Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Stimulering av cytoplasmatiske DNA Sensing Pathways doi: 10.3791/51593 Published: September 18, 2014

Summary

Formålet med protokollen er å bruke optimale fremgangsmåter for å stimulere de cytoplasmiske DNA føler trasé i celler og in vivo. Dette oppnås ved å forbedre genereringen av lange, dobbeltkjedet DNA ved butt-ende ligering. Celler eller mus blir deretter transfektert ved hjelp av en lipid transfeksjon reagens.

Abstract

For effektivt å stimulere en medfødte immunrespons, må DNA være av tilstrekkelig lengde og renhet. Vi presenterer en metode hvor dobbelt-trådet DNA (dsDNA), som har de nødvendige egenskaper for å stimulere cytoplasmisk DNA føler trasé kan genereres billig og på en enkel måte. Ved concatemerization av korte, syntetiske oligonukleotider (som mangler CpG motiver), kan dsDNA bli generert til å være av tilstrekkelig lengde for å aktivere den cytosoliske DNA føle pathway. Denne protokoll omfatter butt ende ligering av oligonukleotidene i nærvær av polyetylenglykol (PEG), som gir et effektivt miljø for ligering til å forekomme. De dsDNA concatemers kan anvendes, etter rensing ved fenol / kloroform ekstraksjon, for å simulere den medfødte immunrespons in vitro ved hjelp av standard protokoller transfeksjon. Dette DNA kan også brukes til å stimulere medfødt immunitet in vivo ved intradermal injeksjon i øret pinna av en mus, for eksempel. Avstandardisere concatemerization prosessen og den etterfølgende stimuleringsregimer, kan en pålitelig og reproduserbar aktivering av den medfødte immunsystemet bli produsert.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

DNA er en viktig komponent i alle organismer og celler, som eukaryoter holder i bestemte avdelinger. En funksjon av den medfødte immunsystemet, er å identifisere når en slik compartmentalization bryter ned eller når fremmed materiale blir innført inn i organismen via et brudd på fysiske, ytre barrierer. I menneskekroppen er det en rekke proteiner som finnes å bidra til å degradere små mengder av DNA som kan unnslippe korrekt compartmentalization; DNAse I, II og III bryte ned DNA i plasma, endosome, og cytosol, respektivt. Imidlertid har det vist seg at mus som mangler DNAse II dør av alvorlig anemi forårsaket av overdreven produksjon av interferoner en som tyder på at det medfødte immunsystemet reagerer på ekstra-kjerne-DNA. Denne responsen skjer selv hos mus som er helt mangelfull i toll-like receptor signalkapasitet. Tallrike studier har nå vist at stimulator av interferon gener (STING) 2 og TANK-bindende kinase 1 (TBK1) 3 er involvert i gjenkjenning av DNA i cytoplasma, og at denne signalveien aktiveres interferon regulerende faktor (IRF) -3 4. Den påfølgende IRF3 avhengige transkripsjon av cytokin, kjemokinet og interferon gener er karakteristisk for en medfødt immunrespons mot enten et patogen eller fare forbundet molekylær mønster (PAMP eller fuktig) 5.

Ønsket om å studere intracellulære nukleinsyre sensing veier har ført til kravet om å utvikle robuste og reproduserbare metoder for å stimulere cellene ved å innføre DNA eller RNA inn i celler uten å aktivere andre medfødte immunresponser. En metode der STING / TBK1 / IRF3 pathway kan stimuleres er ved hjelp av kationiske lipid transfeksjon reagenser å levere nukleinsyre i cytoplasma hvor den kan nås av DNA-sensorer som DNA-PK, IFI16, og CGAS 6-8.

Karakteristikken av DNA som nå er forstått å tillate efficient aktivering av cytoplasma medfødte immunrespons uten stimulering av andre banene er dens lengde, masse, renhet og mangel på CpG motiver 4,7,9. Syntetiske oligonukleotider er godt egnet for det formål å generere en medfødte immunrespons som de tillater at DNA-sekvensen som skal optimaliseres, og fremstilt som en ren kjemisk species. En 45 basepar immuno-stimulerende DNA (ISD) sekvensen ble identifisert ved Stetson et al. Fire som å være et egnet, CpG-fri sekvens for dette formål. Dette dsDNA sekvensen er ellers tilfeldig og har ingen spesifikke funksjoner utover sin mangel på CpG motiver. Vi har funnet at ved concatemerizing ISD oligonukleotid inn betydelig lengre tråder øker omfanget av stimulering 7. Generering av concatemerized ISD er derfor nyttig for å stimulere en cytoplasma medfødte immunrespons. Her presenterer vi protokoller for utarbeidelsen av denne reagensen og hvordan den kan brukes til å aktivere DNA sensing veien ivitro samt in vivo.

MERK: Alle dyrestudier er utført under godkjente institusjonelle protokoller og retningslinjer dyr omsorg.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Concatemerization

  1. Suspender primere Fw og Rv (se tabell for material for primer sekvenser) til en konsentrasjon på 10 mikrogram / ​​mL i molekylærbiologi klasse H 2 O. Deretter blandes 5 pl av Fw og 5 pl av Rv primer i et 1,5 ml mikrosentrifugerør.
  2. Anneal primerblanding ved oppvarming til den riktige annealing temperatur (75 ° C for de primere som er beskrevet her) i 15 min. La på benken for å kjøle seg ned i romtemperatur (RT). Klargjør 60% PEG8000 i løpet av denne inkubasjon ved å løse opp i DDH 2 O.
  3. Tilsett 50 pl av 60% PEG8000 (for å oppnå en sluttkonsentrasjon på 30%), 10 pl 10x polynukleotidkinase (PNK)-buffer, 27 pl av H2O og 3 pl av PNK til primerblandingen. Inkuber ved 37 ° C i 2 timer.
  4. Kjøl deg ned på RT og tilsett 11 mL av DNA ligase buffer. Deretter legger 3 U av DNA-ligase, og inkubere ved 37 ° C over natten.

2. DNA Purificationog analyse

  1. Tilsett 300 pl av H2O for å øke volumet av ligeringsblandingen. Merk: Fortsett i en avtrekkshette på grunn av giftigheten av fenol: kloroform damp.
  2. Tilsett 1 volum (400 pl) fenol: kloroform og bland ved å riste kraftig.
  3. Sentrifuger ved maks hastighet i 1 min i en tabletop mikrosentrifuge. De vandige og oppløsnings lag vil skille med det vandige lag på toppen, og et hvitt lag av utfelt protein mellom de to lag.
  4. Overfør øverste laget til et nytt rør ved forsiktig pipettering (unngå å overføre midten, hvitt lag)
  5. Gjenta trinn 2.2 og 2,3 i det minste to ganger, eller inntil det ikke er noen utfelte protein etter sentrifugering.
  6. Tilsett 1 volum (400 mikroliter) av kloroform og gjenta trinn 02.03 til 02.04.
  7. Tilsett 2 volumer (800 ul) av 100% prechilled etanol og inkuberes ved -20 ° C i minst 1 time eller over natten. MERK: Dette trinnet utfellinger DNA concatemers.
  8. Spinn ned ved maks hastighet og aspirer supernatant. Vask en gang ved å legge til 1 ml 70% etanol og la det lufttørke i avtrekkshette.
  9. Resuspender DNA i 50 mL av endotoksin gratis DDH 2 O. Merk: Bruken av endotoxin frie reagenser er viktig for å generere et DNA-spesifikk medfødte immunrespons i celler og in vivo.
  10. Fjern en 2 ul aliquot av den concatemerized DNA inn i et nytt rør og tilsett 1 ml DNA-gel lastebuffer.
  11. Løs opp 1% agarose i TAE buffer ved oppvarming på full effekt i mikrobølgeovn i 2 min (eller tid som er passende til kraften i ovnen og volum).
  12. Hell gel inn støpeapparatur, tilsett 4 mL av fluorescerende DNA chelaterende fargestoff, sette inn en kam, og la ved romtemperatur i ca 20 min for gelen for å stille.
  13. Når det er satt, må du fjerne kammen og sted gel inn elektroforese tank som inneholder TAE buffer. Load 3 mL av DNA-prøven eller størrelse markører i brønner.
  14. Kjør gelelektroforese for 30-40 min ved 90 V med konstant strøm. Visualize DNA i henhold til ultra-fiolett lys for å observere concatemerization (figur 1A).
  15. Mål-DNA-konsentrasjonen i resten av prøven ved UV-absorbans-spektroskopi. Blank spektrometeret med samme DDH 2 O som ble brukt til å resuspendere DNA og måle absorbansen spektrum 200-300 nm. MERK: DNA-konsentrasjon kan beregnes ved hjelp av Beer-Lambert lov, A = e * c * l, der A er absorbans, e det ekstinksjonskoeffisient, og l avstanden lyset banen. For måling av DNA-konsentrasjoner absorbansen ved 260 nm måles og en ekstinksjonskoeffisient på 0.027 (ug / ml) -1 cm -1 anvendes. Den lysbanen avstand, l, vil variere avhengig av spektrofotometeret. Mens måle konsentrasjonen, ta notat av 260/280 nm absorbans ratio som en indikasjon på DNA renhet; en verdi for dette forholdet over 2,00 anbefales.

3. Transfeksjon av dsDNA Concatemers i ViTro

  1. Seed celler i en vevskultur skål eller plate for å være 70% sammenflytende på tidspunktet for stimulering.
  2. Beregn massen av DNA som kreves for stimulering av cellene ved hjelp av en sluttkonsentrasjon på 1-10 ug / ml. Den nødvendige mengden av DNA vil bli angitt som X nedenfor. For eksempel hvis stimulere celler i en enkelt brønn av en 6-brønns plate med 2 ml av mediet i en konsentrasjon på DNA av 5 mikrogram / ml og deretter en mengde av 2 * 5 = 10 mikrogram av DNA er nødvendig.
  3. Tilsett 50 * X ul serumfritt medium i en egnet størrelse sterilt rør. Pipetter nøye inn i sentrum av det medium, uten å berøre den siden av røret, 2 * X pl av kationisk lipid transfeksjon reagens og la stå i 5 min.
  4. Legg X ug av DNA til røret og vortex kort. La ved RT i minst 20 min. For in vitro transfeksjon legge denne blanding direkte til celler for å stimulere cytoplasmiske DNA føler trasé.

4. Transfeksjon av dsDNA Concatemers jegn Vivo

  1. Forbered transfeksjon blanding som beskrevet i 3.1 til 3.5 ved anvendelse av 1 pg DNA, 2 pl lipid transfeksjon reagens og 18 pl serumfritt medium pr mus øre som skal stimuleres. Forbered en steril 20 mL Hamilton sprøyte, lue med en steril 30 G nål og legg med DNA transfeksjon mix.
  2. Bedøve en C57BL / 6 mus bruker 1-2% isofluran. Bekreft anestesi ved tap av bevegelse og konstant respirasjonsfrekvens og med klype refleks test om nødvendig. Overvåke dyrets øyne under anestesi og bruke salve som er nødvendig for å unngå overdreven tørrhet.
  3. Ved å bruke steril teknikk, injisere forsiktig inn i øret øremuslingen 10 mL av transfeksjon blanding, slik at en enkelt "boble" av væske er dannet i mellom de dermale lag av øret. Merk: Bruk en gummi fingerbøl på tommelen eller pekefingeren, strekke øret over det, og injisere i spiss vinkel for å sikre nålen penetrerer bare det første laget av huden av øret pinna.
  4. Reintroduce musen tilbake i buret og regelmessig overvåke post-bedøvelse utvinning. Bruk en varmelampe for å unngå overdreven avkjøling av anesteserte mus. Ikke la mus uten tilsyn før de har gjenvunnet tilstrekkelig bevissthet til å opprettholde sternal recumbency.
  5. Flash fryse hele øret pinna i et mikrosentrifugerør ved nedsenking i flytende nitrogen i 2 min.

5. Behandling av DNA stimulert Prøver og analyse av kvantitativ PCR (qPCR)

  1. Fra cellekultur: aspirer medium med en pipette og kast avfall.
  2. Tilsett 1 ml sterilt PBS. Gjenta 5.1 og 5.2 to ganger, og gå videre til trinn 5.3
  3. Fra øre vev: slipe vevet under flytende nitrogen ved hjelp av sterile keramiske morter, overføre bakken vev til en mikrorøret ved hjelp av en steril spatel, og fortsett til trinn 5.4
  4. Legg 350 mL lysis buffer og fortsette med kommersielt RNA ekstraksjon kit-protokollen. Elute RNA fra utvinning kit rensingkolonne i 40 pl DDH 2 O. Merk: Den kommersielle RNA ekstraksjon kit (se materialer / utstyr tabell) fungerer veldig bra; andre teknikker har blitt testet med pari resultater.
  5. Kvantifisere RNA ved UV-spektroskopi som beskrevet for DNA ovenfor (avsnitt 2.13). Merk: ekstinksjonskoeffisient for RNA er 0,025 (pg / ml) -1 cm -1.
  6. Legg til en steril PCR rør 1 ul oligo (dT) primer, 1 pl 10 mM dNTP blanding, og 250 ug RNA. Gjør opp volumet til 11 mL med sterilt DDH 2 O.
  7. Inkuber i 5 min ved 65 ° C. Deretter legger 4 mL First Strand Buffer, 1 mL 0,1 M dithiothreitol, 0,25 mL revers transkriptase og 1,75 mL DDH 2 O til røret. Inkuber ved 50 ° C i 1 time etterfulgt av 72 ° C i 15 min. Eventuelt fortynne cDNA produkt 1: 5 bruker DDH 2 O.
  8. For kvantitativ PCR bruk 2 mL cDNA, 2 ul DDH 2 O, 5 mL qPCR mester mix, og enul hver av 10 uM forover og revers primer stocks å forsterke gen (er) for valg. Bland i en 96-brønns plate og analyseres ved hjelp av en kvantitativ PCR-maskin (figurene 1B og 1C).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Resultatene nedenfor viser at concatemerized DNA kan bli generert relativt enkelt, og er i stand til å stimulere en robust medfødte immunrespons i celler og hos mus. Med bruk av PEG8000, kan det tydelig ses at lengden av DNA som genereres er vesentlig lengre og like i stand til å indusere transkripsjon av Cxcl10. Som det fremgår av agarosegel-analyse, har standard concatemerization lengder av DNA på opp til 800 basepar (bp), mens det for prøven med PEG8000, lengden av DNA omfatter tråder i overkant av 10 000 bp (figur 1A). Transfeksjon av disse DNA-molekyler inn i murine embryoniske fibroblaster (MEFs) eller mus induserer en sterk transkripsjon av cytokiner og kjemokiner som kan måles ved qPCR indikerer stimulering av den medfødte immun DNA følemaskiner (figurene 1B og 1C).

AD / 51593 / 51593fig1highres.jpg "/>
Figur 1. Representative data som angir produksjon av concatemerized ISD DNA (conDNA) og stimulering av fibroblaster og mus. (A) En prøve av concatemerized DNA produsert enten med eller uten PEG8000 analysert ved agarosegel-elektroforese. (B) MEFs ble stimulert med ulike DNA-molekyler ved 10 ug / ml, og nivåene av CXCL10 og IL-6 mRNA målt ved qPCR 6 timer senere. (C) mus ble injisert inn i øret pinnae med conDNA og nivåene av CXCL10 og IL-6 mRNA målt ved qPCR 12 timer senere. Dataene er vist som gangers økning i forhold til nivået av HPRT (RQ), og feilfelt er +/- SEM (n = 3).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De protokoller som er beskrevet her, blir brukt til å generere dsDNA å stimulere cytosoliske medfødte immunrespons med reproduserbare resultater i et stort utvalg av celletyper og in vivo. Siden den viktigste substrat reagens som anvendes er en syntetisk oligonukleotid, har det fleksibiliteten i dette system for å bruke alternative DNA-sekvenser eller kjemiske modifikasjoner. Det er mulig, for eksempel, for å erstatte den fremre otidet beskrevet i denne protokoll med en som inneholder en fluorescerende markør eller en biotinrest å spore lokalisering eller vurdere interaksjoner med andre biomolekyler.

En av de viktigste fordelene ved DNA concatemerization er produksjon av lange tråder av dsDNA på en slik måte at sekvensen kan kontrolleres. Det er en begrensning her som er at DNA-lengden ikke kan overvåkes nøyaktig slik at produktet av denne reaksjon er alltid en blanding av DNA i ulike lengder (tilsvarende den kommersielle RNA analoge poly (I: C)). En annen fordel med denne teknikken er at den tillater produksjon av store massemengder immuno-stimulerende DNA (opp til mg mengder). Den concatemerization trinnet kan bli skalert opp lett ved behov, selv om det bør bemerkes at etterfølgende rensetrinn bør da utføres i alikvoter av skalaen beskrevet i protokollen.

Sammenlignet med andre fremgangsmåter for concatemerizing DNA, er hoved tillegg bruk av PEG8000 til ligerings blanding ligering for å forbedre effektiviteten. Legg merke til at PEG8000 kan være vanskelig å oppløse for å lage en 60% (w / v) lager, men kan bli virvlet og forsiktig oppvarmet for å hjelpe solubilisering. Ligerings kan overlates til inkuberes i lengre perioder enn angitt, men dette synes ikke å påvirke lengden av DNA blir generert. Også observeres noen omsorgsbehov ved håndtering av fenol og kloroform da disse kan være kreftfremkallende og etsende. I våre hender genene oppregulert av andre syntetiske DNA-molekyler (for eksempel kommersiell poly (dA: DT)) er forskjellige fra de oppregulert ved concatemerized ISD. Imidlertid har andre, ikke funnet slike forskjeller 10, noe som kan gjenspeile forskjeller mellom celletypene som blir analysert. Uten hensyn til slike konflikter, er den concatemerized ISD betydelig billigere å produsere i forhold til å kjøpe poly (dA: dT) fra en kommersiell kilde og tillater større fleksibilitet via valg av sekvensen og modifikasjoner.

Et aspekt av DNA gjenkjenning som er under-er studert in vivo respons på stimulering. Vi har vist at denne protokollen kan brukes for å generere DNA egnet for in vivo-eksperimenter 7. Den dsDNA produktet er ren og av høy nok konsentrasjon til å tillate injeksjon i mus og etterfølgende måling av medfødte immunsignalprosesser. I protokollen er beskrevet her, må man sørge for å sikre at vannet som brukes til å oppløse den endelige DNA pellet er endotoksiner, RNase og DNase gratis. Injeksjon av gratis DNA eller DNA-lipidkomplekser resulterer i et interferon respons som forventet av DNA føler prosesser, og, som sådan, kan den concatemerized DNA brukes til å undersøke flere aspekter av DNA avføling in vivo.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Forfatterne har ingen bekreftelser.

Materials

Name Company Catalog Number Comments
Forward primer Integrated DNA Technologies n/a TACAGATCTACTAGTGATCTATGA CTGATCTGTACATGATCTACA
Reverse primer Integrated DNA Technologies n/a TGTAGATCATGTACAGATCAGT CATAGATCACTAGTAGATCTGTA
PEG8000 Sigma-Aldrich P-4463
Molecular biology grade water Sigma-Aldrich W4502-1L
T4 polynucleotide kinase Promega M4101
T4 DNA ligase Promega M1801
Phenol:chloroform Fisher Chemical BPE1752p-400
Chloroform Fisher Chemical C/4960/PB08
Ethanol Sigma-Aldrich 32221-2.5L
DNA gel loading buffer New England Biolabs B7021S
Agarose Bioline BIO-41025
Optimem Life Technologies 11058021
TransIT-LT1  Mirus Bioscience MIR 2300
Hamilton syringe Hamilton 80901 Model 1705
30 G needles  BD Bioscience 304000
SYBR Safe DNA gel stain Life Technologies S33102
Rneasy Plus Mini Kit Qiagen 74134
Oligo(dT) primer Thermo Scientific SO131
dNTP mix Fermentas R0192
Super Script III reverse transcriptase Life Technologies 56575
First strand cDNA synthesis buffer Life Technologies y02321
SybrGreen qPCR Fast master mix Applied Biosystems 4385612
cxcl10 murine forward primer  Integrated DNA Technologies n/a ACTGCATCCATATCGATGAC
cxcl10 murine reverse primer Integrated DNA Technologies n/a TTCATCGTGGCAATGATCTC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC

DOWNLOAD MATERIALS LIST

References

  1. Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. Nat. Immunol. 6, 49-56 (2005).
  2. Ishikawa, H., Ma, Z., Barber, G. N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature. 461, 788-792 (2009).
  3. Ishii, K. J., et al. TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature. 451, 725-729 (2008).
  4. Stetson, D. B., Medzhitov, R. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity. 24, 93-103 (2006).
  5. Pichlmair, A., Reise Sousa, C. Innate recognition of viruses. Immunity. 27, 370-383 (2007).
  6. Unterholzner, L., et al. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997-1004 (2010).
  7. Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. DNA-PK is a DNA sensor for IRF-3-dependent innate immunity. Elife. 1, e00047 (2012).
  8. Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 339, 786-791 (2013).
  9. Honda, K., Taniguchi, T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6, 644-658 (2006).
  10. Karayel, E., et al. The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature. Eur. J. Immunol. 39, 1929-1936 (2009).
Stimulering av cytoplasmatiske DNA Sensing Pathways<em&gt; In Vitro</em&gt; Og<em&gt; In Vivo</em
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).More

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter