Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

La estimulación de citoplasmáticos de ADN Sensing Pathways doi: 10.3791/51593 Published: September 18, 2014

Summary

El objetivo del protocolo es utilizar métodos óptimos para estimular las vías de detección de ADN citoplasmáticos en células e in vivo. Esto se logra mediante la mejora de la generación de ADN de largo, de doble cadena durante la ligadura de extremos romos. Las células o ratones se transfectaron a continuación usando un reactivo de transfección de lípidos.

Abstract

Con el fin de estimular eficazmente una respuesta inmune innata, el ADN debe ser de longitud suficiente y pureza. Se presenta un método donde el ADN de doble cadena (dsDNA), que tiene las características necesarias para estimular el ADN citoplásmico vías sensoriales pueden generarse de forma barata y con facilidad. Por el concatemerization de oligonucleótidos cortos, sintéticos (que carecen de motivos CpG), dsDNA se puede generar a ser de longitud suficiente para activar el citosólica vía de detección de ADN. Este protocolo implica ligación de extremos romos de los oligonucleótidos en presencia de polietilenglicol (PEG), que proporciona un entorno eficaz para la ligadura que se produzca. Los concatemers dsDNA se pueden utilizar, después de la purificación por extracción con fenol / cloroformo, para simular la respuesta inmune innata in vitro por los protocolos de transfección estándar. Este ADN se puede utilizar también para estimular la inmunidad innata en vivo por inyección intradérmica en el pabellón de la oreja de un ratón, por ejemplo. Porestandarizar el proceso de concatemerization y los protocolos de estimulación posteriores, una activación fiable y reproducible del sistema inmune innato puede ser producido.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

El ADN es un componente vital de todos los organismos y las células eucariotas, que mantienen en compartimentos específicos. Una función del sistema inmune innato es identificar cuando tal compartimentación se rompe o cuando el material extraño se introduce en el organismo a través de un incumplimiento de las barreras físicas, externos. En el cuerpo humano hay una serie de proteínas que existen para ayudar a degradar pequeñas cantidades de ADN que puede escapar de la compartimentación correcta; DNAsa I, II, y III quiebro de ADN en el plasma, endosoma, y ​​el citosol, respectivamente. Sin embargo, se ha demostrado que los ratones que carecen de ADNasa II mueren a causa de la anemia grave causada por una producción excesiva de los interferones 1 que sugieren que el sistema inmune innato responde a ADN extra-nuclear. Esta respuesta se produce incluso en ratones que son completamente deficientes en la capacidad de señalización de los receptores Toll-like. Numerosos estudios han demostrado que la estimulación de genes de interferón (STING) 2 y vinculante TANK-quinasa 1 (TBK1) 3 están involucrados en la detección de ADN en el citoplasma y que esta vía de señalización activa el factor regulador de interferón (IRF) -3 4. La transcripción dependiente de IRF3 subsiguiente de citoquinas, quimioquinas, y los genes de interferón es característica de una respuesta inmune innata a ya sea un patógeno o peligro asociado patrón molecular (PAMP o DAMP) 5.

El deseo de estudiar las vías de detección de ácidos nucleicos intracelulares ha llevado a la necesidad de desarrollar métodos robustos y reproducibles para estimular las células mediante la introducción de ADN o ARN en las células sin activar otras respuestas inmunes innatas. Un método por el cual la picadura / TBK1 / vía IRF3 pueden ser estimulados es mediante el uso de lípidos catiónicos reactivos de transfección para entregar ácido nucleico en el citoplasma, donde se puede acceder por los sensores de ADN tales como ADN-PK, IFI16, y cgas 6-8.

Las características de ADN que se entienden actualmente para permitir effciente activación de la respuesta inmune innata citoplasmática sin estimulación de otras vías son de su longitud, la masa, la pureza, y la falta de motivos CpG 4,7,9. Los oligonucleótidos sintéticos son muy adecuados para el propósito de generar una respuesta inmune innata, ya que permiten la secuencia de ADN para ser optimizado y se preparó como una especie química pura. Un ADN (ISD) secuencia de inmuno-estimuladoras 45 pares de bases fue identificado por Stetson et al. 4 como una secuencia adecuada, CpG-libre para este propósito. Esta secuencia de ADN de doble cadena es de otra manera aleatoria y no tiene características específicas más allá de su falta de motivos CpG. Hemos encontrado que por concatemerizing el oligonucleótido ISD en hebras significativamente más largos aumenta la magnitud de la estimulación 7. Generación de ISD concatemerized tanto, es útil para estimular una respuesta inmune innata citoplasmática. Aquí presentamos los protocolos para la preparación de este reactivo y cómo se puede utilizar para activar la vía de detección de ADN envitro, así como in vivo.

NOTA: Todos los estudios con animales se realizan bajo protocolos institucionales aprobados y las directrices de cuidado de animales.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. concatemerization

  1. Cebadores Resuspender Fw y Rv (véase la Tabla de Materiales para las secuencias de primers) a una concentración de 10 mg / l en la biología molecular de grado H 2 O. Luego, mezclar 5 l de Fw y 5 l de imprimación Rv en un tubo de 1.5 ml.
  2. Mezcla de cebador recocido por calentamiento a la temperatura de recocido correcto (75 ° C para los cebadores descritos aquí) durante 15 min. Deja en el banco para que se enfríe a temperatura ambiente (TA). Prepare el PEG8000 60% durante esta incubación disolviendo en ddH 2 O.
  3. Añadir 50 l de 60% ​​PEG8000 (para lograr una concentración final de 30%), 10 l de 10x polinucleótido quinasa (PNK) tampón, 27 l de H 2 O, y 3 l de PNK a la mezcla de cebadores. Incubar a 37 ° C durante 2 horas.
  4. Enfriar a temperatura ambiente y añadir 11 l de tampón de ligasa de ADN. A continuación, añadir 3 U de ADN ligasa y se incuba a 37 ° C durante la noche.

2. DNA Purificationy análisis

  1. Añadir 300 l de H 2 O para aumentar el volumen de la mezcla de ligación. Nota: Proceda de una campana de extracción debido a la toxicidad del fenol: cloroformo vapor.
  2. Añadir 1 volumen (400 l) de fenol: cloroformo y mezclar agitando vigorosamente.
  3. Se centrifuga a velocidad máxima durante 1 min en una microcentrífuga de sobremesa. Las capas acuosas y de disolventes se separarán con la capa acuosa en la parte superior y una capa blanca de proteína precipitada entre las dos capas.
  4. Transferir la capa superior a un nuevo tubo mediante una cuidadosa pipeteado (evitar la transferencia de media, capa blanca)
  5. Repetir los pasos 2.2 y 2.3 al menos dos veces o hasta que no hay proteína precipitada después de la centrifugación.
  6. Añadir 1 volumen (400 l) de cloroformo y repita los pasos 2.3 a 2.4.
  7. Añadir 2 volúmenes (800 mu l) de etanol al 100% previamente enfriada y se incuba a 20 ° C durante al menos 1 hora o toda la noche. NOTA: este paso precipita los concatemers ADN.
  8. Centrifugar a máxima velocidad y supe aspiradornatant. Lavar una vez por la adición de 1 ml de etanol al 70% y dejar secar al aire en la campana de humos.
  9. ADN Resuspender en 50 l de ddH endotoxina libre 2 O. Nota: El uso de endotoxina libre de reactivos es crítico para la generación de una respuesta inmune innata-específica de ADN en las células e in vivo.
  10. Quitar una alícuota de 2 l de ADN concatemerized en un tubo nuevo y añadir 1 ml de tampón de carga en gel de ADN.
  11. Disolver 1% de agarosa en tampón TAE mediante calentamiento a plena potencia en un horno de microondas durante 2 min (o el tiempo que sea adecuada a la potencia del horno y el volumen).
  12. Vierta gel en aparato de colada, añadir 4 l de colorante fluorescente quelante ADN, inserte un peine, y dejar a temperatura ambiente durante aproximadamente 20 minutos para que el gel se fijó.
  13. Una vez establecido, quitar el gel de peine y el lugar en el tanque de electroforesis que contiene tampón TAE. Carga 3 l de la muestra de ADN o marcadores de tamaño en los pozos.
  14. Ejecutar electroforesis en gel durante 30-40 min a 90 V con corriente constante. Visualize el ADN bajo luz ultravioleta para observar concatemerization (Figura 1A).
  15. Medir la concentración de ADN en el resto de la muestra por espectroscopia de absorbancia de UV. En blanco con el espectrómetro de la misma ddH2O que se utilizó para resuspender el DNA y medir el espectro de absorbancia 200 a 300 nm. NOTA: la concentración de ADN se puede calcular usando la ley de Beer-Lambert, A = e * c * l, donde A es la absorbancia, e el coeficiente de extinción, y l la distancia de la trayectoria de la luz. Para la medición de las concentraciones de ADN de la absorbancia a 260 nm se debe medir y un coeficiente de extinción de 0,027 (mg / ml) -1 cm -1 utilizado. La distancia trayectoria de la luz, l, variará dependiendo del espectrofotómetro. Mientras que la medición de la concentración, tome nota de la relación de absorbancia 260/280 nm como una indicación de la pureza del ADN; Se recomienda un valor para este coeficiente por encima de 2.00.

3. transfección de ADN de doble cadena Concatemers En Vitro

  1. Se siembran las células en una placa de cultivo de tejido o placa a 70% de confluencia en el momento de la estimulación.
  2. Calcular la masa de ADN necesario para la estimulación de las células utilizando una concentración final de 1-10 mg / ml. La masa requerida de ADN se observará como X a continuación. Por ejemplo, si se requiere la estimulación de células en un solo pocillo de una placa de 6 pocillos con 2 ml de medio a una concentración de ADN de 5 g / ml a continuación, una masa de 2 * 5 = 10 g de ADN.
  3. Añadir 50 * X l de medio libre de suero en un tubo estéril de tamaño adecuado. Pipetear cuidadosamente en el centro del medio, sin tocar el lado del tubo, 2 * X l de reactivo de transfección lípido catiónico y se deja durante 5 min.
  4. Añadir X g de ADN para el tubo y agitar brevemente. Deja a temperatura ambiente durante al menos 20 min. Para la transfección in vitro añadir esta mezcla directamente a las células para estimular las vías de detección de ADN citoplasmáticos.

4. Transfección de ADN de doble cadena que Concatemersn Vivo

  1. Preparar la mezcla de transfección como se describe en 3.1 a 3.5 usando 1 g de ADN, 2 l de reactivo de transfección de lípidos, y 18 l de medio libre de suero por oído del ratón para ser estimulada. Preparar un estéril 20 l Hamilton jeringa, tapa con un 30 G aguja estéril, y cargar con la mezcla de transfección de ADN.
  2. Anestesiar a un ratón C57BL / 6 usando 1-2% de isoflurano. Confirme la anestesia por la pérdida de movimiento y el ritmo respiratorio constante y por la prueba de reflejo del pellizco si es necesario. Monitorear los ojos de los animales durante la anestesia y usar ungüento según sea necesario para evitar la sequedad excesiva.
  3. Utilizando una técnica estéril, inyectar con cuidado en el pabellón de la oreja 10 l de la mezcla de transfección de manera que se forma una única "burbuja" de líquido entre las capas dérmicas de la oreja. Nota: Use un dedal de goma en el pulgar o el dedo índice, estire el oído sobre ella, e inyectar en un ángulo agudo para asegurar la aguja penetra sólo la primera capa de la piel del pabellón de la oreja.
  4. Reintroducir ratón en la jaula y regularmente monitorear la recuperación post-anestésica. Utilice una lámpara de calentamiento para evitar el enfriamiento excesivo de los ratones anestesiados. No deje sin vigilancia los ratones hasta que hayan recuperado el conocimiento suficiente para mantener decúbito esternal.
  5. Flash congelar todo el pabellón de la oreja en un tubo de microcentrífuga por inmersión en nitrógeno líquido durante 2 min.

5. Procesamiento de Muestras de ADN estimulada y análisis por PCR cuantitativa (qPCR)

  1. Desde el cultivo de células: medio aspirado con una pipeta y desechar los residuos.
  2. Añadir 1 ml de PBS estéril. Repita 5.1 y 5.2 dos veces y vaya al paso 5.3
  3. De tejido de la oreja: moler el tejido en nitrógeno líquido usando una maja de cerámica estériles y mortero, transferir tejido tierra a un tubo de microcentrífuga con una espátula estéril, y vaya al paso 5.4
  4. Añadir 350 l de tampón de lisis y proceder con el protocolo de kit de extracción de ARN comercial. Eluir el ARN de purificación kit de extraccióncolumna de 40 l ddH 2 O. Nota: El kit de extracción de RNA comercial (ver materiales / equipos de mesa) funciona muy bien; otras técnicas han sido probadas con resultados mediocres.
  5. Cuantificar ARN mediante espectroscopia UV como se describe para ADN anterior (sección 2.13). Nota: el coeficiente de extinción para el ARN es de 0,025 (g / ml) -1 cm -1.
  6. Añadir a una estéril PCR tubo de 1 l de oligo (dT), 1 l de 10 mM dNTP mix, y 250 mg de ARN. Completar el volumen a 11 l con ddH estéril 2 O.
  7. Incubar durante 5 min a 65 ° C. A continuación, añadir 4 l First Strand Buffer, 1 l 0,1 M ditiotreitol, 0,25 l de transcriptasa inversa y 1,75 l de ddH2O al tubo. Incubar a 50 ° C durante 1 hora seguido de 72 ° C durante 15 min. Opcionalmente, diluir cDNA producto 1: 5 usando ddH 2 O.
  8. Por PCR cuantitativa cDNA uso 2 l, 2 l ddH 2 O, 5 l mezcla maestra qPCR, y 1l cada una de 10 uM de avance y retroceso poblaciones de cebadores para amplificar el gen (s) de elección. Mezclar en una placa de 96 pocillos y analizar usando una máquina de PCR cuantitativa (Figuras 1B y 1C).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Los resultados a continuación indican que el ADN concatemerized se puede generar con relativa facilidad y es capaz de estimular una respuesta inmune innata robusta en las células y en ratones. Con el uso de PEG8000, se puede ver claramente que la longitud del ADN que se genera es significativamente más larga e igualmente capaz de inducir la transcripción de CXCL10. Como se observa mediante análisis en gel de agarosa, la concatemerization estándar tiene longitudes de ADN de hasta 800 pares de bases (pb), mientras que para la muestra con PEG8000, la longitud del ADN incluye hebras en exceso de 10.000 pb (Figura 1A). La transfección de estos ADN en fibroblastos murinos embrionarios (MEFs) o ratones induce una transcripción robusta de citocinas y quimiocinas que puede ser medido por qPCR indicando la estimulación del ADN inmune innata maquinaria de detección (Figuras 1B y 1C).

ad / 51593 / 51593fig1highres.jpg "/>
Figura 1. Los datos representativos que indican la producción de ADN ISD concatemerized (conDNA) y la estimulación de los fibroblastos y ratones. (A) una muestra de ADN concatemerized producidos ya sea con o sin PEG8000 se analizaron por electroforesis en gel de agarosa. (B) MEFs fueron estimuladas con diferentes ADNs a 10 mg / ml y los niveles de CXCL10 y la IL-6 mRNAs medidos por qPCR 6 horas más tarde. (C) los ratones fueron inyectados en el pabellón auricular con conDNA y los niveles de CXCL10 y la IL-6 mRNAs medido por qPCR 12 horas más tarde. Los datos se muestran como pliegue aumento relativo al nivel de HPRT (RQ) y las barras de error son +/- SEM (n = 3).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Los protocolos descritos aquí se utilizan para generar ADN de doble cadena para estimular la respuesta inmune innata citosólica con resultados reproducibles en una amplia gama de tipos de células e in vivo. Dado que el principal reactivo sustrato utilizado es un oligonucleótido sintético, hay flexibilidad en este sistema para el uso de secuencias de ADN alternativas o modificaciones químicas. Es posible, por ejemplo, para reemplazar el oligonucleótido cadena directa descrito en este protocolo con uno que contiene un marcador fluorescente o un resto de biotina para rastrear la localización o evaluar las interacciones con otras biomoléculas.

Una de las principales ventajas de concatemerization ADN es la producción de largas hebras de ADN de doble cadena de manera que la secuencia puede ser controlada. Hay una limitación aquí, que es que la longitud del ADN no se puede controlar precisamente lo que el producto de esta reacción es siempre una mezcla de ADN de diferentes longitudes (similar a la poli análogo de ARN comercial (I: C)). Otra ventaja de esta técnica es que permite la producción de grandes cantidades masivas de ADN inmuno-estimuladoras (hasta cantidades mg). El paso concatemerization se puede escalar fácilmente según se requiera, aunque debe tenerse en cuenta que las etapas de purificación posteriores a continuación, deben llevarse a cabo en alícuotas de la escala se describe en el protocolo.

En comparación con otros métodos de concatemerizing ADN, la adición principal es el uso de PEG8000 a la mezcla de ligadura para mejorar la eficiencia de ligación. Tenga en cuenta que PEG8000 puede ser difícil de disolver para hacer un 60% (w / v) stock pero puede ser vórtex y se calienta suavemente para ayudar a la solubilización. La ligación se puede dejar incubar durante períodos más largos que se indica, pero esto no parece afectar a la longitud del ADN que se genera. Algunas necesidades de atención también se observan al manipular fenol y cloroformo, ya que pueden ser cancerígenos y corrosivo. En nuestras manos los genes regulados por incremento por otros ADN sintéticos (tales como poli comercial (dA: DT)) son diferentes de los upregulated por ISD concatemerized. Sin embargo, otros no han encontrado tales diferencias de 10, lo que puede reflejar la variación entre los tipos de células que se analiza. A pesar de tales conflictos, la DSI concatemerized es significativamente más barato generar cuando se compara con la compra de poli (dA: dT) a partir de una fuente comercial y permite mayor flexibilidad a través de elección de la secuencia y modificaciones.

Un aspecto de detección de ADN que es bajo-estudiado es la respuesta a la estimulación in vivo. Hemos demostrado que este protocolo se puede utilizar para generar ADN adecuado para experimentos in vivo 7. El producto dsDNA es puro y de alta concentración suficiente para permitir la inyección en ratones y posterior medición de procesos de señalización inmune innata. En el protocolo descrito aquí, se debe tener cuidado para asegurar el agua utilizada para disolver el sedimento de ADN final es la endotoxina, RNasa, DNasa y libre. La inyección de ADN o ADN libreLos complejos lipídicos resultados en una respuesta de interferón como se esperaba de los procesos de detección de ADN y, como tal, el ADN concatemerized se pueden utilizar para sondear múltiples aspectos de la detección de ADN in vivo.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Los autores no tienen reconocimientos.

Materials

Name Company Catalog Number Comments
Forward primer Integrated DNA Technologies n/a TACAGATCTACTAGTGATCTATGA CTGATCTGTACATGATCTACA
Reverse primer Integrated DNA Technologies n/a TGTAGATCATGTACAGATCAGT CATAGATCACTAGTAGATCTGTA
PEG8000 Sigma-Aldrich P-4463
Molecular biology grade water Sigma-Aldrich W4502-1L
T4 polynucleotide kinase Promega M4101
T4 DNA ligase Promega M1801
Phenol:chloroform Fisher Chemical BPE1752p-400
Chloroform Fisher Chemical C/4960/PB08
Ethanol Sigma-Aldrich 32221-2.5L
DNA gel loading buffer New England Biolabs B7021S
Agarose Bioline BIO-41025
Optimem Life Technologies 11058021
TransIT-LT1  Mirus Bioscience MIR 2300
Hamilton syringe Hamilton 80901 Model 1705
30 G needles  BD Bioscience 304000
SYBR Safe DNA gel stain Life Technologies S33102
Rneasy Plus Mini Kit Qiagen 74134
Oligo(dT) primer Thermo Scientific SO131
dNTP mix Fermentas R0192
Super Script III reverse transcriptase Life Technologies 56575
First strand cDNA synthesis buffer Life Technologies y02321
SybrGreen qPCR Fast master mix Applied Biosystems 4385612
cxcl10 murine forward primer  Integrated DNA Technologies n/a ACTGCATCCATATCGATGAC
cxcl10 murine reverse primer Integrated DNA Technologies n/a TTCATCGTGGCAATGATCTC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC

DOWNLOAD MATERIALS LIST

References

  1. Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. Nat. Immunol. 6, 49-56 (2005).
  2. Ishikawa, H., Ma, Z., Barber, G. N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature. 461, 788-792 (2009).
  3. Ishii, K. J., et al. TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature. 451, 725-729 (2008).
  4. Stetson, D. B., Medzhitov, R. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity. 24, 93-103 (2006).
  5. Pichlmair, A., Reise Sousa, C. Innate recognition of viruses. Immunity. 27, 370-383 (2007).
  6. Unterholzner, L., et al. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997-1004 (2010).
  7. Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. DNA-PK is a DNA sensor for IRF-3-dependent innate immunity. Elife. 1, e00047 (2012).
  8. Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 339, 786-791 (2013).
  9. Honda, K., Taniguchi, T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6, 644-658 (2006).
  10. Karayel, E., et al. The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature. Eur. J. Immunol. 39, 1929-1936 (2009).
La estimulación de citoplasmáticos de ADN Sensing Pathways<em&gt; In Vitro</em&gt; Y<em&gt; En Vivo</em
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).More

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter