Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Tripanozomlann RNA Düzenleme karşı ilaçlar Tarama için bir Muhabiri olarak RNA Catalyst

Published: July 22, 2014 doi: 10.3791/51712
* These authors contributed equally

Abstract

Önemli bir ilerleme trypanosom mitokondriyal RNA düzenleme mekanizmasını belirleyen yapılmıştır. Benzer bir şekilde, önemli bir ilerleme RNA düzenlemeyi katalize editosome kompleksin bileşenleri tespit yapılmıştır. Ancak, bu proteinlerin nasıl birlikte çalıştığını hala net değildir. Editosome karşı yüksek verimli bir ekrandan edilen kimyasal bileşikler, düzenleme çevrimi içinde bir veya daha fazla aşamasını bloke eden ya da etkileyebilir. Bu nedenle, yeni kimyasal bileşiklerin tanımlanması editosome fonksiyonu ve kesme düzeneği için değerli moleküler problar üretecektir. Önceki çalışmalarda, in vitro deneyler, düzenleme, radyo-etiketli RNA kullanılarak gerçekleştirildi. Bu deneyler zaman verimsiz ve yüksek verimli amaçlar için uygun, alıcıdır. Burada, homojen floresans-esaslı "karıştır ve ölçmek" RNA düzenleme izlemek için bir çekiç ribozim in vitro haberci deneyi sunulmuştur. Sadece bir RNA düzenleme bir sonucu olarakçekiç ribozim, bir flüoresan rezonans enerji transferi (FRET) oligonükleotid alt-tabaka bölünme geçirmektedir. Bu da, böylece bir sinyal üreten söndürücüden fluorofor ayrılması ile sonuçlanır. Editosome fonksiyonu bloke edildiğinde aksine, floresans sinyali söndürülür olacaktır. Bu in vitro RNA ya da düzenleme editosome fonksiyonunu inhibe kimyasallar yüksek yayılımlı tarama esnasında izlenmesi için genel olarak uygulanabilir olması gerekir, son derece hassas ve basit bir testtir.

Introduction

RNA düzenleme, bir post-transkripsiyonel mRNA modifikasyon bir işlem olup, ilk tripanosomatidlerde 1 keşfedilmiştir. O zamandan beri, önemli iş Tiypanosoma brucei 2,3 RNA düzenleme arkasındaki mekanizmayı inceleyerek yapılmıştır. Enzimatik reaksiyonlar bir dizi olarak, editosome, yaklaşık 20 protein bir çekirdek kompleksi, enerji üretim oksidatif fosforilasyon sisteminin çoklu bileşenleri için olgun mRNA mitokondriyal oluşturur. Katalitik olayların sırası kılavuzu RNA'lar (gRNAs) tarafından dikte gibi, endonükleolitik bölünme, üridilat (U) ekleme veya silme, ve ligasyon 4.

Çekirdek editosome kompleks proteinlerine ilave olarak, yardımcı bir dizi faktör de 5-7 tespit edilmiştir. Bu proteinler daha çok bağımsız kompleksleri gruplandırılmıştır görülür. Ancak, çekirdek editosome kompleks protein montaj sırası ve aksesuar ile çekirdek kompleks etkileşim kalıplarıkompleksleri belirlenecek henüz. Tripanosomatidlerde RNA düzenleme işlemini hedefleme kimyasal Disektörler sağlayabilir ki editosome kompleksinin oluşumu ve işlevi okuyan yardım. Ayrıca, birkaç editosome proteinler üzerinde fonksiyonel çalışmalar ilaç 8-12 hedef olarak potansiyellerini gösteren, farklı yaşam evrelerinde genelinde zorunluluk göstermiştir. Bu nedenle, editosome en bulunan inhibitörleri aynı zamanda tripanosomatidlerde karşı kurşun bileşikleri olarak hareket edebilir. Tripanosomatid neden olduğu hastalıklara karşı mevcut ilaçlar, toksik verimsiz ve 13,14 pahalı gibi bu, zamanında.

Bir etkili ve uygun in vitro deney RNA düzenlemeyi engelleyen özel inhibitörler için kimyasal evreni keşfetmek için gereklidir. Üç deneyleri geliştirilmiş ve editosome aktivitelerini izlemek için kullanılmıştır: vitro RNA düzenleme tahlilinde 15 (a) tam yuvarlak, (b) in vitro RNA düzenleme tahlilinde 16,17, ön ayrıldı and (c) çekiç ribozimi (HHR) deneyi 18-tabanlı. İlk iki deney radyoaktivite yardımıyla düzenlenmiş ürün (ATPase 6 mRNA) doğrudan görselleştirme dayanır. HHR-bazlı analiz düzenleme üzerine bir Ribozim davranmasına modellenmiştir ATPaz 6 mRNA değiştirilmiş bir sürümünü kullanır. Fonksiyonel Ribozim sonra özellikle bir muhabir olarak hizmet veren, radyo etiketli RNA substrat Cleaves. Son zamanlarda, Moshiri'nin et al. Geliştirilmiş bir 'karışımı ve ölçmek' radyo işaretli RNA alt-tabaka, bir flüoresan rezonans enerji transferi (FRET) alt-tabaka 19 ile değiştirildiği burada RNA düzenleme izlemek için in vitro tahlilinde raportör HHR-göre. Bu testin prensibi avantajlar şunlardır: (a) aktif ribozim ve alt-tabaka bölünme üretim düşük hacimli (örneğin 20 ul) aynı tüp içerisinde aynı anda meydana gibi, hızlı ve uygun bir karışım ve tahlilin ölçmek tür, (b ) bu radyoaktif etiketli malzemelerin kullanımı önler, (c) bir hassasiyeti olduğufloresan bir mikro-titre plaka biçiminde enstrümantasyon, ve (d)-gürültü oranı yüksek bir sinyal ile fforded. Bu tayin kullanılarak, saflaştırılmış editosome karşı bilinen RNA ligaz düzenleme inhibitörlerinin etkisi 19, teyit edilmiştir. Bu deney esas olarak T'den bütün editosomes karşı, RNA düzenleme önleyicilerinin hızlı tespit edilmesi için tahlil doğrulanmış brucei.

Şekil 1 ayrıntılı bir adım adım şemadır flüoresan bazlı vitro RNA düzenleme deneyde gösterilebilir. Bu protokol, ya in vitro RNA ya da düzenleme izleme kolayca çeşitli ölçekler bileşik kütüphanelerinin taranması için adapte edilmesi için kullanılabilir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Aşağıdaki protokol floresan RNA dayalı düzenleme tahlilini yapmak için prosedür açıklanmaktadır. Deney, tek bir PCR tüpü, deney kapsamına bağlı olarak, 96 oyuklu, veya 384 oyuklu plakalar içerisinde gerçekleştirilir. Daha sonra, floresans sinyali uygun bir gerçek zamanlı PCR algılama sistemi üzerinde okunabilir. Burada deney 384 oyuklu plakalar bağlamında tarif edilmektedir.

1.. Kültürleme T. brucei Hücreler

  1. T. için bir büyüme ortamı hazırlayın brucei formu hücreleri procyclic. Ortamı, 1 L için:
    1. 800 ml'lik mili Q suyu içinde 25.4 g SDM-79 tozu çözülür.
    2. 10 M NaOH ile 7.3 'e 2 NaHCO 3 g ve pH ekleyin.
    3. 900 ml, filtre ile sterilize bir son hacme nanopure su ekleyin.
    4. % 10 son konsantrasyonlara Fetal Bovine Serum (FBS), penisilin-streptomisin çözeltisi ve hemin (2.5 mg / ml) (v / v), 100 U / ml ve 7.5 mg / L idi.
  2. T <300 ml büyümekem> 1.5 x 10 7 hücre / ml 'lik bir yoğunluğa kadar 70 rpm'de çalkalanarak 28 ° C'de brucei 1.7A vahşi tip (procyclic form) hücreleri. Not: Bu aktif editosome 3 ml üretmelidir ~ 600 düzenleme reaksiyonlar için yeterli toplam protein, 0.5 mg.
  3. 4 ° C'de 10 dakika boyunca 6000 x g'de santrifüj ile hücreler hasat
  4. Soğutulmuş PBSG tamponu, 50 ml (10 mM Na 2 HPO 4, 10 mM NaH 2 PO 4, 145 mM NaCl ve 6 mM glukoz) ile pelet yıkayın ve 10 dk için 10,000 x g'de santrifüj ile tekrar hücrelerin aşağı spin 4 ° C.

Ham Mitokondri 2.. İzolasyonu

Not: Tüm adımlar editosome aktivitesini korumak için buz üzerinde ya da 4 ° C'de gerçekleştirilmelidir.

  1. DTE tamponu, 30 ml (1 mM Tris-HCl, pH 8.0 ve 1 mM EDTA) içinde yeniden süspanse hasat edilen hücreler. Yukarı okşayarak ve aşağı buz üzerinde en az 10 defa hücre zarı bozmak için bir 40 ml steril Dounce homojenleştirici (pre-soğutulmuş) kullanın. Tercihen mitokondri çökertmek için, 4 ° C'de 10 dakika boyunca 15.800 x g'de 0.25 M. Santrifüj bir son konsantrasyon elde etmek için homojenat için hemen 4.3 ml,% 60 sukroz (örneğin, 1.75 M w / v) ekleyin.
  2. STM tampon maddesi (20 mM Tris-HCl pH 8.0, 250 mM sukroz ve 2 mM MgCI2) 4.6 ml mitokondriyal pelletini. I, sırasıyla 0.3 mM ve 9 U / ml nihai konsantrasyonda 0.1 M CaCI2 13.8 ul ve RNase-barındırmayan DNase 4 ul ekleyin. Buz üzerinde 1 saat için karışımın inkübe edin.
  3. 4 ° C'de 10 dakika boyunca 15,800 xg'de DNase I Santrifüjü etkisiz hale getirmek için STE tampon 4,6 ml (20 mM Tris-HCl pH 8.0, 250 mM sukroz ve 2 mM EDTA) ekleyin
  4. 400 ul liziz tamponu (10 mM Tris-HCl pH 7.2, 10 mM MgCl2, 100 mM KCI, 1 ug / ml pepstatin, 1 mM DTT, ve 1 x tam EDTA içermeyen proteaz inhibitörü) ve bir transfer pelletini mikrofüj tüpü.
  5. % 1 a bir nihai konsantrasyona kadar% 10 Triton X-100 eklemend bir boru döndürücüde 4 ° C'de 15 dakika boyunca inkübe lizat.
  6. 4 ° C'de 15 dakika boyunca 17,000 x g santrifüj ile iki kez mitokondriyal lizat temizleyin; temizlenmiş süpernatan her tutma.

3.. Editosome Arıtma

  1. Dökün 10 ml 10% -30% (40 mM HEPES pH 7.9, 20 mM Mg (OAc) 2, 100 mM KCl 2x HHE gradyan tamponu kullanılarak, bir ultra santrifüj tüp içinde (v / v) gliserol lineer gradyan (Tablo 1), ve 2 mM EDTA) ve kullanma kılavuzunu takip ederek bir degrade yapımcısı.
  2. Dikkatlice gliserol gradyanın tepesinden çözeltisi 500 ul çıkarıp hafifçe silinir mitokondriyal lizat 500 ul yükleyin. Ultrasantrifüj işlemi kullanılarak 4 ° C'de 6 saat boyunca 178,000 x g'de Spin.
  3. 4 ° C 'de, gradyanın alt üst sıralı 500 ul fraksiyonlar toplamak Sonra kullanıma kadar -80 ° C'de sıvı azot ve mağaza kullanarak kesirler dondurma oturtun.

  1. 3 dakika boyunca 90 ° C'de ısıtma ile 1:1 'lik bir mol oranında, bir T7 yükseltici oligonükleotid (5'-TAATACGACTCACTATAGGG-3') ile T7 promotörü dizisi (Tablo 2) tamamlayıcı bir sekansı içeren ve oda sıcaklığında soğutulduktan ilgili DNA şablonu tavlama en az 10 dakika karıştırıldı.
  2. Kullanım kılavuzunu takip ederek in vitro transkripsiyon kiti kullanılarak RNA'yı.
  3. 7 M üre boya (7 M üre,% 0.05 ksilen Cynol ve% 0.05 bromofenol mavisi) eşit hacmi eklenerek transkripsiyon reaksiyonu durdurun. 9% poliakrilamid jel (% 9 akrilamid, 7 M üre, 1 x TBE) denatüre steril bir filtre üzerinde çalıştırın.
  4. Bir bulmak için kısa dalga boylu UV lamba ve tüketim ilgili RNA ile ultraviyole (UV) gölgeleme kullanın. Bir mikrofüj tüpüne eksize jel parça koyun ve jel elüsyon tampon 400 ul (20 mM Tris-HCl pH 7.5, 250 mM NaOAc, 1 mM EDTA ve% 0.25 SDS) ekleyin. Bir tüpü rotatifine oda sıcaklığında gece boyunca Zehir.
  5. Precisoğuk% 100 etanol içinde 1 ml ilave edildi ve 30 dakika, -20 ° C, gece boyunca -80 ° C'de ya da inkübe edilerek elüe RNA pitate.
  6. RNA aşağı pelet 4 ° C'de 30 dakika boyunca 16,000 x g'de santrifüjleyin.
  7. % 75 etanol içinde 1 ml pelet yıkayın. 4 ° C'de 20 dakika boyunca 16,000 x g'de santrifüje
  8. Tablo 2'de gösterildiği gibi, istenen konsantrasyonları elde etmek için RNase içermeyen su içinde uygun bir RNA topağı yeniden süspanse edin.

5. Floresans tabanlı RNA Düzenleme Testi

  1. Tek bir reaksiyon için, bir mikrofuj tüp içinde preA6Rbz 1 pmol (1 ul) ve 2.5 pmol gA6Rbz (1 ul) (1:2.5 mol oranı) bir araya 3 dakika boyunca 70 ° C'de inkübe edilir ve bu da oda sıcaklığında bekletin en az 10 dak.
  2. Bu arada (25 mM HEPES pH 7.9, 10 mM Mg (OAc) 2, 50 mM KCI ve 10 mM EDTA), 1 mM 1x HHE tampon içeren düzenleme reaksiyonu için, preA6Rbz ve gA6Rbz olmadan Tablo 3 kullanarak bir ana karışım hazırlamakATP, 5 mM CaCl2, Torula maya RNA,% 0.1 Triton X-100 ve saflaştırılmış editosome 16 ng / ml.
  3. Ana karışımı tamamlamak için tavlı preA6Rbz ve gA6Rbz ekleyin.
  4. RNase içermeyen su 2 ul (no bileşikleri ile kuyu) veya 200 uM kimyasal bileşiklerin birinin veya 2 ul birini içeren kuyu içine ana karışımı (Tablo 3) 18 ul koyun ve şekil 5'e göre olan bir plaka içerisinde kontrol örneklerini içerir.
  5. Bir plaka kapatıcı ile plaka Seal ve herhangi bir hava kabarcıklarını çıkarmak için aşağı plaka döndürün. 4 saat boyunca 28 ° C'de inkübe edilir.
  6. Her bir oyuğa gA6Rbz yarışmacının 25 pmol (2 ul) ilave edin. Plakayı aşağı spin ve gerçek-zamanlı PCR makinesine koyun, taze bir mühürleyen yerleştirin. Aşağıdaki deney Programı:
    Adım 1: 5 dakika boyunca 85 ° C; Adım 2: 10 dakika boyunca 24 ° C; Adım 3: kes.
  7. 23 ul son hacim olması için her bir oyuğa FRET alt-tabakanın 15 pmol (1 ul) ilave edin. Taze bir mühürleyen ile plaka mühür.Çabuk plaka spin ve real-time PCR makinede geri yerleştirin.
  8. Aşağıdaki adımlara yeni bir deneme Programı:
    Adım 1: 1 dakika için 37 ° C; Adım 2: oku; Adım 3: 1, 40 kez Git Adım; Adım 4: durdurun.
  9. Okuma gerektiren ve FAM filtresi seçmek tüm kuyuları seçerek Kur plaka. 23 ul ve çalışma başlatmak gibi giriş seviyesi.
  10. Analizi için bir çubuk grafik üzerinde yamaçları çizilerek kinetik bir ölçümünü elde etmek için her bir oyuğa / numuneden elde edilen değerlerin eğimi hesaplanır. NOT: Bir kinetik okuma numune ve arka plan arasındaki sinyal-gürültü oranını iyileştirir; arkaplan örneği sıfıra yakın bir eğime sahip gibi. Bir uç nokta okuma yüksek bir arka plan gürültü vardır.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Büyük çaplı bir ekranı set edilmesi için gereken gerekli adımları göstermek için, 2-5 tahlilin kalitesine ilişkin temsili kontrol deneyleri Şekil. Bu tarama birkaç gün boyunca tutarlı bir deney için ya da farklı ekranlar karşılaştırılması için gerekli kontrol deneyleri bulunmaktadır.

Floresan Sinyal-gürültü Oranı değerlendirilmesi

Büyük çaplı bir kurulumunda fosforla etiketlenmiş oligonükleotid substratın istikrar ve kalitesini sağlamak için, arka plan ve deney maksimum sinyal arasındaki fark olarak tanımlanan Z'-faktör, aktif ribozim molekülü (A6Rbz) kullanılarak hesaplanmıştır. . '(; Verici FAM) ve 3 flöresin' N, N '-tetrametil-Z'faktör ile deneyler> 0,5 yüksek verimli ekran için kabul edilebilir olarak kabul edilir Şekil 2 FRET 5 etiketli substrat kullanılarak temsili verileri göstermektedirthylrhodamine (TAMRA; söndürücü) (A6Rbz_F / T). A6Rbz varlığında ve yokluğunda 72 çoğaltır kullanılarak hesaplanmıştır, bu alt-tabaka bir 0.64 Z'-faktörü üretti.

Bu deneyde, Iowa koyu siyah bir söndürücü maddenin (A6Rbz_F/Ib) kullanan alternatif bir alt-tabaka TAMRA kıyasla daha iyi bir sinyal-gürültü oranı verebilir. Iowa Siyah, TAMRA aksine, yaydığı ısı ve ışık olarak değil enerjisini absorbe olmasıdır. FAM / Iowa Black (F / Ib)-etiketli substrat kullanılarak elde Z'-faktörü 0.68 idi. TAMRA etiketli alt-tabaka üzerine F / Ib-işaretli substrat için Z'-faktör iyileşme nedeniyle göreceli olarak daha düşük arka plan taşımaktadır. Bu temsili sonuçları, her iki alt-tabakalar, yüksek geçirimli bir elek kullanılmak için uygun seçenekler olduğunu göstermektedir.

Gliserol Gradient Kesirler Düzenleme Faaliyetleri Belirlenmesi

, Deneyler için glisero en aktif editosome fraksiyonları belirlemek ve seçmek içinl gradyan fraksiyonları flüoresan bazlı deney (Aşama V) kullanılarak in vitro düzenleme için test edilmiştir. Bu veriler en aktif fraksiyonları gibi (Şekil 3) fraksiyonları 7-12 göstermek (≥% 50 düzenleme etkinlik;% 100 olarak en aktif fraksiyonu ile). Daha editosome gerekli olduğunda bu kısımlar kombine edilebilir.

Editosome eden fraksiyonlar bir araya getirilmiş iken Z'-faktörünün hesaplanması

En aktif fraksiyonlar (F8 + F9 + F10) editosome kaynağı olarak kullanıldığı zaman editosome fraksiyonu birleştirilir ve etkisini belirlemek için, 0.6 Z'-faktör değeri hesaplanmıştır. 72 suret editosome varlığında ve yokluğunda (Şekil 4) test edildi Z'-faktörünü hesaplamak için. F / Ib alt-tabaka, bu deneyde kullanıldı. Bu veriler, gliserol gradyan fraksiyonları bir araya Z'-faktör dayalı tahlilin kalitesi üzerinde minimal bir etkiye sahip olduğunu göstermektedir.

ass = "jove_content"> Örnek Testi için Kontrol Deneyi

Farklı kontrol örnekleri karşılaştırarak Örnek veri tahlilde değişkenleri analiz etmek için kullanıldı. Şekil 5'te gösterildiği gibi, herhangi bir RNA düzenleme bileşeni (reaksiyon 1-4) kayıp reaksiyonları substratı yarmak yoktur. Ve bağıl floresan düzenleme aktivitesi ile ölçüldüğü gibi, substratın yarılması sadece bir inhibitörü (Reaksiyon 5) yokluğunda ya da tüm düzenleme bileşenlerin varlığı ve aktif olmayan bir bileşik (bir reaksiyon düzenleme reaksiyonların tüm bileşenlerinin mevcudiyetinde gözlenmektedir 6). Bunun aksine, bir inhibe edici bileşik RNA düzenleme blok ve bir pozitif kontrol (Reaksiyon 7) olarak kullanılır. Burada, Mordan Siyah (MrB) ve C53 bileşikleri, sırasıyla pozitif ve negatif kontroller olarak kullanılmıştır.

ghres.jpg "width =" 500 "/>
Şekil 1. Çekiç ribozim tabanlı vitro RNA düzenleme deneyde gösterilebilir. A) adım adım şematik bir temsilidir floresan merkezli düzenleme vitro deneyde: kendi kılavuz RNA (gA6Rbz) ile önceden düzenlenmiş çekiç ribozim (önceden düzenlenmiş A6Rbz) (a) hibridizasyonu. (B) Tanıma ve saflaştırılmış editosome kompleksi tarafından RNA dubleks etkileşimi. Editosome tarafından katalize (c) Silme RNA düzenleme. (D) 85 ° C'de ısıtılarak ve kılavuz RNA yarışmacının (gA6Rbz_comp) eklenmesi ile editosome ve gA6Rbz gelen düzenlenmiş A6Rbz ayrışması. (E) aktif A6 çekiç ribozim (aktif A6Rbz) ile alt-tabakanın FRET hibridizasyonu. (F) aktif ribozimini. B) Önceden düzenlenmiş çekiç ribozimdir (A6Rbz önceden düzenlenmiş) tarafından FRET substratın bölünmesini aşağıdaki FAM sinyallerin algılanması üç Bize silme (çift başlı arro belirtir gA6Rbz ile birlikte gösterilirdüzenleme bölgesi (ES) için ağırlık). Fonksiyonel editosome mevcudiyetinde RNA düzenleme sonucu olarak etkin ribozim artık FRET substratı (bir ok ile gösterilen bölünme sitesi) yarabilir aktif formuna (düzenlenmiş A6Rbz) içine düzenlenir. 5'-Cuga-3 'ribozimdir aktivite (düzenlenebilir site) için gerekli katalitik çekirdek düzenlenmiş A6Rbz arasında (Bu rakam Moshiri'nin 19 modifiye edilmiştir) vurgulanır korunmuş. , bu rakamın daha büyük bir versiyonunu görmek için buraya tıklayınız.

Şekil 2,
Şekil 2.. Sinyal-gürültü farklı söndürücüleri barındıran FRET yüzeyler arasındaki oran karşılaştırma. FAM / TAMRA (F / T) ve FAM / Iowa Siyah FQ (F / lb) yüzeyler kullanılarak ribozyme (A6Rbz) aktivitesi. Y-ekseni, hukDakikada NTS floresan keyfi birim (FAU).

Şekil 3,
Mitokondriyal lizat gliserol gradyan santrifüjü. Kesir 9. (F9) 'den elde seçim fraksiyonların Şekil 3,. RNA düzenleme aktivitesi, en yüksek aktiviteye sahiptir. Y-ekseni,% 100 olarak F9 dikkate alınarak, yüzde olarak nispi düzenleme aktivitesini temsil etmektedir.

Şekil 4,
Şekil 4,. Editosome kaynağı olarak en aktif fraksiyonlar (F8 + F9 + F10) kullanılarak Z'-faktör hesaplanması. Deneysel varyasyon tepkime her tür 72 kez tekrarlanmış olan elde edilmiştir. Z'-faktörü 0.6 olarak hesaplandı. Y-ekseni, göreli düzenleme aktivitesini temsil etmektedir.

Şekil 5,
Şekil 5,. Floresan merkezli düzenleme RNA deneyi için deney Örnek. Reaksiyonları ve CFX384 TouchTM gerçek zamanlı PCR algılama sistemi başına 20 ul'lik bir nihai hacimde gerçekleştirilmiştir floresan sinyalini ölçmek için kullanıldı. Grafik deneyi (# 5) için tüm bileşenleri ihtiva eden bir tam düzenleme reaksiyonuna ilaveten çeşitli kontrolleri göstermektedir. Floresan tek başına (# 1) alt-tabakanın bütünlüğünü değerlendirmek için FRET alt-tabakanın mevcudiyetinde ölçülmüştür. Örnek 2. önce düzenleme için bir ribozim etkinliğini izlemek için editosome yokluğunda gerçekleştirildi. Alt tabaka üzerinde denatüre editosome etkisini değerlendirmek için, floresans editosome ve FRET alt-tabakanın mevcudiyetinde ölçülmüştür ancak (# 3). Rehber-yönettiği düzenleme özgünlük, bir sam sınamak içinple gA6Rbz yokluğunda (# 4) kullanılmıştır. Olmayan bir inhibitör (C53, # 6) ve bir inhibitör bileşiği (MrB, # 7) düzenleme tahlil üzerindeki etkisini test etmek için kullanıldı. RNA düzenleme MRB önemli ölçüde inhibe edilirken, C53 göz ardı edilebilir bir etkiye sahiptir. Hata çubukları 10 kez tekrarlanmış arasında deneysel varyasyon (standart sapma) karşılık gelir. Y-ekseni,% 100 olarak reaksiyonun tamamlandığı (# 5) göz önüne alındığında, yüzde olarak nispi düzenleme aktivitesini temsil etmektedir.

% 10. % 30
2x HHE degrade tampon 5 mi 5 mi
Gliserin 1 mi 3 mi
DEPC H2O 4 mi 2 mi
1 M DTT 10 ul 10 ul

Tablo 1.% 10 ve% 30 Gliserin Solüsyonu (10ml her biri).

Pre-Düzenlenen A6 Ribozim (preA6Rbz)
preA6Rbz DNA şablonu 5'-ACATTTGATCTATTGTTTCGTCCTCACGGACTCA TCAAAAGTCACAACTTTCCCTTTCTCTCCTCCCCCTAACCTTT CCCTATAGTGAGTCGTATTA CC-3 '
preA6Rbz RNA 5'-GGGAAAGGUUAGGGGGAGGAGAGAAAGGGAAA GUUGUGACUUUUGAUGAGUCCGUGAGGACGAAACAAUAGA UCAAAUGU-3 '
RNA stok kons. 1 uM
Kılavuz A6 Ribozim (gA6Rbz)
gA6RBz DNA şablonu 5'-AAAAAAAAAAAAAAAAATAATTATCATATCACTGT CAAGGGAAAGTTGTGAGGGTGATGAGTCCGTGTATATCC CTATAGTGAGTCGTATTA CC-3 '
gA6Rbz RNA 5'-GGGAUAUACACGGACUCAUCACCCUCACAACUU UCCCUUGACAGUGAUAUGAUAAUUAUUUUUUUUUUUUUUUUU-3 '
RNA stok kons. 2.5 uM
Kılavuz A6 Ribozim Rakip (gA6RBz_comp)
gA6Rbz_comp DNA şablonu 5'-GGATATACACGGACTCATCACCCTCACAACTTTC CCTTGACAGTGATATGATAATTATTTTTTTTTTTTTTTTT CCCTAT AGTGAGTCGTATTA -3 '
gA6Rbz_comp RNA 5'-AAAAAAAAAAAAAAAAAUAAUUAUCAUAUCACUG UCAAGGGAAGUUGUGAGGGUGAUGAGUCCGUGUAUAUCC-3 '
RNA stok kons. 12.5 uM
Aktif A6 Ribozim (A6RBz)
A6Rbz DNA şablonu 5'-ACATTTGATCTATTGTTTCGTCCTCACGGACTCAT CAGTCACAACTTTCCCTTTCTCTCCTCCCCCTAACCTTTCC CTATAGTGAGTCGTATTA CC-3 '
A6Rbz RNA 5'-GGGAAAGGUUAGGGGGAGGAGAGAAAGGGAAA GUUGUGACUGAUGAGUCCGUGAGGACGAAACAAUAGAUCA AAUGU-3 '
RNA stok kons. 1 uM
Tabakayı FRET
TAMRA söndürücü 5'-FAM-GAUCUAUUGUCUCACA-TAMRA-3 '(Eurogentec)
Iowa Siyah söndürücü 5'-FAM-GAUCUAUUGUCUCACA-Iowa Black-3 '(IDT)
RNA stok kons. 15 uM (her ikisi için)

Tablo 2.. DNA ve RNA Şablonlar Yüzeyleri.

Bileşim Düzenleme reaksiyonu (ul)
10x HHE 1.5
0.1 M CaCl2 1
100 mM ATP 0.2
10% Triton X-100 0.2
500 ng / Torula maya RNA uL 1
Editosome 5
RNazsız H 2 O 7.1
1 uM preA6Rbz 1
2.5 iM gA6Rbz 1
Toplam 18

Tablo 3. Reaksiyon Kompozisyon ve Master Mix.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Trypanosom RNA düzenleme kompleksine karşı inhibitörlerini teşhis etmek için yeni bir yüksek veri akışı tarama yöntemi tripanosomatidlerde neden olduğu hastalıkların karşı ilaç keşfi için yeni bir araç temin sunuldu. FRET tabanlı tahlil ribozim yaygın olarak farklı amaçlar 20-22 için kullanılmıştır; ancak, RNA düzenleme aktivitesi 19 in vitro izlenmesi için FRET bazlı ribozim tahlilin kapasitesini kullanılmıştır var. Bu deney, potansiyel olarak, memelilerde 23 çekirdeği ile kodlanmış RNA'ların nükleotid ikame düzenleme gibi ökaryotlarda RNA düzenleme diğer türleri, adapte edilebilir.

Bu tahlilin yenilik başına FRET tabanlı bir ribozim tahlilleri kurulmasında değil, editosome karşı kimyasal yüksek verimli tarama için uygun olan bir RNA düzenleme tahlilinde içine bu tekniği içeren bir yöntem geliştirme. Ribozim tahlil-tabanlı bir yöntem diğer ekranlar ve eşek üzerinde çeşitli avantajları vardırays şu anda bu amaç için kullanılabilir. Özel olarak, teknik, böylelikle, yüksek miktarda madde taraması için uygun yapım 19, bir radyo-etiketli bir karşıt olarak alt-tabaka üzerinde bir floresan dayanan bir hassas ve tekrarlanabilir bir "mix-ve-ölçer" deneyi sunar. Bunun yerine basit bir uç-nokta sinyalinin alt tabakanın ilavesinden sonra bir floresan sinyalinin gerçek zamanlı izleme sayesinde daha doğru bir test bileşiklerinin 19, IC50 değerlerini belirlemek için yapar. Bundan başka, tek tek rekombinan proteinlerin aksine bütün-editosome kompleks bileşiklerin önleyici etkilerinin test edilmesine imkan verir. Protein kompleksleri içindeki etkileşimlerinin dinamik yapısı göz önüne alındığında, bu yöntem daha biyolojik temsilcisi editosome proteinlere karşı inhibitörlerinin belirlenmesi 24 ayar veriyor söylenebilir. Buna ek olarak, tüm-editosome kompleksi potansiyel hedef RNA düzenleme ilerlemesini durdurmak için bir fırsat sağlarÇeşitli geçici adımlar olduğunu daha önce tespit edilmemiştir. Böylece, teknik RNA düzenleme süreci için çok önemli etkileşimleri ve faaliyetleri olarak daha iyi bir bakış açısı kazanıyor sağlayacaktır. Bu yaklaşım, karmaşık 24,25 inhibitörleri olarak hareket eden prokaryotik ribozom kompleks birleştirmesi ve işlevi örneğin viomisin ve eritromisin gibi antibiyotikler, kullanan aydınlatılmasına örneklediği gibi geçmişte başarılı olduğu bulunmuştur.

Yöntemin başarılı tamamlanmasını sağlamak için, protokollerin bazı ayarlamalar gerekli olabilir. İlk olarak, uygun gliserol gradyan mitokondriyal özü fraksiyonun seçimi çok önemlidir. Burada, gradyanın ~ 20S bölgesine karşılık gelen 11 üzerinden kısımlar 7, kısım 9, maksimum aktivite sergileyen en yüksek düzenleme aktivitesi gösterdi. Bu fraksiyon sunulan tüm testleri için seçilmiş olmakla birlikte, hangi fra değerlendirmek amacıyla önceden tüm fraksiyonlar test etmek için gereklidirdüzenleme aktivitesi tepe şeklinde gösterilmektedir. İkinci olarak, bir seçim fraksiyon doğrulamak için, bu Z'-faktör değeri hesaplanarak sinyal-gürültü oranını değerlendirmek için ön testler için çok önemlidir. Uygun mitokondriyal özü gliserol gradyan ayırma tamamlanmış ise 0,6 'lık bir Z'-değeri elde edilebilir. Daha sonra, titrasyon 19 ile maksimum düzenleme aktivitesi elde etmek için gerekli mitokondriyal özü tekrar değerlendirilmesi reaksiyon hacmi için tavsiye edilir.

Bu yazıda sunulan tekniğin önemli bir kısıtlılığı editosome kompleksi 19 saflaştırılmış edildiği mitokondriyal özü gliserol degrade fraksiyonlamanın zahmetli ve zaman alıcı bir süreç ile ilgilidir. Bu dezavantajlara rağmen, bu yöntem, tercihen, böylece yüksek verimli tarama uygulama için eleme, verim potansiyeline karşı düşük maliyeti göz önüne alındığında, ham editosome elde etmek üzere sürülmektedir. Böyle TAP-etiket pu gibi kontrast, diğer yöntemlerdearalığında olacak şekilde yapılır, daha da saflaştırılmış fraksiyonlar editosome vermek mümkün olan bu tür ikincil deneyleri durumunda olduğu gibi bir orta verimli deneyler düşük için uygun olan. Ayrıca, bileşiklerin spesifik inhibitör etkisi sağlamak için, bu editosome yokluğunda ribozim (A6Rbz) aktivitesine karşı test etmek için kontroller dahil etmek gerekir. Daha önceki çalışmalar, bu yöntem sayesinde yüksek bileşik konsantrasyonları 19 de olası parazit boya benzeri bileşikler için IC50 değerlerini hesaplarken de etkisiz olabilir sermiştir unutulmamalıdır.

Daha önceden bölünmüş önceden düzenlenmiş ribozim içeren benzer bir floresans bazlı analiz geliştirme sunulan HTS tekniği duyarlılığını artırmak için faydalıdır. Bu editosome karmaşık endonükleazları ile katalize oran-sınırlayıcı endonükleolitik klivaj adımı atlayarak izin verecektir. Bu tadil edilmiş tahlilin diğer bir avantajı ikinci bir tarama aracı olarak bir uygulama olurExoUase, TUTase ve ligasyon katalitik aktiviteleri üzerindeki birincil bir elek vasıtasıyla tanımlanır inhibitörlerinin etkisini izlemek için. Şu anda teklif edilen deney RNA düzenleme silme tür karşı inhibitörlerinin tespiti ile sınırlıdır. Bu nedenle, keşfetmek için başka bir cadde RNA düzenleme ekleme türüne bileşik etkileri izleyebilmek için sunulan testin değişiklik olacaktır.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
SDM-79 Medium Gibco by Life Technologies
Fetal Bovine Serum Life Technologies 12483-020 heat inactivation at 55 °C for 1 hr
Hemin, minimum 80% Sigma H5533-10G
Penicillin-Streptomycin Sollution Fisher Scientific MT-30-002-CI
Dnase 1 recombinant, Rnase Free  Roche 4716728001
T7 RiboMax Express Large  scale RNA  production system Promega P1320
Kimble Kontes Dounce Tissue Grinders   Fisher Scientific K885300-0040  
Gradient Master, ver 5.25  Biocomp 107-201M
Ultra Clear Tube, 13.2 ml Beckman Coulter 344059
Optima L-100XP  Ultracentrifuge  Beckman Coulter 392052
SW 41 Ti ROTOR Beckman Coulter 331336
MicroSeal 'B' Seal, Seals Biorad MSB1001
CFX 384 Touch Real-Time PCR Detection System Biorad 185-5484
Acryl/Bis solution (19:1), 40% (w/v) Bio Basic A0006-500ML
Urea, Molecular biology grade, 1 kg Life Technologies AM9902

DOWNLOAD MATERIALS LIST

References

  1. Benne, R., et al. transcript of the frameshifted coxII gene from trypanosome mitochondria contains four nucleotides that are not encoded in the DNA. Cell. 46, 819-826 (1986).
  2. Hajduk, S., Ochsenreiter, T. RNA editing in kinetoplastids. RNA biology. 7, 229-236 (2010).
  3. Aphasizhev, R., Aphasizheva, I. Uridine insertion/deletion editing in trypanosomes: a playground for RNA-guided information transfer. Wiley interdisciplinary reviews RNA. 2, 669-685 (2011).
  4. Seiwert, S. D., Stuart, K. RNA editing: transfer of genetic information from gRNA to precursor mRNA in vitro. Science. 266, 114-117 (1994).
  5. Weng, J., et al. Guide RNA-binding complex from mitochondria of trypanosomatids. Molecular. 32, 198-209 (2008).
  6. Hashimi, H., Zikova, A., Panigrahi, A. K., Stuart, K. D., Lukes, J. TbRGG1, an essential protein involved in kinetoplastid RNA metabolism that is associated with a novel multiprotein complex. RNA. 14, 970-980 (2008).
  7. Ammerman, M. L., et al. Architecture of the trypanosome RNA editing accessory complex, MRB1. Nucleic Acids Res. 40, 5637-5650 (2012).
  8. Huang, C. E., O'Hearn, S. F., Sollner-Webb, B. Assembly and function of the RNA editing complex in Trypanosoma brucei requires band III protein. Molecular and cellular biology. 22, 3194-3203 (2002).
  9. Carnes, J., Trotter, J. R., Peltan, A., Fleck, M., Stuart, K. RNA editing in Trypanosoma brucei requires three different editosomes. Molecular and cellular biology. 28, 122-130 (2008).
  10. Hearn, S. F., Huang, C. E., Hemann, M., Zhelonkina, A., Sollner-Webb, B. Trypanosoma brucei RNA editing complex: band II is structurally critical and maintains band V ligase, which is nonessential. Molecular and cellular biology. 23, 7909-7919 (2003).
  11. Schnaufer, A., et al. An RNA ligase essential for RNA editing and survival of the bloodstream form of Trypanosoma brucei. Science. 291, 2159-2162 (2001).
  12. Tarun, S. Z., et al. KREPA6 is an RNA-binding protein essential for editosome integrity and survival of Trypanosoma brucei. RNA. 14, 347-358 (2008).
  13. Croft, S. L., Barrett, M. P., Urbina, J. A. Chemotherapy of trypanosomiases and leishmaniasis. Trends in parasitology. 21, 508-512 (2005).
  14. Denise, H., Barrett, M. P. Uptake and mode of action of drugs used against sleeping sickness. Biochemical pharmacology. 61, 1-5 (2001).
  15. Seiwert, S. D., Heidmann, S., Stuart, K. Direct visualization of uridylate deletion in vitro suggests a mechanism for kinetoplastid RNA editing. Cell. 84, 831-841 (1996).
  16. Igo, R. P., Palazzo, S. S., Burgess, M. L., Panigrahi, A. K., Stuart, K. Uridylate addition and RNA ligation contribute to the specificity of kinetoplastid insertion RNA editing. Molecular and cellular biology. 20, 8447-8457 (2000).
  17. Igo, R. P. Jr, et al. Role of uridylate-specific exoribonuclease activity in Trypanosoma brucei RNA editing. Eukaryotic cell. 1, 112-118 (2002).
  18. Wang, B., Salavati, R., Heidmann, S., Stuart, K. A hammerhead ribozyme substrate and reporter for in vitro kinetoplastid RNA editing. RNA. 8, 548-554 (2002).
  19. Moshiri, H., Salavati, R. A fluorescence-based reporter substrate for monitoring RNA editing in trypanosomatid pathogens. Nucleic Acids Res. 38, e138 (2010).
  20. Jenne, A., et al. Rapid identification and characterization of hammerhead-ribozyme inhibitors using fluorescence-based technology. Nature. 19, 56-61 (2001).
  21. Hartig, J. S., et al. Protein-dependent ribozymes report molecular interactions in real time. Nature. 20, 717-722 (2002).
  22. Famulok, M. Allosteric aptamers and aptazymes as probes for screening approaches. Current opinion in molecular therapeutics. 7, 137-143 (2005).
  23. Teng, B., Burant, C. F., Davidson, N. O. Molecular cloning of an apolipoprotein B messenger RNA editing protein. Science. 260, 1816-1819 (1993).
  24. Jurica, M. S. Searching for a wrench to throw into the splicing machine. Nature chemical biology. 4, 3-6 (2008).
  25. Spahn, C., Prescott, C. Throwing a spanner in the works: antibiotics and the translation apparatus. Journal of molecular medicine. 74, 423-439 (1996).

Tags

Genetik Sayı 89 RNA düzenleme, Editosome çekiç ribozim (HHR) yüksek verimli tarama flüoresan rezonans enerji transferi (FRET)
Tripanozomlann RNA Düzenleme karşı ilaçlar Tarama için bir Muhabiri olarak RNA Catalyst
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Moshiri, H., Mehta, V., Salavati, R. More

Moshiri, H., Mehta, V., Salavati, R. RNA Catalyst as a Reporter for Screening Drugs against RNA Editing in Trypanosomes. J. Vis. Exp. (89), e51712, doi:10.3791/51712 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter