Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Estimulação da Citoplasmáticas DNA Sensing Pathways doi: 10.3791/51593 Published: September 18, 2014

Summary

O objectivo do protocolo é a utilização de métodos mais eficientes para estimular as vias sensoriais citoplasmáticos de ADN em células e in vivo. Isto é conseguido através da melhoria da geração de ADN de comprimento, de cadeia dupla, durante a ligação das extremidades cegas. As células ou os ratinhos são depois transfectadas utilizando um reagente de transfecção de lípidos.

Abstract

A fim de estimular eficazmente uma resposta imune inata, o DNA tem de ser de comprimento e pureza suficientes. Apresenta-se um método em que o ADN de cadeia dupla (dsDNA), que possui as características necessárias para estimular o ADN citoplasmática vias sensoriais pode ser gerada de forma barata e com facilidade. Pelo concatemerization de oligonucleótidos curtos, sintéticos (que não têm motivos CpG), dsDNA pode ser gerado para ser de comprimento suficiente para activar a via citosólica detecção de ADN. Este protocolo envolve a ligação de extremidades rombas de oligonucleótidos na presença de polietileno glicol (PEG), que proporciona um ambiente eficaz para a ligação ocorra. Os concatemeros dsDNA pode ser usado, após purificação por extracção com fenol / clorofórmio, para simular a resposta imune inata in vitro por protocolos de transfecção convencionais. Este ADN pode também ser utilizada para estimular a imunidade inata in vivo por injecção intradérmica no pavilhão auricular de um rato, por exemplo. Porpadronizar o processo concatemerization e os protocolos de estimulação posterior, uma activação fiável e reprodutível do sistema imune inato pode ser produzido.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

DNA é um componente vital de todos os organismos e células eucariontes, que manter em compartimentos específicos. Uma das funções do sistema imune inata é identificar quando tais compartimentalização quebra ou quando o material estranho é introduzido no organismo por meio de uma quebra de barreiras físicas externas. No corpo humano, há um certo número de proteínas que existem para ajudar a degradar pequenas quantidades de ADN, que pode escapar da compartimentação correcta; DNAse I, II, III e quebrar o DNA no plasma, endossoma, e citosol, respectivamente. No entanto, foi demonstrado que ratinhos que carecem de DNAse II morrem de anemia grave causada pela produção excessiva de uma interferões, sugerindo que o sistema imune inato responde ao ADN extra-nuclear. Esta resposta ocorre mesmo em ratinhos que são totalmente deficiente na capacidade de sinalização dos receptores do tipo Toll. Numerosos estudos têm mostrado agora que estimulador de genes interferon (STING) 2 e de ligação TANK quinase 1 (TBK1) 3 estão envolvidos na detecção de DNA no citoplasma e que esta via de sinalização activa o factor regulador de interferão (IRF) -3 4. A posterior transcrição dependente de IRF3 de citocinas, quimiocinas e genes interferon é característica de uma resposta imune inata, quer um patógeno ou perigo associado padrão molecular (PAMP ou DAMP) 5.

O desejo de estudar intracelulares nucleicos vias sensoriais ácido levou à necessidade de desenvolver métodos consistentes e reprodutíveis para estimulação das células através da introdução de DNA ou RNA em células sem activar outras respostas imunitárias inatas. Um método pelo qual o aguilhão / TBK1 / via IRF3 pode ser estimulado é através da utilização de lípidos catiónicos os reagentes de transfecção para entregar ácidos nucleicos para o citoplasma, onde pode ser acedido por meio de sensores de ADN, tais como ADN-PK, IFI16, e cgas 6-8.

As características de ADN que são correntemente considerados para permitir eficient activação da resposta imune inata citoplasmática sem estimulação de outras vias são o seu comprimento, de massa, pureza e falta de CpG motifs 4,7,9. Os oligonucleótidos sintéticos são altamente adequados para a finalidade de gerar uma resposta imune inata uma vez que permitem que a sequência de DNA a ser optimizado e preparado como uma espécie química pura. Um ADN (DSI) sequência de imuno-estimuladora 45 pares de bases foi identificado por Stetson et al. Quatro como sendo uma sequência adequada, CpG-livre para esse efeito. Esta seqüência dsDNA é outra forma aleatória e não tem características específicas para além de sua falta de motivos CpG. Verificou-se que o oligonucleótido por concatemerizing DSI em filamentos longos aumenta significativamente a magnitude da estimulação 7. Geração de ISD concatemerized é, portanto, útil para estimular uma resposta imune inata citoplasmática. Aqui apresenta-se os protocolos para a preparação deste reagente e como ela pode ser utilizada para activar a via de detecção de ADN emvitro, bem como in vivo.

NOTA: Todos os estudos em animais são realizados no âmbito de protocolos institucionais aprovados e orientações de cuidados de animais.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Concatemerization

  1. Ressuspender iniciadores Fw e Rv (ver Tabela de Materiais para as sequências de iniciadores) a uma concentração de 10 mg / mL em biologia molecular, grau de H 2 O. Em seguida, misturar 5 ul de Fw e 5 ul de iniciador Rv em um tubo de microcentrífuga de 1,5 ml.
  2. Mistura de iniciadores de recozimento por meio de aquecimento para a temperatura de emparelhamento correcto (75 ° C para os iniciadores aqui descritos) para 15 min. Deixar no banco para esfriar em temperatura ambiente (RT). Prepare o PEG8000 60% durante esta incubação por dissolução em ddH 2 O.
  3. Adicionar 50 ul de 60% ​​PEG8000 (para se conseguir uma concentração final de 30%), 10 ul de tampão 10x polinucleótido quinase (PNK), 27 ul de H2O e 3 mL de PNK para a mistura de iniciadores. Incubar a 37 ° C durante 2 horas.
  4. Arrefecer à temperatura ambiente e adicionar 11 mL de tampão DNA ligase. Em seguida, adicionar 3 L de ligase de ADN e incubar a 37 ° C durante a noite.

2. DNA Purificatione Análise

  1. Adicionar 300 ul de H2O para aumentar o volume da mistura de ligação. Nota: Vá em um exaustor, devido à toxicidade do fenol: clorofórmio vapor.
  2. Adicionar 1 volume (400 mL) de fenol: clorofórmio e misturar agitando vigorosamente.
  3. Centrifugar a uma velocidade máxima durante 1 min numa microcentrífuga de mesa. As camadas aquosa e de solvente vai separar com a camada aquosa no topo e uma camada de proteína precipitada branco entre as duas camadas.
  4. Transferir camada de topo para um novo tubo por pipetagem cuidadosa (evitar a transferência do meio, a camada de branco)
  5. Repita os passos 2.2 e 2.3, pelo menos, duas vezes ou até não haver qualquer proteína precipitada, após a centrifugação.
  6. Adicionar 1 volume (400 mL) de clorofórmio e repita os passos de 2,3-2,4.
  7. Adicionam-se 2 volumes (800 uL) de 100% de etanol previamente arrefecido e incuba-se a -20 ° C durante pelo menos 1 hora ou durante a noite. Nota: Esta etapa precipita as concatemeros DNA.
  8. Girar em velocidade máxima e aspirado supernatant. Lavar uma vez por adição de 1 ml de etanol a 70% e deixar secar ao ar no exaustor de fumos.
  9. Ressuspender o ADN em 50 ul de endotoxina livre ddH 2 O. Nota: O uso de reagentes de endotoxina livre é essencial para a geração de uma resposta imune inata específicos de ADN em células e in vivo.
  10. Retirar uma aliquota de 2 pi de DNA concatemerized para um novo tubo e adicionar 1 ml de tampão de carga do gel do ADN.
  11. Dissolver 1% de agarose em tampão TAE por aquecimento em potência máxima em um forno de microondas por 2 min (ou o tempo que é apropriado para o poder do forno e volume).
  12. Despeje em aparelho de vazamento de gel, adicionar 4 mL de corante fluorescente quelante de DNA, inserção de um pente, e deixar à temperatura ambiente durante aproximadamente 20 minutos para que o gel definido.
  13. Uma vez definida, retire o gel pente e lugar dentro do tanque de eletroforese contendo tampão TAE. Carga 3 l de marcadores de amostra ou tamanho DNA nos poços.
  14. Executar a electroforese em gel para 30-40 min a 90 V com uma corrente constante. Visualize o DNA sob luz ultra-violeta para observar concatemerization (Figura 1A).
  15. Medir a concentração de ADN no restante da amostra por espectroscopia de absorção de UV. Vazio do espectrómetro com o mesmo ddH2O que foi usada para ressuspender o ADN e medir o espectro de absorvância entre 200-300 nm. NOTA: concentração de DNA pode ser calculada utilizando a lei de Beer-Lambert, A = e * c * l, onde A é a absorbância, E o coeficiente de extinção, e l a distância do caminho da luz. Para a medição de concentrações de ADN da absorvância a 260 nm deve ser medido e um coeficiente de extinção de 0,027 (ng / mL) -1 cm -1 utilizado. A distância do trajecto da luz, l, vai variar dependendo do espectrofotómetro. Enquanto a medição da concentração, tome nota da relação de absorbância 260/280 nm como uma indicação de pureza de DNA; Recomenda-se um valor para este rácio acima de 2,00.

3. transfecção de dsDNA concatemeros Em Vitro

  1. Células semente em um prato de cultura ou placa de tecido a ser 70% confluente no momento da estimulação.
  2. Calcula-se a massa de ADN necessário para a estimulação das células, utilizando uma concentração final de 1-10 ug / ml. A massa necessária de DNA será notado por X abaixo. Por exemplo, se estimular as células num poço de uma placa de 6 poços, com 2 ml de meio a uma concentração de ADN de 5 ug / ml, em seguida, uma massa de 2 * 5 = 10 ug de DNA é necessária.
  3. Adicionar 50 ul * X de meio isento de soro para um tubo esterilizado de tamanho adequado. Pipetar cuidadosamente no centro do meio, sem tocar no lado do tubo, * 2 X ul de reagente de transfecção de lípido catiónico e de deixar durante 5 min.
  4. Adicionar X ug de ADN para o tubo e vortex brevemente. Deixar a temperatura ambiente durante pelo menos 20 min. Para transfecção in vitro, adicione essa mistura diretamente nas células para estimular citoplasmáticos vias sensoriais DNA.

4 Transfecção de dsDNA concatemeros In Vivo

  1. Preparar a mistura de transfecção, conforme descrito no 3,1-3,5 usando 1 mg de DNA, 2 mL de reagente de transfecção de lipídios e 18 mL meio sem soro por orelha de rato a ser estimulado. Prepare uma estéril de 20 mL Hamilton seringa, tampa com uma agulha estéril 30 G, e carregar com a mistura de transfecção de DNA.
  2. Anestesiar um C57BL / 6 mouse usando 1-2% de isoflurano. Confirme anestesia por perda de movimento e ritmo respiratório constante e pelo teste do reflexo pitada se necessário. Monitorar os olhos do animal durante a anestesia e usar pomada conforme necessário para evitar o ressecamento excessivo.
  3. Utilizando uma técnica asséptica, com cuidado para injectar o pavilhão auricular 10 ul da mistura de transfecção de modo a que um único "bolha" de líquido é formada entre as camadas dérmicas da orelha. Nota: Usar um dedal de borracha no seu polegar ou dedo indicador, esticar o ouvido sobre ele, e injectar a um ângulo agudo para assegurar que a agulha penetra apenas a primeira camada de pele do pavilhão auricular.
  4. Reintroduzirem mouse de volta para a jaula e monitorizar regularmente a recuperação pós-anestésica. Use uma lâmpada de aquecimento para evitar arrefecimento excessivo dos ratos anestesiados. Não deixe os ratos sem vigilância até que tenham recuperado a consciência suficiente para manter decúbito esternal.
  5. Flash congelar todo o pavilhão auricular num tubo de microcentrífuga por imersão em azoto líquido durante 2 min.

5 Processamento de amostras de DNA estimulada e Análise por PCR quantitativo (qPCR)

  1. A partir de cultura de células: médio aspirado com uma pipeta e descarte de resíduos.
  2. Adicionar 1 ml de PBS estéril. Repita 5.1 e 5.2 duas vezes e vá para o passo 5.3
  3. De tecido da orelha: moer tecido sob nitrogênio líquido usando pilão de cerâmica estéreis e argamassa, transferir tecido terreno para um tubo de microcentrífuga com uma espátula estéril, e avançar para o passo 5.4
  4. Adicionar 350 ul de tampão de lise e prosseguir com ARN comercial protocolo do kit de extracção. Eluir RNA de extracção purificação kitcoluna em 40 ul ddH 2 O. Nota: O kit de extração de RNA comercial (ver materiais / equipamentos de mesa) funciona muito bem; outras técnicas foram testadas com resultados abaixo da média.
  5. Quantificar RNA por espectroscopia de UV, como descrito acima para o ADN (secção 2.13). Nota: o coeficiente de extinção para o RNA é de 0,025 (ng / mL) -1 cm -1.
  6. Adicionar a um tubo estéril de PCR 1 ul de oligo (dT), 1 ul de 10 mM de dNTP mix, e 250 ug de ARN. Completar o volume para 11 mL com DDH estéril 2 O.
  7. Incubar durante 5 min a 65 ° C. Em seguida, adicionar 4 mL First Strand Buffer, 1 ul de 0,1 M ditiotreitol, 0,25 ul de transcriptase reversa e 1,75 ul ddH2O para o tubo. Incubar a 50 ° C durante 1 h seguido de 72 ° C durante 15 min. Opcionalmente, o produto de cDNA diluído 1: 5, utilizando DDQ 2 O.
  8. Para a PCR quantitativa cDNA uso 2 l, 2 l DDH 2 O, 5 jul qPCR mistura principal, e 1ul de 10 uM de cada um para a frente e para trás os estoques de iniciadores para amplificar o gene (s) de escolha. Misturar em uma placa de 96 poços e analisar usando uma máquina de PCR quantitativa (Figuras 1B e 1C).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Os resultados abaixo indicam que o DNA concatemerized pode ser gerado com relativa facilidade e é capaz de estimular uma resposta imune inata e robusto nas células em ratinhos. Com o uso de PEG8000, que pode ser claramente visto que o comprimento do ADN a ser gerado é significativamente mais longa e igualmente capazes de induzir a transcrição de CXCL10. Como se pode ver pela análise em gel de agarose, o concatemerization padrão tem comprimentos de ADN de mais de 800 pares de bases (pb), enquanto que para a amostra com PEG8000, o comprimento das cadeias de ADN inclui em excesso de 10.000 pb (Figura 1A). A transfecção destes DNAs em fibroblastos murinos embrionárias (MEFs) ou ratinhos induz a transcrição robusta de citocinas e quimiocinas, que pode ser medido por qPCR indicando estimulação da detecção imunológica inata ADN máquinas (Figuras 1B e 1C).

ad / 51593 / 51593fig1highres.jpg "/>
Figura 1. dados representativos, indicando a produção de concatemerized DSI ADN (conDNA) e estimulação de fibroblastos e murganhos. (A) Uma amostra de ADN concatemerized produzido com ou sem PEG8000 analisados ​​por electroforese em gel de agarose. (B) MEFs foram estimuladas com vários DNAs a 10 ug / ml e os níveis de CXCL10 e IL-6 mRNAs medido por qPCR 6 horas mais tarde. (C) Os ratinhos foram injectados no pavilhão auricular com conDNA e os níveis de CXCL10 e IL-6 mRNAs medido por qPCR 12 horas mais tarde. Os dados são mostrados como vezes de aumento relativamente ao nível de HPRT (RQ) e as barras de erro são +/- SEM (n = 3).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Os protocolos aqui descritos são utilizados para gerar dsDNA para estimular a resposta imune inata citosólica com resultados reprodutíveis em uma ampla gama de tipos de células e in vivo. Uma vez que o principal reagente de substrato utilizado é um oligonucleótido sintético, não há flexibilidade no presente sistema para a utilização de sequências de ADN alternativos ou modificações químicas. É possível, por exemplo, para substituir a cadeia de oligonucleótido descrito adiante neste protocolo com uma que contém um marcador fluorescente ou uma porção de biotina para acompanhar a localização ou avaliar as interacções com outras biomoléculas.

Uma das principais vantagens da concatemerization ADN é a produção de longas cadeias de dsDNA de forma que a sequência pode ser controlada. Não existe uma limitação que é aqui que o comprimento do ADN não pode ser monitorizado com precisão de modo que o produto desta reacção é sempre uma mistura de ADN de diferentes comprimentos (semelhante ao RNA poli análogo comercial (I: C)). Uma outra vantagem desta técnica é que ele permite a produção de grandes quantidades de massa de DNA de imuno-estimuladores (até valores mg). O passo concatemerization pode ser facilmente dimensionada para cima, conforme necessário, embora seja de notar que os passos de purificação subsequentes devem então ser realizado em alíquotas da escala descrita no protocolo.

Em comparação com outros métodos de concatemerizing ADN, a adição principal é a utilização de PEG8000 para a mistura de ligação para melhorar a eficiência da ligação. Note-se que PEG8000 pode ser difícil dissolver para fazer uma de 60% (w / v) de imagens, mas podem ser agitadas e suavemente aquecida para ajudar a solubilização. A ligação pode ser deixada a incubar durante períodos mais longos do que indicado, mas isto não parece afectar o comprimento do ADN a ser gerado. Algumas necessidades de cuidados também ser observado ao manusear fenol e clorofórmio como estes podem ser cancerígenos e corrosivo. Nas nossas mãos, os genes regulados positivamente por outros DNAs sintéticos, tais como poli (comercial (dA: DT)) são diferentes dos regulada pela ISD concatemerized. No entanto, outros não encontraram diferenças de 10, o que pode refletir a variação entre os tipos de células que está sendo analisado. Não obstante estes conflitos, DSI concatemerized é significativamente mais barato para gerar, quando em comparação com a compra de poli (dA: dT) a partir de uma fonte comercial e permite uma maior flexibilidade através da escolha de uma sequência e modificações.

Um dos aspectos da detecção de DNA que está sob estudado é a resposta in vivo à estimulação. Nós demonstramos que este protocolo pode ser utilizado para gerar o DNA adequado para experiências in vivo, 7. O produto dsDNA é puro e de concentração alta o suficiente para permitir a injeção em camundongos e mensuração subsequente dos processos de sinalização imune inata. No protocolo aqui descrito, deve ser tomado cuidado para garantir que a água utilizada para dissolver o sedimento de DNA final é a endotoxina, RNase e DNase. A injeção de DNA gratuito ou DNA-Complexos de lípido resulta numa resposta de interferão, como esperado de processos de detecção de ADN e, como tal, o ADN concatemerized pode ser utilizado para sondar o ADN de vários aspectos de detecção in vivo.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Os autores não têm confirmações.

Materials

Name Company Catalog Number Comments
Forward primer Integrated DNA Technologies n/a TACAGATCTACTAGTGATCTATGA CTGATCTGTACATGATCTACA
Reverse primer Integrated DNA Technologies n/a TGTAGATCATGTACAGATCAGT CATAGATCACTAGTAGATCTGTA
PEG8000 Sigma-Aldrich P-4463
Molecular biology grade water Sigma-Aldrich W4502-1L
T4 polynucleotide kinase Promega M4101
T4 DNA ligase Promega M1801
Phenol:chloroform Fisher Chemical BPE1752p-400
Chloroform Fisher Chemical C/4960/PB08
Ethanol Sigma-Aldrich 32221-2.5L
DNA gel loading buffer New England Biolabs B7021S
Agarose Bioline BIO-41025
Optimem Life Technologies 11058021
TransIT-LT1  Mirus Bioscience MIR 2300
Hamilton syringe Hamilton 80901 Model 1705
30 G needles  BD Bioscience 304000
SYBR Safe DNA gel stain Life Technologies S33102
Rneasy Plus Mini Kit Qiagen 74134
Oligo(dT) primer Thermo Scientific SO131
dNTP mix Fermentas R0192
Super Script III reverse transcriptase Life Technologies 56575
First strand cDNA synthesis buffer Life Technologies y02321
SybrGreen qPCR Fast master mix Applied Biosystems 4385612
cxcl10 murine forward primer  Integrated DNA Technologies n/a ACTGCATCCATATCGATGAC
cxcl10 murine reverse primer Integrated DNA Technologies n/a TTCATCGTGGCAATGATCTC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC

DOWNLOAD MATERIALS LIST

References

  1. Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. Nat. Immunol. 6, 49-56 (2005).
  2. Ishikawa, H., Ma, Z., Barber, G. N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature. 461, 788-792 (2009).
  3. Ishii, K. J., et al. TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature. 451, 725-729 (2008).
  4. Stetson, D. B., Medzhitov, R. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity. 24, 93-103 (2006).
  5. Pichlmair, A., Reise Sousa, C. Innate recognition of viruses. Immunity. 27, 370-383 (2007).
  6. Unterholzner, L., et al. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997-1004 (2010).
  7. Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. DNA-PK is a DNA sensor for IRF-3-dependent innate immunity. Elife. 1, e00047 (2012).
  8. Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 339, 786-791 (2013).
  9. Honda, K., Taniguchi, T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6, 644-658 (2006).
  10. Karayel, E., et al. The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature. Eur. J. Immunol. 39, 1929-1936 (2009).
Estimulação da Citoplasmáticas DNA Sensing Pathways<em&gt; In Vitro</em&gt; E<em&gt; In Vivo</em
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).More

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter