다시 케이지에 정기적으로 후 마취 회복을 모니터링 할 수 있습니다. 마취 된 쥐의 과도하게 냉각되지 않도록 가열 램프를 사용한다. 그들은 흉골 드러 누움을 유지하기 위해 충분한 의식을 회복 할 때까지 무인 쥐를 두지 마십시오.
  5. 플래시는 2 분 동안 액체 질소에 침지 microcentrifuge 관에서 전체 귀 귓바퀴를 동결.

정량 PCR에 의한 DNA 자극 샘플 및 분석의 5 처리 (qPCR에)

  1. 흡인 피펫 매체 및 폐기물을 폐기 : 세포 배양에서.
  2. 멸균 PBS 1 ㎖를 추가합니다. 5.1 및 5.2을 두 번 반복하고 5.3 단계로 진행
  3. 귀 조직에서 : 살균 세라믹 봉과 박격포를 사용하여 액체 질소에서 조직을 분쇄 멸균 주걱을 사용하여 microcentrifuge 관에 지상 조직을 전송하고, 5.4 단계로 진행
  4. 350 μL 용해 버퍼를 추가 및 상업 RNA 추출 키트 프로토콜로 진행합니다. 추출 키트 정화에서 용출 RNA40 ㎕의 DDH 2 O.에서 열 참고 : 상업 RNA 추출 키트는 아주 잘 작동 (재료 / 장비 표 참조); 다른 기술은 평균 이하의 결과를 테스트되었습니다.
  5. (2.13) 이상 DNA에 대하여 기술 된 바와 같이 UV 분광법에 의한 RNA 정량화. 주 : RNA에 대한 흡광 계수는 0.025 (μg / ㎖) -1 cm -1이다.
  6. 올리고 (DT) 프라이머의 멸균 PCR 튜브 1 μl를 추가, 10 밀리미터의 dNTP의 한 UL 혼합하고, 250 μg의 RNA. 멸균 DDH 2 O. 11 μL의 볼륨을 확인
  7. 65 ° C에서 5 분 동안 품어. 그런 다음 4 μL 먼저 스트랜드 버퍼, 1 ㎕의 0.1 M 디티 오 트레이 톨을 추가, 0.25 μL 튜브에 효소와 1.75 μL DDH 2 O 역. 15 분 동안 72 ° C 다음에 1 시간 동안 50 ° C에서 품어. O. DDH 2를 사용하여 5 : 임의로, 하나의 cDNA 생성물을 희석
  8. 정량 PCR을 사용하여 2 μL의 cDNA, 2 μL의 DDH 2 O, 5 ㎕의 qPCR에 마스터 믹스, 그리고 일에 대한앞으로 10 μM의 각 μL 선택의 유전자 (들)을 증폭하는 프라이머 주식을 역으로 수행하십시오. 96 웰 플레이트에 혼합하고 정량적 PCR 기계 (그림 1B와 1C)를 사용하여 분석 할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

아래 결과는 concatemerized DNA가 상대적으로 쉽게 생성 세포와 마우스에서 강력한 선천성 면역 반응을 자극 할 수 있음을 나타낸다. PEG8000의 사용으로, 명확 생성되는 DNA의 길이가 상당히 길어 CXCL10의 전사를 유도 할 수있는 동등 함을 알 수있다. 아가 로즈 겔 분석으로 알 수있는 바와 같이 PEG8000과 샘플, DNA의 길이가 10000 BP (도 1a)을 초과하는 가닥을 포함하는 반면, 표준 concatemerization는 최대 800 염기쌍 (BP)의 DNA의 길이를 갖는다. 쥐의 배아 섬유 아 세포 (MEFs) 또는 마우스로 이들의 DNA의 형질은 선천성 면역 DNA 감지 장치 (그림 1B와 1C)의 자극을 나타내는 qPCR에 의해 측정 할 수있다 사이토 카인과 케모카인의 강력한 전사를 유도한다.

광고 / 51,593 / 51593fig1highres.jpg "/>
생쥐의 섬유 아세포와 concatemerized ISD DNA (conDNA)의 생산과 자극을 나타내는도 1 대표 데이터. (A)는 concatemerized의 DNA 샘플 또는 아가로 오스 겔 전기 영동에 의해 분석 PEG8000없이 어느 제조. (B) MEFs ML은 10 μg /에서 다양한 DNA를 자극하고 CXCL10 및 IL-6의 mRNA 수준은 6 시간 후 qPCR에 의해 측정 하였다. (C) 마우스에서 12 시간 이상 qPCR에 의해 측정하고 conDNA CXCL10의 수준 및 IL-6 mRNA를 함께 귀 귓바퀴에 주사 하였다. 데이터 HPRT (RQ) 및 오차 막대의 레벨에 비해 배 증가로서 도시되어있다 +/-은 SEM (N = 3).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

여기에 설명 된 프로토콜은 세포 유형의 넓은 범위에서와 생체 내에서 재현 가능한 결과와 세포질 선천성 면역 반응을 자극하는 dsDNA를 생성하는 데 사용된다. 사용 된 주 기판 시약 합성 올리고 뉴클레오티드이므로, 다른 DNA 서열 또는 화학적 변형을 이용하여 본 시스템의 유연성이있다. 그것은 예를 들어 형광 라벨 또는 현지화를 추적 또는 다른 생체 분자와의 상호 작용을 평가하기 위해 비오틴 부위를 포함 하나이 프로토콜에서 설명 순방향 가닥 올리고 뉴클레오타이드를 대체 할 수있다.

DNA의 concatemerization의 주요 이점 중 하나는 시퀀스 제어 할 수있는 방식에서 dsDNA의 긴 가닥의 생산이다. C :이 반응의 생성물은 상업적 RNA 아날로그 폴리 (I 유사한 다른 길이의 DNA (의 혼합물이 항상 있도록 DNA 길이를 정확하게 감시 할 수 없다는 것이다 여기에 제한되지)). 이 방법의 또 다른 장점은 (mg의 양까지) 면역 자극 DNA의 큰 질량의 수량의 생산을 허용한다는 것이다. 필요에 따라 그 이후의 정제 단계가 다음에서 설명하는 프로토콜 규모의 분취 량에서 수행되어야한다는 것을 주목해야한다하더라도 concatemerization 단계는 용이하게 확장 할 수있다.

DNA를 concatemerizing의 다른 방법에 비해, 메인 첨가 결찰 효율을 개선하기 위해 결찰 믹스 PEG8000의 사용이다. PEG8000이 60 %를 만들기 위해 (w / v)의 주식을 용해하기 어려운 경우가 있습니다 만, 와동 부드럽게 용해 도움을 가열 할 수 있습니다. 결찰이 표시보다 긴 기간 동안 배양 남아있을 수 있지만, 이것은 DNA의 길이가 생성되는 영향을 나타나지 않습니다. 이러한 발암 물질과 부식성 수있는 페놀과 클로로포름을 처리 할 때 일부 관리 요구도 관찰 될 수있다. 우리 손에서 유전자에 dA (예 : 상업 폴리 다른 합성 DNA를 (에 의해 상향 조절: DT는)) concatemerized ISD에 의해 발현이 다릅니다. 그러나, 다른 종류의 세포 사이의 변화가 분석되고 반영 될 수 등의 차이 (10)를 발견하지 않았습니다. 이러한 갈등에도 불구하고, concatemerized ISD는 구입 폴리에 비해 생성 상당히 저렴 : 상용 소스에서 DA (DT) 시퀀스 및 수정의 선택을 통해보다 유연하게 할 수 있습니다.

언더 연구되고있다 DNA 센싱의 일 양태는 자극에 생체 내 반응이다. 우리는이 프로토콜은 생체 내 실험 7에 적합한 DNA를 생성하는데 사용될 수 있음을 보여 주었다. dsDNA 생성물은 생쥐에 주입 및 선천성 면역 신호 전달 과정의 연속 측정을 할 수 있도록 순수하고 충분히 높은 농도이다. 여기에 설명 된 프로토콜에서, 치료는 독소,의 RNase와 DNase를 무료 최종 DNA 펠렛을 용해시키기 위해 사용되는 물을 보장하기 위해주의해야한다. 무료 DNA 또는 DNA- 사출같은 DNA 감지 과정의 예상과 같은 인터페론 응답 지질 복합체 결과, concatemerized DNA는 DNA 검출 생체의 여러 측면을 검사하는데 사용될 수있다.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

저자는 수신 확인이 없습니다.

Materials

Name Company Catalog Number Comments
Forward primer Integrated DNA Technologies n/a TACAGATCTACTAGTGATCTATGA CTGATCTGTACATGATCTACA
Reverse primer Integrated DNA Technologies n/a TGTAGATCATGTACAGATCAGT CATAGATCACTAGTAGATCTGTA
PEG8000 Sigma-Aldrich P-4463
Molecular biology grade water Sigma-Aldrich W4502-1L
T4 polynucleotide kinase Promega M4101
T4 DNA ligase Promega M1801
Phenol:chloroform Fisher Chemical BPE1752p-400
Chloroform Fisher Chemical C/4960/PB08
Ethanol Sigma-Aldrich 32221-2.5L
DNA gel loading buffer New England Biolabs B7021S
Agarose Bioline BIO-41025
Optimem Life Technologies 11058021
TransIT-LT1  Mirus Bioscience MIR 2300
Hamilton syringe Hamilton 80901 Model 1705
30 G needles  BD Bioscience 304000
SYBR Safe DNA gel stain Life Technologies S33102
Rneasy Plus Mini Kit Qiagen 74134
Oligo(dT) primer Thermo Scientific SO131
dNTP mix Fermentas R0192
Super Script III reverse transcriptase Life Technologies 56575
First strand cDNA synthesis buffer Life Technologies y02321
SybrGreen qPCR Fast master mix Applied Biosystems 4385612
cxcl10 murine forward primer  Integrated DNA Technologies n/a ACTGCATCCATATCGATGAC
cxcl10 murine reverse primer Integrated DNA Technologies n/a TTCATCGTGGCAATGATCTC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC

DOWNLOAD MATERIALS LIST

References

  1. Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. Nat. Immunol. 6, 49-56 (2005).
  2. Ishikawa, H., Ma, Z., Barber, G. N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature. 461, 788-792 (2009).
  3. Ishii, K. J., et al. TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature. 451, 725-729 (2008).
  4. Stetson, D. B., Medzhitov, R. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity. 24, 93-103 (2006).
  5. Pichlmair, A., Reise Sousa, C. Innate recognition of viruses. Immunity. 27, 370-383 (2007).
  6. Unterholzner, L., et al. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997-1004 (2010).
  7. Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. DNA-PK is a DNA sensor for IRF-3-dependent innate immunity. Elife. 1, e00047 (2012).
  8. Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 339, 786-791 (2013).
  9. Honda, K., Taniguchi, T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6, 644-658 (2006).
  10. Karayel, E., et al. The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature. Eur. J. Immunol. 39, 1929-1936 (2009).
세포질 DNA 검출 진학의 자극<em&gt; 체외</em&gt;와<em&gt; 생체</em
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).More

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter