Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Stimulering av Cytoplasmatiska DNA Sensing Pathways doi: 10.3791/51593 Published: September 18, 2014

Summary

Syftet med protokollet är att använda optimala metoder för att stimulera de cytoplasmiska DNA kännande vägar i celler och in vivo. Detta uppnås genom att förbättra alstringen av långa, dubbelsträngade DNA under trubbig ände-ligering. Celler eller möss transfekteras sedan med användning av en lipid transfektion reagens.

Abstract

För att effektivt stimulera ett inneboende immunsvar, måste DNA vara av tillräcklig längd och renhet. Vi presenterar en metod där dubbelsträngat DNA (dsDNA), som har de egenskaper som krävs för att stimulera cytoplasma DNA kännande vägar kan genereras billigt och enkelt. Förre concatemerization av korta, syntetiska oligonukleotider (vilka saknar CpG-motiv) kan dsDNA genereras för att ha tillräcklig längd för att aktivera den cytosoliska DNA avkänning vägen. Detta protokoll involverar trubbig ände-ligering av oligonukleotiderna i närvaro av polyetylenglykol (PEG), som tillhandahåller en miljö för effektiv ligering skall ske. De dsDNA konkatemerer kan användas, efter rening genom fenol / kloroform-extraktion, för att simulera det medfödda immunsvar in vitro genom vanliga transfektions-protokoll. Detta DNA kan också användas för att stimulera det medfödda immunförsvaret in vivo genom intradermal injektion i ytterörat hos en mus, till exempel. Genomstandardisera concatemerization processen och de efterföljande stimuleringsprotokoll, kan produceras en tillförlitlig och reproducerbar aktivering av det medfödda immunsystemet.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

DNA är en viktig komponent i alla organismer och celler, vilka eukaryoter hålla i särskilda fack. En funktion av det medfödda immunförsvaret är att identifiera när en sådan uppdelning går sönder eller när främmande material införs i organismen via en överträdelse av fysiska, yttre hinder. I människokroppen finns det ett antal proteiner som finns för att hjälpa bryta ned små mängder DNA som kan komma rätt uppdelning; DNAs I, II och III bryta ned DNA i plasma, endosomen, och cytosol, respektive. Det har dock visat sig att möss som saknar DNAse II dör av svår blodbrist som orsakas av överproduktion av interferoner 1 tyder på att det medfödda immunförsvaret reagerar på extra-nukleärt DNA. Detta inträffar även hos möss som är helt saknar toll-liknande kapacitet receptorsignalering. Ett stort antal studier har nu visat att stimulator av interferongener (STING) 2 och TANK-bindande kinas 1 (TBK1) 3 är involverade vid detektering av DNA i cytoplasman och att denna signalväg aktiverar interferonreglerande faktor (IRF) -3 4. Den efterföljande IRF3 beroende transkription av cytokin, kemokin och interferongener är kännetecknande för en medfödd immunsvar mot antingen en patogen eller fara molekylära mönster (PAMP eller DAMP) 5.

Viljan att studera intracellulära nukleinsyra kännande vägar har lett till krav på att utveckla robusta och reproducerbara metoder för att stimulera celler genom att införa DNA eller RNA i celler utan att aktivera andra medfödda immunsvar. En metod som STING / TBK1 / IRF3 vägen kan stimuleras är att använda katjoniska lipid transfektionsreagens att leverera nukleinsyra i cytoplasman där den kan nås av DNA-sensorer såsom DNA-PK, IFI16 och cgas 6-8.

Egenskaperna hos DNA, som för närvarande förstås att medge efficient aktivering av cytoplasma medfödda immunsvar utan stimulering av andra vägar är dess längd, vikt, renhet och avsaknad av CpG-motiv 4,7,9. Syntetiska oligonukleotider är mycket lämpliga i syfte att alstra en medfödd immunsvar som de tillåter den DNA-sekvens, som skall optimeras och framställd som en ren kemisk art. En 45 baspar immuno-stimulatoriska DNA (ISD) sekvensen identifierades genom Stetson et al. Fyra som en lämplig, CpG-fri sekvens för detta syfte. Denna dsDNA sekvens är annars slumpmässig och har inga särskilda egenskaper utöver sin brist på CpG-motiv. Vi har funnit att genom concatemerizing ISD oligonukleotiden i signifikant längre strängarna ökar magnituden av stimuleringen 7. Generering av concatemerized ISD är därför användbart för att stimulera en cytoplasmatisk medfödda immunsvar. Här presenterar vi protokoll för att förbereda detta reagens och hur den kan användas för att aktivera DNA avkänning vägenvitro såväl som in vivo.

OBS: Alla djurförsök utförs under godkända institutionella protokoll och riktlinjer djurvårds.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Concatemerization

  1. Resuspendera primers Fw och Rv (se tabell i Material primersekvenser) till en koncentration av 10 mikrogram / ​​l inom molekylärbiologi klass H 2 O. Därefter blandas 5 pl av Fw och 5 pl av Rv-primer i ett 1,5 ml mikrocentrifugrör.
  2. Anneal primer mix genom uppvärmning till rätt hybridiseringstemperatur (75 ° C för de primrar som beskrivs här), för 15 min. Låt på bänken svalna i rumstemperatur (RT). Förbered 60% PEG8000 under denna inkubation genom upplösning i DDH 2 O.
  3. Lägg 50 pl av 60% PEG8000 (för att uppnå en slutlig koncentration av 30%), 10 ul av 10x polynukleotidkinas (PNK) buffert, 27 ^ il H2O, och 3 | il av PNK till tändämnesblandningen. Inkubera vid 37 ° C under 2 tim.
  4. Kyl ner vid RT och tillsätt 11 l av DNA-ligas buffert. Sedan till 3 U av DNA-ligas och inkubera vid 37 ° C över natten.

2. DNA Purificationoch analys

  1. Lägg 300 | il av H2O för att öka volymen av ligeringsblandningen. Notera: Gå vidare i ett dragskåp på grund av toxicitet av fenol: kloroform ånga.
  2. Tillsätt 1 volym (400 l) av fenol: kloroform och blanda genom att skaka kraftigt.
  3. Centrifugera vid max hastighet under 1 min i en bordsskiva mikrocentrifug. De vattenhaltiga och lösningsmedelsskikten separerar med den vattenhaltiga skikt ovanpå och ett vitt skikt av utfällt protein mellan de två skikten.
  4. Överför toppskiktet till ett nytt rör genom försiktig pipettering (undvika att överföra mitten, vitt skikt)
  5. Upprepa steg 2,2 och 2,3 åtminstone två gånger eller tills det inte finns någon utfällda proteinet efter centrifugering.
  6. Tillsätt 1 volym (400 l) av kloroform och upprepa steg 2,3-2,4.
  7. Lägg 2 volymer (800 | il) av 100% förkyld etanol och inkubera vid -20 ° C under minst 1 h eller över natten. OBS: detta steg fäller DNA konkatemerer.
  8. Spinn ner vid max hastighet och aspirera supernatant. Tvätta en gång genom att tillsätta 1 ml av 70% etanol och låt lufttorka i dragskåp.
  9. Resuspendera DNA i 50 fil endotoxin gratis DDH 2 O. Anmärkning: Användning av endotoxin fritt reagens är kritisk för att generera ett DNA-specifikt medfödda immunsvar i celler och in vivo.
  10. Ta en 2 pl alikvot av concatemerized DNA i ett nytt rör och tillsätt 1 ml DNA gelladdningsbuffert.
  11. Lös upp 1% agaros i TAE buffert genom uppvärmning på full effekt i mikrovågsugn i 2 min (eller tid som är lämpligt att kraften i ugnen och volym).
  12. Häll gelen i gjutningsapparat, tillsätt 4 l av fluorescerande DNA kelatbildande färgämne, sätt in en kam, och låt stå i rumstemperatur i ca 20 min för gelen att ställa in.
  13. När set, ta bort kammen och placera gelen i elektrofores tank innehållande TAE buffert. Load 3 l av DNA-prov eller storleksmarkörer i brunnar.
  14. Kör gelelektrofores under 30-40 minuter vid 90 V med konstant ström. Visualize DNA under ultraviolett ljus för att observera concatemerization (Figur 1A).
  15. Mät DNA-koncentrationen i återstoden av provet genom UV-absorbans-spektroskopi. Blank spektrometern med samma DDH 2 O som användes för att resuspendera DNA och mät absorbansspektrum 200-300 nm. OBS: DNA-koncentration kan beräknas med hjälp av Lambert-Beers lag, A = e * c * l, där A är absorbansen, e extinktionskoefficienten och l avståndet strålgången. För mätning av DNA-koncentrationer av absorbansen vid 260 nm bör mätas och en extinktionskoefficient på 0,027 (ig / ml) -1 cm -1 användas. Den Ijusväg avstånd, L, kommer att variera beroende på spektrofotometer. Medan mätning av koncentrationen, ta del av den 260/280 nm absorbansförhållandet som en indikation på DNA renhet; ett värde för detta förhållande på över 2,00 rekommenderas.

3 Transfektion av dsDNA konkatemerer i ViTro

  1. Seed celler i en vävnadsodlingsskål eller platta för att vara 70% sammanflytande vid tiden för stimulering.
  2. Beräkna massan av DNA som krävs för stimulering av celler med användning av en slutkoncentration av 1-10 pg / ml. Den erforderliga massan av DNA kommer att noteras som X nedan. Till exempel om att stimulera celler i en enda brunn i en 6-brunnars platta med 2 ml medium vid en koncentration av DNA från 5 ^ g / ml då en massa av 2 * 5 = 10 ^ g DNA krävs.
  3. Lägg 50 * X il av serumfritt medium i en lämplig storlek sterilt rör. Pipettera försiktigt i mitten av mediet, utan att röra vid sidan av röret, 2 * X pl katjonisk lipid transfektionsreagens och låt stå i 5 minuter.
  4. Lägg till X ng DNA att kort röret och skaka. Lämna vid RT under åtminstone 20 min. För in vitro transfektion lägga denna blandning direkt till celler för att stimulera cytoplasmiska DNA kännande vägar.

4. Transfektion av dsDNA konkatemerer jagn Vivo

  1. Förbered transfektion blandning såsom beskrivits i 3,1-3,5 med användning av 1 | ig DNA, 2 | il lipid transfektion reagens, och 18 pl serumfritt medium per mus öra som skall stimuleras. Förbered en steril 20 ^ Hamilton spruta, keps med en steril 30 G nål och ladda med DNA transfektion mix.
  2. Bedöva en C57BL / 6 musen med 1-2% isofluran. Bekräfta anestesi av förlust av rörelse och konstant andningsfrekvens och nypa reflex test om det behövs. Övervaka djurets ögon under anestesi och använda salva som krävs för att undvika överdriven torrhet.
  3. Med användning av steril teknik, injicera varsamt in i ytterörat 10 ul av transfektion mixen så att en enda "bubbla" av vätska bildas i mellan de dermala skikten av örat. OBS: Använd en gummifingerborg på tummen eller pekfingret, sträcka örat över det, och injicera i en spetsig vinkel för att säkerställa att nålen tränger bara det första lagret av huden på ytterörat.
  4. Reinducera musen tillbaka in i buren och regelbundet övervaka efter anestesi återhämtning. Använd en värmelampa för att undvika överdriven kylning av sövda möss. Lämna inte möss utan uppsikt tills de har återfått tillräcklig medvetenhet för att upprätthålla sternala VILA.
  5. Flash frysa hela ytterörat i ett mikrocentrifugrör genom nedsänkning i flytande kväve under 2 min.

5. Behandling av DNA stimulerade prover och analys av kvantitativ PCR (qPCR)

  1. Från cellodling: aspirera medium med en pipett och kassera avfall.
  2. Tillsätt 1 ml steril PBS. Upprepa 5.1 och 5.2 två gånger och gå vidare till steg 5.3
  3. Från öronvävnad: slipa vävnad under flytande kväve med sterila keramiska mortel, överföra marken vävnad till ett mikrocentrifugrör med en steril spatel, och gå vidare till steg 5,4
  4. Lägg 350 l lysbuffert och fortsätta med kommersiella RNA-extraktion kit-protokollet. Eluera RNA från extraktion kit reningkolumn i 40 l DDH 2 O. Obs: Den kommersiella RNA-extraktion kit (se material / utrustning tabell) fungerar mycket bra; andra tekniker har testats med subpar resultat.
  5. Kvantifiera RNA genom UV-spektroskopi som beskrivits för DNA ovan (avsnitt 2.13). Anm: extinktionskoefficienten för RNA är 0,025 (ig / ml) -1 cm -1.
  6. Lägg till ett sterilt PCR-rör 1 pl av oligo (dT)-primer, 1 pl av 10 mM dNTP-blandning, och 250 | ig RNA. Fyll med vatten till 11 l med sterilt DDH 2 O.
  7. Inkubera i 5 minuter vid 65 ° C. Lägg sedan till 4 l First Strand buffert, 1 l 0,1 M ditiotreitol, 0,25 l omvänt transkriptas och 1,75 l DDH 2 O till röret. Inkubera vid 50 ° C under en timme följt av 72 ° C under 15 min. Eventuellt späd cDNA produkt 1: 5 med hjälp av DDH 2 O.
  8. För kvantitativ PCR användning 2 pl cDNA, 2 pl DDH 2 O, 5 pl qPCR Master Mix och 1il vardera av 10 iM framåt och bakåt primer lager för att förstärka gen (er) i valet. Blanda i en 96-brunnars platta och analysera med användning av en kvantitativ PCR-maskin (figurerna 1B och 1C).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Resultaten nedan indikerar att concatemerized DNA kan genereras med relativ lätthet och är i stånd att stimulera en robust medfödda immunsvar i celler och i möss. Med användning av PEG8000, kan det tydligt ses att längden av DNA som genereras är betydligt längre och lika med förmåga att inducera transkription av Cxcl10. Såsom framgår med agarosgelanalys, har standarden concatemerization längder av DNA av upp till 800 baspar (bp), medan för provet med PEG8000, längden av DNA innefattar strängarna överstigande 10.000 bp (Figur 1A). Transfektion av dessa DNA i murina embryonala fibroblaster (MEF) eller möss inducerar en robust transkription av cytokiner och kemokiner som kan mätas med qPCR indikerar stimulering av det medfödda immun DNA avkänning maskiner (figur 1B och 1C).

ad / 51593 / 51593fig1highres.jpg "/>
Figur 1. Representativa data som indikerar att produktionen av concatemerized ISD-DNA (conDNA) och stimulering av fibroblaster och möss. (A) Ett prov av concatemerized DNA produceras antingen med eller utan PEG8000 analyseras med agarosgelelektrofores. (B) MEFs stimulerades med olika DNA: er vid 10 | ig / ml och nivåerna av CXCL10 och IL-6-mRNA mättes genom qPCR 6 h senare. (C) Möss injicerades i örat pinnae med conDNA och nivåerna av CXCL10 och IL-6-mRNA mättes genom qPCR 12 h senare. Data visas som-faldig ökning i förhållande till den nivå av HPRT (RQ) och felstaplar är +/- SEM (n = 3).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De protokoll som beskrivs här används för att generera dsDNA att stimulera cytosoliskt medfödda immunsvar med reproducerbara resultat i en rad olika celltyper och in vivo. Eftersom huvud substratreagenset som används är en syntetisk oligonukleotid, det finns flexibilitet i detta system för att använda alternativa DNA-sekvenser eller kemiska modifieringar. Det är möjligt, till exempel, för att ersätta den främre strängen oligonukleotiden beskrivs i detta protokoll med en som innehåller en fluorescerande etikett eller biotindel att spåra lokalisering eller bedöma interaktioner med andra biomolekyler.

En av de främsta fördelarna med DNA concatemerization är produktion av långa strängar av dsDNA i ett sätt att sekvensen kan kontrolleras. Det finns en begränsning här som är att DNA-längden icke kan exakt övervakas så att produkten av denna reaktion är alltid en blandning av DNA av olika längder (liknande den kommersiella RNA-analog poly (I: C)). En annan fördel med denna teknik är att den möjliggör framställning av stora massa mängder av immuno-stimulatoriska DNA (upp till mg belopp). Det concatemerization steget kan skalas upp lätt efter behov, även om det bör noteras att efterföljande reningssteg så ska genomföras i portioner av skalan beskrivs i protokollet.

Jämfört med andra metoder för concatemerizing DNA, är den viktigaste tillsats användning av PEG8000 till ligeringsblandningen för att förbättra ligering effektivitet. Observera att PEG8000 kan vara svåra att lösa upp för att göra en 60% (vikt / volym) lager men kan virvlades och försiktigt värmas för att hjälpa solubilisering. Ligeringen kan lämnas att inkubera i längre perioder än anges, men detta tycks inte påverka längden på DNA genereras. Vissa vårdbehov också iakttas vid hantering av fenol och kloroform som dessa kan vara cancerframkallande och frätande. I våra händer generna uppregleras av andra syntetiska DNA (t.ex. kommersiell poly (dA: DT)) skiljer sig från de som uppregleras av concatemerized ISD. Men andra har inte funnit sådana skillnader 10, vilket kan reflektera variation mellan celltyper som analyseras. Trots sådana konflikter är concatemerized ISD betydligt billigare att generera jämfört med att köpa poly (dA: dT) från en kommersiell källa och ger större flexibilitet genom val av sekvens och modifieringar.

En aspekt av DNA avkänning som är under studerad är svaret in vivo på stimulering. Vi har visat att detta protokoll kan användas för att generera DNA lämplig för in vivo experiment 7. Den dsDNA produkten är ren och av tillräckligt hög koncentration för att medge injektion i möss med påföljande mätning av medfödda immunsignaleringsprocesser. I det protokoll som beskrivs här, måste man för att se till det vatten som används för att lösa upp den slutliga DNA-tabletten är endotoxin, RNas och DNas gratis. Injektion av fria DNA eller DNA-lipidkomplex resulterar i en interferonsvar som förväntat av DNA avkännande processer och, som sådan, kan den concatemerized DNA användas för att sondera ett flertal aspekter av DNA-avkänning in vivo.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Författarna har inga bekräftelser.

Materials

Name Company Catalog Number Comments
Forward primer Integrated DNA Technologies n/a TACAGATCTACTAGTGATCTATGA CTGATCTGTACATGATCTACA
Reverse primer Integrated DNA Technologies n/a TGTAGATCATGTACAGATCAGT CATAGATCACTAGTAGATCTGTA
PEG8000 Sigma-Aldrich P-4463
Molecular biology grade water Sigma-Aldrich W4502-1L
T4 polynucleotide kinase Promega M4101
T4 DNA ligase Promega M1801
Phenol:chloroform Fisher Chemical BPE1752p-400
Chloroform Fisher Chemical C/4960/PB08
Ethanol Sigma-Aldrich 32221-2.5L
DNA gel loading buffer New England Biolabs B7021S
Agarose Bioline BIO-41025
Optimem Life Technologies 11058021
TransIT-LT1  Mirus Bioscience MIR 2300
Hamilton syringe Hamilton 80901 Model 1705
30 G needles  BD Bioscience 304000
SYBR Safe DNA gel stain Life Technologies S33102
Rneasy Plus Mini Kit Qiagen 74134
Oligo(dT) primer Thermo Scientific SO131
dNTP mix Fermentas R0192
Super Script III reverse transcriptase Life Technologies 56575
First strand cDNA synthesis buffer Life Technologies y02321
SybrGreen qPCR Fast master mix Applied Biosystems 4385612
cxcl10 murine forward primer  Integrated DNA Technologies n/a ACTGCATCCATATCGATGAC
cxcl10 murine reverse primer Integrated DNA Technologies n/a TTCATCGTGGCAATGATCTC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC

DOWNLOAD MATERIALS LIST

References

  1. Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. Nat. Immunol. 6, 49-56 (2005).
  2. Ishikawa, H., Ma, Z., Barber, G. N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature. 461, 788-792 (2009).
  3. Ishii, K. J., et al. TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature. 451, 725-729 (2008).
  4. Stetson, D. B., Medzhitov, R. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity. 24, 93-103 (2006).
  5. Pichlmair, A., Reise Sousa, C. Innate recognition of viruses. Immunity. 27, 370-383 (2007).
  6. Unterholzner, L., et al. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997-1004 (2010).
  7. Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. DNA-PK is a DNA sensor for IRF-3-dependent innate immunity. Elife. 1, e00047 (2012).
  8. Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 339, 786-791 (2013).
  9. Honda, K., Taniguchi, T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6, 644-658 (2006).
  10. Karayel, E., et al. The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature. Eur. J. Immunol. 39, 1929-1936 (2009).
Stimulering av Cytoplasmatiska DNA Sensing Pathways<em&gt; In Vitro</em&gt; Och<em&gt; In Vivo</em
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).More

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter