Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

인간 배아 줄기 세포에 표적으로 아연 손가락 핵산 분해 효소 향상된 유전자

doi: 10.3791/51764 Published: August 23, 2014

Summary

리포터 세포주 시각화 추적 이종 집단의 관심의 세포를 분리 할 수​​있는 수단을 제공한다. 그러나, 유전자 - 표적 인간 배아 줄기 세포에서 종래의 상동 재조합을 사용하여 매우 비효율적이다. 여기서, 우리는 아연 핑거 클레아 향상된 상동 재조합을 사용하여 EGFP CNS 중뇌 특정 전사 인자 PITX3 궤적 타겟팅 기술한다.

Abstract

현재 인간 배아 줄기 세포 (ESC) 분화 프로토콜을 하나의 주요 제한은 이종 세포 집단의 생성이다. 이러한 배양 관심의 세포를 포함 할뿐만 아니라 미분화 ESCS 비 신경 유도체 및 다른 신경 세포 아형로 오염된다. 이것은 시험 관내에서 이러한 약물 발견 또는 세포 대체 요법에 대한 시험 관내 모델로서 생체 애플리케이션에서의 사용을 제한한다. 이것을 극복하기 위해, 시각화 트랙과 관심 셀을 분리하는 수단을 제공 리포터 세포주는 설계 될 수있다. 종래의 상 동성 재조합은 매우 비효율적이다 통해 그러나, 인간 배아 줄기 세포에 이것을 달성한다. 이 프로토콜과 함께 뇌하수체의 호 메오 박스 (homeobox) 인간 배아 줄기 세포에서 삼 (PITX3) 궤적 사이트 별 이중 가닥 DNA 나누기를 소개 맞춤 설계된 아연 핑거 뉴 클레아 제를 사용하는 대상에 대해 설명PITX3 - EGFP - 특정 DNA 기증자 벡터입니다. PITX3 리포터 세포주의 발생에 이어, 그 다음 그러한 체외 파킨슨 병 모델링 또는 세포 대체 요법으로 연구에 사용하기 위해 발행 프로토콜을 사용하여 구별 될 수있다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

현재 배아 줄기 세포 (ESC) 분화 프로토콜은 특히 특정 신경 표현형의 유도와 관련하여, 이종 세포 집단에서 발생. 배양이 원하는 세포 표현형, 다른 신경 세포가 포함되지만 이에 따라, 비 - 신경 세포와 분화되지 않은 세포 유형은 종종 하나 존재한다. 이러한 특성은 ESC의 적용 세포 대체 요법에 사용하기위한 시험 관내 및 질병 모델링 셀 소스를 유도 제한한다.

유전자 리포터 세포주 시각화 추적 관심 셀을 분리하는 수단을 제공하는, 리포터 단백질 (RP)의 발현은 내인성 발현을 재현 한한다. 유전자 코딩 영역의 바로 상류 프로모터의 사용은 유전자 조 기자를 유도하는 데 사용될 수 있지만, 이러한 구조는 내인성 유전자 발현을 제어하는​​ 조절 요소 정확한 부족하다. 대조적으로, 상 동성 재조합이 구비기회는 RP의 고품질 표현을 보장합니다. 과거에, 관심있는 특정 유전자좌에 상 동성 재조합을 위해 설계된 벡터를 표적으로하는 DNA 1,2 전달하는 수단으로 전기 천공을 사용하여 마우스 ESCS (mESCs)에서의 RP를 대상으로 사용되어왔다. 그러나 종래의 상 동성 재조합을 통해 리포터 세포주의 생성 인간 ESCS (인간 배아 줄기) 매우 비효율적이다, 따라서 전용 (3에서 검토)의 경우 소수의 문서화되었다. 징크 핑거 뉴 클레아 제 (ZFNs)로 통칭 사이트 특정 징크 핑거 모티프와 FOK I 클레아의 융합을 포함하는 엔지니어링 키메라 단백질을 사용하여 DNA 이중 가닥 나누기 소정 게놈 유전자좌에 도입 될 수있다. DNA 이중 가닥 브레이크 양측 상 동성을 가진 DNA 벡터가 추가 될 때, 사이트는 게놈 DNA 공여체 서열의 혼입을 허용, 상동 재조합에 의해 복구 될 수있다. 이 기술은 유용 F를 증명했다인간 일차 전지 4,5와 인간 배아 줄기 6,7 모두에서 게놈 편집. 보다 최근의 작업들이 이용했다 전사 활성제와 같은 이펙터 클레아 (TALENs), 공장에서 사용 전사 인자는 부위 - 특이 적 뉴 클레아 제 (9)의 설계에 도움 8 병원체.

다음의 프로토콜에서는 인간 뇌하수체 메오 3 (PITX3)에 대한 궤적 ZFNs 함께 상동 타겟팅 벡터 (6)를 함유 EGFP의 일렉트로 hESC의 리포터 세포주의 생성을 보여준다. 2~3주에 대한 항생제의 선택에 따라, 제대로 통합 된 DNA를 가진 인간 배아 줄기 수동으로 집어 확장 및 PCR을 통해 처음 상영하고,이어서 남부 블로 팅에 의해 검증 될 수있다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

모든 과정은 무균 층류 후드에서 수행된다. 달리 지정하지 않는 한 모든 미디어 및 솔루션은 37 ° C 평형을하고 있습니다.

형질에 대한 (이 프로토콜에 사용되는 인간 배아 줄기 및 hiPSCs, WA-09) 인간의 PSC를 1. 확장

참고 : 마트 리겔 또는 Geltrex에 인간 배아 줄기을 확장 할 필요가 없습니다. 마우스 배아 섬유 아 세포 (MEFs)에 확장 된 인간 배아 줄기는 MEF 제거 단계 다음 일렉트로 또는 nucleofection 사용할 수 있습니다 (2.8 절 참조).

  1. 1 × 100mm 요리와 MEF 미디어 cm 2 당 2.0 × 10 4 세포에서 DR4 MEFs의 1 개 75cm2 플라스크를 준비 / V 젤라틴 w 0.1 %로 사전 코팅 요리에 (표 1 참조).
    주 : CF1, BLK6 또는 MF1 MEFs를 사용할 수있다, 그러나, 예를 들면, DR410, 항생제 내성 MEF 라인을 사용하는 것이 권장된다.
  2. 다음날, 100mm 접시 위에 통로 인간 배아 줄기 섹션 1.1에서 준비 MEFs가 미리 도금. 이 ASPI을 수행하려면문화 요리에 환율이 hESC의 미디어,의 Ca2 + /의 Mg2 + - 무료 행크스 '균형 염 용액 (HBSS)와 인간 배아 줄기를 씻어, 37 ° C / 5 % CO 2에서 가습 배양기에서 디스 파제 (해당 볼륨에 대한 표 2 참조)과 장소를 추가 할 수 있습니다. MEFs를 제거하는 HBSS로 2 회 - 3 ~ 5 분 배양 후, 부드럽게 흡인 디스 파제와 한을 씻는다. 부드럽게 배양 접시의 표면에서 식민지를 다쳤고, hESC의 미디어 (표 3 참조) 셀 스크레이퍼를 사용하여, 5 ml의 피펫을 추가합니다.
  3. 15 ㎖의 원심 분리 관에 배양 접시에서 서스펜션의 식민지 조각을 수집합니다. hESC의 미디어와 15 ML 튜브로 전송 헹구고 배양 접시. 단일 세포 또는 작은 조각으로 대단히 짧은 시간을 휴식하지 않도록주의하십시오.
  4. 식민지 조각을 펠렛 160 XG에서 5 분 동안 원심 분리기.
  5. 기음 뜨는. 식민지 조각 펠릿을 풀어 손가락으로 15 ML 튜브의 바닥을 누릅니다. 분할 비율에 따라 hESC의 미디어에 부드럽게 재현 탁 식민지 조각 (normall4 일 : 8 적합한) 나중에 일 사이에 비율을 분할합니다. 효율성을 replating 영향을 미칠 것이 아니라 단일 세포 또는 작은 조각으로 대단히 짧은 렌더링하지 않도록 각별히주의해야합니다.
  6. MEFs가 HBSS로 1 배 세척에 hESC의 조각을 replating 이전. 천천히 요리 MEFs가 사전에 도금 hESC의 매체에 hESC의 단편을 함유하는 세포 현탁액의 적당량 (표 2 참조) 추가한다.
  7. 인큐베이터에있는 선반에 배양 접시를 놓고 고르게 식민지 조각을 배포 좌우로 앞뒤로 및 측면 천천히 이동합니다.
  8. 매일 hESC의 미디어를 교체합니다.
  9. MEFs (MEF-CM)에서 에어컨 미디어를 준비하기 위해 씻어 75cm 2 플라스크 MEFs HBSS로 1 개에 사전 도금. hESC의 미디어를 추가합니다. 24 시간을 따라 미디어를 조절하고 신선한 hESC의 미디어로 교체 수집합니다. 십이일 최대 매일 반복합니다. 필요할 때까지 4 ° C에서 MEF-CM을 저장합니다.

형질에 대한 인간의 ESCS의 2 준비

  1. 인간 배아 줄기의 성장을 관찰매일 현미경. 식민지 40~50% 합류, 판 cm 2 당 2.0 × 10 5 MEFs와 3 × 100mm 요리 될 때.
  2. 식민지가 60이 될 때 - 70 %의 합류 그들은 형질 전환 할 준비가 된 것입니다. 차별화 된 식민지 또는 식민지 코어를 제거하여 '신랑'식민지.
    참고 : 우리는 높은 형질을 믿고 세포가 로그 위상 성장에있을 때 목표로 효율성이 발생, 그것은 인간 배아 줄기는 ≥ 70 % 포화 상태에 도달하기 전에 일렉트로이 실시하는 것이 좋습니다.
  3. HBSS와 hESC의 식민지를 씻고 Accutase를 추가합니다.
    참고 : ROCK 억제제에 미리 치료 인간 배아 줄기 필요가 없습니다 Y-27632 단계 2.7시 Y-27632와 함께 배양 할 때 충분한 억제가 발생합니다
  4. 37 ° C / 5 현미경으로 볼 때 식민지 단일 셀을 렌더링 할 때까지 %의 CO 2시 20 분 - 10 알을 품다. 1 ML의 피펫 씹다 세포.
  5. 40 μm의 셀 straine를 사용하여 15 ML 원뿔 튜브에 hESC의 미디어와 필터를 추가세포 덩어리를 제거하려면 r.
  6. 5 분 동안 160 XG에 원심 분리기. 신선한 hESC의 미디어에 재현 탁 세포 펠렛 및 잔여 Accutase 솔루션을 제거하는 반복합니다.
  7. 10 μM Y-27632 및 100mm 접시에 총 세포 현탁액을 전송이 젤라틴으로 코팅 된 사전이 포함 hESC의 미디어에 재현 탁 세포.
  8. 30 분의 최소 37 ° C / 5 % CO 2에서 품어.
  9. 이 시간 동안 MEFs는 젤라틴 코팅 접시에 부착됩니다. 신선한 15 ML의 원심 분리기 튜브에 1 ㎖의 피펫을 사용하여 비 부착 인간 배아 줄기를 수집하고 혈구를 사용하여 셀 밀도를 결정한다.

인간 배아 줄기의 3 일렉트로

  1. 0.22 μm의 필터 및 추가 10 NG / ml의 재조합 인간 섬유 아세포 성장 인자 2 (rhFGF2)를 사용하여 필터 CM-MEF 매체.
  2. 5 분 동안 160 XG에서 새로운 15 ML 원뿔 튜브와 원심 분리기 섹션 2.9에서 7.5 × 106 인간 배아 줄기을 전송합니다.
  3. 지수 전자 업계를위한 선택 프로그램 : electroporator를 설정이 시간 동안250 V, 용량 : ctroporation는 다음과 같은 매개 변수, 전압 설정 500 μF, 그리고 저항 : ∞-.
  4. 뜨는을 기음과 얼음처럼 차가운 0.22 μm의 여과 HBSS의 0.8 ml의 세포 펠렛을 다시 일시 중지합니다. 멸균 0.4 cm의 일렉트로 큐벳에 솔루션을 전송합니다.
  5. TV-hPITX3 앞으로 타겟팅 구조 (30 μg DNA)를 추가하고 200 μL 피펫으로 가볍게 섞는다. 5 분 동안 얼음 위에서 배양한다. 이 시간 동안 PITX3 ZFN의 mRNA 한 나누어지는 제거하고 얼음에 해동. 전기 천공 큐벳에 DNA / 세포 혼합물에 전송에게 ZFN의 mRNA의 7.5 μl를 해동합니다. 200 μL 피펫으로 가볍게 섞는다.
    주 : 타겟팅되는 궤적은 효율에 기여 타겟팅 주요 요인이다. 이러한 PITX3 같은 유전자 침묵, ESCS 표현하지 유전자가 어려운 궤적 인코딩은 종래의 상 동성 재조합 (6)을 대상으로하여. 따라서,이 프로토콜은 사용자 DNA 이중 가닥을 유도하기 위해 B 인간 PITX3 궤적 위해 활용한다 ZFNs 설계reak.
  6. electroporator의 화면 지침에 따라 Electroporate.
  7. 200 μL 피펫 10ml로 hESC의 매체를 함유하는 15 ㎖의 튜브에 전기 천공 큐벳에서 컨텐츠를 전송할 사용. hESC의 매체의 200 ㎕의 15 ML 튜브 각 시간과 전송 두 번 큐벳을 씻으십시오. 가있을 것 "점액 같은"파편에 부정적인 세포 생존에 영향을 미칠 용해 세포에서 DNA와 단백질로 구성. 이 파편을 제거하기 위해 5 분 동안 160 XG에 원심 분리기.
  8. 뜨는을 대기음 부드럽게 풀어 세포 펠렛을 누릅니다. 10 μM Y-27632을 포함 MEF-CM 보충 30 ㎖에 다시 일시 중지하고 MEFs와 예비 도금 3 × 100mm 요리에 replate.
  9. 매일 미디어를 변경합니다. 2 일에, Y-27632는 회수 될 수 있고 세포는 hESC의 미디어 만 재배.
  10. 2-3일 후 인간 배아 줄기는 50-70% 합류해야한다. 이 시점에서 항생제 선택 (예를 들어, 0.5 μg / ㎖의 퓨로 마이신)를 시작합니다.
  11. 셀프 유지매일 신선한 hESC의 / 퓨로 마이신 미디어를 추가하여 ection. ~ 칠일 후에 작은 콜로니를 볼 수 있어야합니다. 항생제 내성 MEFs를 사용하지 않는 경우는 MEFs cm 당 2 부가 1.0 × 104 세포를 첨가하여 보충 할 수있다.

4 따기 형질 전환 hESC의 클론

  1. 약 14 - (식민지 ~ 1mm 직경에 도달 한) 선택 다음 21 일 확장과 심사에 대 한 번호판을 준비합니다. 5 시간의 최소 4 ° C에서 마트 리젤 또는 Geltrex의 분취 량을 해동하여 시작합니다. 제조업체의 지침에 따라 희석하고 3 × 96 - 웰 플레이트의 각 웰에 75 μl를 추가합니다. cm 2 당 2.0 × 10 4 세포에 MEFs을 도금 3 × 48 - 웰 플레이트를 준비합니다. 37 ° C / 5 % CO 2에서 두 판 O / N을 품어.
  2. 다음날 격자를 절단하여 2 ml의 피펫의 끝에서 21 G 바늘을 사용하여 16-25 개로 콜로니 해부.
  3. 기음 96 - 웰 플레이트에서 마트 리젤과 supplem로 교체ented CM-MEF 미디어. 48 - 웰 플레이트 한 HBSS와 x와 hESC의 미디어를 추가 씻으 MEFs.
  4. 200 μL 피펫을 사용하여 부드럽게 확장을 위해 48 웰 플레이트에 해부 식민지의 3 분의 전송할 수 있습니다. 보충 CM-MEF 매체를 함유 대응 96 웰 플레이트로 해부 콜로니의 다른 2/3 옮긴다.
  5. 매일 미디어를 변경하여 두 판을 유지 (MEFs를 포함하는 48 웰 플레이트에 96 웰 마트 리겔 코팅 플레이트와 hESC의 미디어를 CM-MEF 매체를 보완, 모두 0.5 μg / ml의 퓨로 마이신으로 보충).
  6. 96 - 웰 플레이트가 100 % 합류 된 후 초기 PCR을 통해 화면까지 확대.

(5) 검사 및 긍정적 인 클론의 확장

  1. 게놈 DNA (11에 따라 방법을) 준비 반전 판에서 모든 미디어를 제거하려면 다음 종이 타월에시킨다.
  2. RT PBS (100 μL / 웰 각 세척), 단계 5.1로 반전하고 오와 각 웰에 두 번 씻어. -80 ° C의 F에서 장소 판또는 1-2 시간이 세포 용해에 도움 (플레이트는 다음과 같이 무한정에 저장 될 수 있습니다.)
  3. 세포가 Sarcosyl 용해 버퍼를 만들 C -80 °에있는 동안 (표 4 참조) (50 μL / 웰). 각 웰에 5 다음 실온에서 분 피펫 용해 버퍼 세포, 따뜻한 판을 용해합니다. 습도를 만들 촉촉한 종이 타월을 포함하는 밀봉 용기에 테이프, 장소, 각 판의 가장자리를 밀봉하고, 60 ° C에서 O / N을 배양한다.
  4. 배양 후, -20 ° C 무수 에탄올 10 ㎖에 500의 NaCl 150 μl를 추가 잘 혼합하고, 각 웰에 100 μl를 추가 (참고 : NaCl을 추가 할 때 에탄올 흐린 갈 것입니다). 탭 판 부드럽게 믹스 (안 피펫을) 및 RT에서 30 분의 최소 떠나. 이 시간 동안 용액은 맑은 꺼지고 DNA가 침전된다.
  5. 다음 각 웰에 70 % 에탄올 150 μl를 추가 단계 5.1에서와 같이 솔루션을 제거합니다. 부드럽게 접시 전환 및 이전시킨다. 이 단계 더 배를 반복합니다.
    참고 : 때문에 침전 된 DNA 자연스럽게 adhE 유전자조직 배양 플라스틱에 입술은 이러한 세척 단계 동안에서 이탈하지 않습니다.)
  6. 최종 세척 후 최고 속도로 간단히 원심 분리 판은 적어도 30 분 동안 실온에서 각 웰 후 자연 건조의 하단 (또는 37 ° C)에 DNA를 집중합니다.
  7. 40 추가 - 50 μL의 T0.1E (pH8.0)을 1 시간 동안 65 ° C에서 각 웰과 장소 플레이트 또는 TE (pH8.0) (표 5 참조) 또는 4 ° CO / N PCR을 위해 사용하기 전에. 부드럽게 플레이트의 측면을 활용하여 DNA를 재현 탁. 다시 중단 DNA / 10 ㎕의 PCR 반응의 1-2 μl를 사용합니다.
  8. 이 hPITX3의 L 팔 세대와 긴 템플릿 PCR 시스템을 확장 사용. F 및 hPITX3의 L 팔 GFP의 R 프라이머는 58 ° C에서 어닐링, 45 초 연장, 35 사이클에서 클론의 초기 검사를 수행합니다.
  9. 1 % 아가 로스 젤 Hyperladder의 1킬로바이트와 Electrophorese 샘플은 45 분 동안 100 V에서 GelRed 및 UV 조명을 통해 긍정적 인 클론을 감지 함유.
  10. expa에서 게놈 DNA를 소화하여 PCR 긍정적 인 클론의 유효성을 검사남부 오 점에 벡터 동성 팔을 HindIII 및 혼성화 프로브 5 '와 3'와 nded 클론 (아래 참조) (이전에 하나의 설명 참조). 프로브는 프라이머 쌍 hPITX3 5 '프로브 F와 R, 및 hPITX3 3'프로브 F와 R,를 EcoRI으로 절단하며, 일반적인 클로닝 벡터에 라이 게이션을 사용하여 PCR에 의해 생성됩니다.
  11. 양성 클론의 수에 따라, MEFs (2 cm 당 2.0 × 104 세포)와 전도금하여 6 - 웰 플레이트의 웰 (2)을 준비한다.
  12. 그 다음날은 1 시간의 최소 10 μM Y-27632와 함께 48 웰 플레이트에 긍정적 인 클론을 전처리.
  13. HBSS에 긍정적 인 클론을 씻고 Accutase의 300 μl를 추가합니다.
  14. 식민지 단일 셀을 렌더링 할 때, hESC의 미디어 1 ㎖를 추가하고 15 ML 튜브에 수집합니다.
  15. 매일 미디어를 변경합니다. 일이에, Y-27632 철회 할 수 있으며, 세포는 hESC의 미디어에서 성장.
  16. 80 % 합류, 계대하고 깔깔 나머지 동결 - 콜로니 70되면뉴욕 조각.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

PITX3와 함께 사용자 정의 설계 PITX3 아연 손가락 쌍의 공동 일렉트로에 따라 - EGFP - 특정 DNA 기증자 벡터, 이후 퓨로 마이신 선택, 양 hESC의 클론은 처음 게놈 PCR 검사 (그림 1)를 통해 검출되었다. 이러한 PCR 5 긍정적 인 클론 '및 3'특정 프로브의 남부 오 하이브리드는 19 %의 효율로, PITX3 궤적 (그림 2)의 한 엑손하는 정확한 타겟팅을 확인했다. 도 3에 도시 된 이미지는 면역 발행 PA6 간질 세포 분화 프로토콜 12,13을 이용하여 분화를 다음 PITX3 프로모터에 의해 구동 EGFP 발현을 보여준다. EGFP의 공동 현지화는 같은 FOXA2 (적색) (그림 3A)과 티로신 수산화 효소 (TH, 빨간색)으로 중뇌 도파민 신경 세포의 마커를 관찰 할 수있다 (그림 3B) 중요한 것은 어떤 공동 현지화 C 동안 GABA 성 마커, 감마 - 아미노 부티르산 (; 빨간색 GABA)으로 관찰 할 수 울드   (그림 3C).

그림 1
PCR 산물 (984 bp의 밴드에서) 같이 그림 1 예비 게놈 PCR 검사. 식민지 따기 및 확장 다음은 예비 게놈 PCR 검사는 많은 양의 클론을 발견했습니다. (클론은. EGFP 유전자에 위치해 있습니다 프라이머 hPITX3의 L 팔 세대. 바로 왼쪽 대상으로 팔의 외측에있는 F, 및 hPITX3의 L 암 GFP R을 사용하여 상영되었다)을 마우스 오른쪽 손과 왼쪽 편 레인 1킬로바이트 아르 사다리입니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

> "법이지 그림이
EGFP의 그림 2 유효성 검사는 인간 배아 줄기에 징크 핑거 뉴 클레아 제를 사용하여 hPITX3 궤적에 대상. 대상의 유효성을 검사하기 위해 사용 남부 오점 전략 (A) 도식. 상단 패널 회로도 타겟팅하기 전에 기본 hPITX3 궤적을 보여줍니다. 하단 패널 회로도는 EGFP 형질 전환 유전자를 올바르게 삽입 다음 hPITX3 궤적을 보여줍니다. 각 패널에서 빨간 선은 5 '와 3'는 남부 오 프로브는 바인딩되는 사이트를 설명하고,도 2b. (B) PCR 사전 심사에서 선택 올바르게 대상 식민지의 대표 남부 오의 대역에 해당합니다. 요약 : EGFP, 강화 된 녹색 형광 단백질; PGK 인간 phosphoglycerol 키나제 프로모터; 순수하지 않아, 퓨로 마이신 내성 유전자. 다른 기능 :에 loxP 사이트, 보라색; 폴리아 데 닐화 서열, BLUE, hPITX3의 엑손, 오렌지. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
도 3 hPITX3-EGFP 인간 배아 줄기는 PA6 / LSB / SAG가 / FGF8 조건에서 분화. (A) FOXA2 (적색), (B) TH (적색) 및 (C) GABA (적색)로 표지 EGFP의 면역 형광 이미지. DAPI (파란색)와 대조. 바, 50 μm의 크기를 조정합니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

PITX3와 함께 사용자 정의 설계 PITX3 아연 손가락 쌍의 공동 일렉트로에 따라 - EGFP의 특이 적 DNA 기증자 벡터, 이후 퓨로 마이신 선택, 양 hESC의 클론은 처음 게놈 PCR 검사 (그림 1)를 통해 검출되었다. 이러한 PCR 5 긍정적 인 클론 '및 3'특정 프로브의 남부 오 하이브리드는 19 %의 효율로, PITX3 궤적 (그림 2)의 한 엑손하는 정확한 타겟팅을 확인했다. 도 3에 도시 된 이미지는 면역 발행 PA6 간질 세포 분화 프로토콜 12,13을 이용하여 분화를 다음 PITX3 프로모터에 의해 구동 EGFP 발현을 보여준다. 중요한 것은 어떤 공동 현지화 GABA 성 마커를 관찰 할 수 없었다 동안, (그림 3B) EGFP의 공동 현지화는 FOXA2 (적색) (그림 3A)과 티로신 수산화 (빨간색 TH) 등의 중뇌 도파민 신경 세포의 마커를 관찰 할 수 , 감마 - 아미노 부티르산 (GABA, 빨간색) (그림 3C).

ontent "fo를하면 : 유지 - together.within 페이지를 ="항상 "> 그림 1
PCR 산물 (984 bp의 밴드에서) 같이 그림 1 예비 게놈 PCR 검사. 식민지 따기 및 확장 다음은 예비 게놈 PCR 검사는 많은 양의 클론을 발견했습니다. (클론은. EGFP 유전자에 위치해 있습니다 프라이머 hPITX3의 L 팔 세대. 바로 왼쪽 대상으로 팔의 외측에있는 F, 및 hPITX3의 L 암 GFP R을 사용하여 상영되었다)을 마우스 오른쪽 손과 왼쪽 편 레인 1킬로바이트 아르 사다리입니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림이
그림 2의 검증EGFP는 인간 배아 줄기에서 징크 핑거 뉴 클레아 제를 사용 hPITX3 궤적 타겟팅. 대상의 유효성을 검사하기 위해 사용 남부 오점 전략 (A) 도식. 상단 패널 회로도 타겟팅하기 전에 기본 hPITX3 궤적을 보여줍니다. 하단 패널 회로도는 EGFP 형질 전환 유전자를 올바르게 삽입 다음 hPITX3 궤적을 보여줍니다. 각 패널에서 빨간 선은 5 '와 3'는 남부 오 프로브는 바인딩되는 사이트를 설명하고,도 2b. (B) PCR 사전 심사에서 선택 올바르게 대상 식민지의 대표 남부 오의 대역에 해당합니다. 요약 : EGFP, 강화 된 녹색 형광 단백질; PGK 인간 phosphoglycerol 키나제 프로모터; 순수하지 않아, 퓨로 마이신 내성 유전자. 다른 기능 :에 loxP 사이트, 보라색; 폴리아 데 닐화 서열, 블루, hPITX3의 엑손, 오렌지. 이 파이의 더 큰 버전을 보려면 여기를 클릭하십시오gure.

그림 3
도 3 hPITX3-EGFP 인간 배아 줄기는 PA6 / LSB / SAG가 / FGF8 조건에서 분화. (A) FOXA2 (적색), (B) TH (적색) 및 (C) GABA (적색)로 표지 EGFP의 면역 형광 이미지. DAPI (파란색)와 대조. 바, 50 μm의 크기를 조정합니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

물질 ㎖ / 100 ㎖의 카탈로그 번호 (공급 업체)
DMEM 89 10566-016 (생명 기술)
태아 혈청 10 16140-071 (생명 기술)
펜 / 패 혈성 1 15070-063 (생명 기술)

표 1.

구성 요소 100mm 요리 60mm 요리 6 잘 48 - 웰 96 웰 75cm 2 플라스크
HBSS 5 ML 2 ML 1 ML 0.5 ml의 0.1 ml의 8 ML
Accutase 5 ML 2 ML 1 ML 0.5 ml의 0.1 ml의 8 ML
디스 파제 5 ML 2 ML 1 ML - - -
hESC의 미디어 10 ML 6 ML 3 ML 0.5 ml의 0.2 ml의 15 ML
마트 리겔 - - - - 0.1ml의 -

표 2.

</ 테이블>

표 3.

물질 ㎖ / 100 ㎖의 카탈로그 번호 (공급 업체)
DMEM / F12 80 11320-033 (생명 기술)
KSR 20 10828-028 (생명 기술)
NEAA 1 11140-050 ​​(생명 기술)
GlutaMAX 1 35050-061 (생명 기술)
펜 / 패 혈성 1 15070-063 (생명 기술)
ß-머 캅토 에탄올 0.1 21985-023 (시그마 - 알드리치)
rhFGF2 7 NG / ㎖ [최종] 233-FB-025 / CF (R & D 시스템)
물질 집중 카탈로그 번호 (공급 업체)
N-Lauroylsarcosine 나트륨 염 용액 (Sarcosyl) 0.5 % (W / v) 61747 (시그마 - 알드리치)
EDTA 10.0 밀리미터 E9884 (시그마 - 알드리치)
염화나트륨 10.0 밀리미터 S3014 (시그마 - 알드리치)
트리스 염소 (pH7.5) 10.0 밀리미터 T3253 (시그마 - 알드리치)
테 K 1.0 ㎎ / ㎖ BIO-37084 (Bioline 호주)

표 4.

물질 집중 카탈로그 번호 (공급 업체)
트리스 염소 (pH8.0) 10.0 밀리미터 T3253 (시그마 - 알드리치)
EDTA (pH8.0) 0.1 mM의 E9884 (시그마 - 알드리치)

표 5.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

리포터 세포주의 생성은, 추적 시각화하고 인간 배아 줄기 유래의 이종 집단으로부터 관심 세포를 분리하기위한 강력한 수단을 제공한다. 그러나, 기존의 상동 재조합을 통해 표적 유전자는 인간의 ESCS 3 매우 비효율적 인 것으로 입증되었습니다. 이 프로토콜에서는 ZFNs 함께 널리 타겟팅 벡터를 이용하여 인간 배아 줄기에서 엑손 PITX3 궤적 중 하나에 RP를 도입하는 비교적 간단한 기술을 설명한다. 우리 손에서 유전자 표적 시스템 (즉, 이전에 6 출판 유사) 제대로 대상 PITX3 궤적을 포함 퓨로 마이신 내성 클론의 19 %로, 효율적입니다.

유전자 타겟팅을 용이하게하기 위해 ZFNs 사용에 제한이 집에서 처음부터 ZFNs 설계에 어려움이있다. 따라서,이 프로토콜에서 우리는 사용자 정의 취득 비용이 많이들 수 있습니다 시판 ZFNs를 디자인했다. & # 사용160; 최근 TALEN 시스템 동성 재조합을 이용한 유전자 타겟팅을 위해 사용되었다. TALENs의 사용은 크게 유전자 편집의 비용을 감소시키고 프로세스를 촉진, 사내에서 설계 될 수있다. 명백하게 본 연구에서 증명되지 않았지만 방법론 동일하다 TALEN 플라스미드 단계 3.5 대신 ZFN의 mRNA에 사용되는 것을 제외하고도 9에 나타낸 바와 같이,이 프로토콜은 쉽게, TALENs의 사용을 포함하도록 변형 될 수있다.

이 기술을 사용하는 경우가 hPSCs 로그 상 성장에 있는지 확인하는 것이 필수적이다 (예를 들어, 배양은 70 % 이상 합류 아니다). 우리는이 세포 분열시 핵 봉투 고장 다음 핵 플라스미드 이익 액세스와 같은 중요하다고 생각합니다. 이 프로세스에 공여 DNA를 통합 분열 동안 상동 지시 수리 악용 더욱이, DNA 공여체 벡터는 DNA 합성 만 다음 DNA에 통합 할게놈.

ZFN 접근법의 또 다른 잠재적 인 제한은 DNA의 도입은 게놈의 다른 곳에서 중단된다. 외부 5 '와 3'프로브 남부 하이브리드는 올바른 통합을 감지하지만 다른 곳 게놈의 추가 통합 이벤트 나 오류가 발생하기 쉬운 수리를 감지하지 않습니다. 엑스트라 통합 이벤트 3,6 SELEX를 사용하여 검출 될 수 ZFN 쌍의 오프 - 타겟 절단 반면 벡터 특정 프로브를 사용하여 서던 혼성화 (예, EGFP)에 의해 검사 될 수있다.

우리가 직접 한 PITX3 유전자의 불 활성화에 기인 할 수 중뇌 도파민 신경 세포의 개발에 명백한 효과를 관찰하지 않았지만, 연구진은 유전자의 한 사본이 중단되는 모든 대상 이벤트에 해로울 수 있다는 것을 명심해야 결과를 분석 할 때 그 셀의 개발은이 점을 고려해야합니다. 이다는 경우는 크게 달라집니다유전자를 표적으로 만 실험을 수행함으로써 확인 될 수있다.

PA6 기반 분화 프로토콜 12,13을 이용하여 우리가 (도 3) 및 정렬 형광 활성화 세포 다음 네거티브 인구 대 양성 EGFP의 qPCR을 분석 면역 형광에 의한 리포터 시스템의 충실도를 확인 할 수 있었다 (데이터는 미도시). PITX3가 중뇌 도파민 성 신경 세포 (14)에 전사 인자의 특정이므로, 인간 PITX3 리포터 세포주의 엔지니어링 어느 체외 PD 모델링 또는 세포 대체 요법의 연구에서 인간 배아 줄기로부터 유도 PITX3 + 중뇌 도파민 성 신경 세포의 사용을 용이하게한다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자가 공개하는 게 없다.

Acknowledgments

이 프로토콜에 설명 된 작품은 재생 의료에 대한 캘리포니아 연구소 (CIRM)와 공동 제휴의 일환으로 빅토리아 정부에서 자금을 지원에 의해 가능하게되었다.

Materials

Name Company Catalog Number Comments
Mouse Embryonic Fibroblasts (DR4) GlobalStem GSC-6004G
Gelatin Sigma G1393-100ML
HBSS, no Calcium, no Magnesium, no Phenol Red (HBSS) Life Technologies 14175-095
Dispase StemCell Technologies 7923
Cell Scraper Corning 3008
Accutase Life Technologies A11105-01
Y27632 Axon Medchem Axon 1683
Cell Strainer - 40 μm BD Biosciences 352340
33 mm - 0.22 μm filter Millipore SLGP033RS
rhFGF2 R&D Systems 233-FB-025/CF
Electroporator BioRad 165-2661
0.4 cm electroporation cuvette BioRad 165-2088
Human TV-hPITX3-forward targeting construct Addgene 31942
ZFN Kit; Human PITX3 Sigma-Aldrich CKOZFN1050-1KT
Puromycin InvivoGen ant-pr-1
Matrigel BD Biosciences 354277
Geltrex Life Technologies A1569601
NaCl Sigma-Aldrich S3014
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 10566-016
Fetal Bovine Serum, Qualified, Heat Inactivated, US Origin (FBS) Life Technologies 16140-071
Pen/Strep Life Technologies 15070-063
Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12) Life Technologies 11320-033
KnockOut Serum Replacement (KSR) Life Technologies 10828-028
MEM Non-Essential Amino Acids  (NEAA) Life Technologies 11140-050
GlutaMAX Life Technologies 35050-061
ß-mercaptoethanol Life Technologies 21985-023
N-Lauroylsarcosine sodium salt solution (Sarcosyl) (30%) Sigma-Aldrich 61747
EDTA Sigma-Aldrich E9884
Trizma Hydrochloride Sigma-Aldrich T3253
Proteinase K solution (20 mg/ml) Bioline Australia BIO-37084
Expand Long Template PCR System Roche Australia 11681834001
hPITX3 L arm gen. F (primer): 5’ TGTCCTAAGGAGAATGGGTAACAGACA 3’ GeneWorks, Australia
hPITX3 L arm GFP R (primer): 5’ ACACGCTGAACTTGTGGCCGTTTA 3’ GeneWorks, Australia
HyperLadder 1 kb  Bioline Australia BIO-33025
GelRed Jomar Bioscience, Australia 41003

DOWNLOAD MATERIALS LIST

References

  1. Nefzger, C. M., et al. Lmx1a Allows Context-Specific Isolation of Progenitors of GABAergic or Dopaminergic Neurons During Neural Differentiation of Embryonic Stem Cells. Stem Cells. 30, (7), 1349-1361 (2012).
  2. Zeng, W. R., Fabb, S. R. A., Haynes, J. M., Pouton, C. W. Extended periods of neural induction and propagation of embryonic stem cell-derived neural progenitors with EGF and FGF2 enhances Lmx1a expression and neurogenic potential. Neurochemistry International. 59, (3), 394-403 (2011).
  3. Collin, J., Lako, M. Concise review: putting a finger on stem cell biology: zinc finger nuclease-driven targeted genetic editing in human embryonic stem cells. Stem Cells. 29, (7), 1021-1033 (2011).
  4. Carroll, D. Progress and prospects: zinc-finger nucleases as gene therapy agents. Gene Therapy. 15, (22), 1463-1468 (2008).
  5. Urnov, F. D., et al. Highly efficient endogenous human gene correction using designed zinc-finger nucleases. Nature. 435, (7042), 646-651 (2005).
  6. Hockemeyer, D., et al. Efficient targeting of expressed and silent genes in human ESCs and iESCs using zinc-finger nucleases. Nature Biotechnology. 27, (9), 851-857 (2009).
  7. Lombardo, A., et al. Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery. Nature Biotechnology. 25, (11), (2007).
  8. Boch, J., Bonas, U. Xanthomonas AvrBs3 family-type III effectors: discovery and function. Annual Review of Phytopathology. 48, 419-436 (2010).
  9. Hockemeyer, D., et al. Genetic engineering of human embryonic cells using TALE nucleases. Nature Biotechnology. 29, (8), 731-734 (2011).
  10. Tucker, K. L., Wang, Y., Dausman, J., Jaenisch, R. A transgenic mouse strain expressing four drug-selectable marker genes. Nucleic Acids Research. 25, (18), 3745-3746 (1997).
  11. Ramírez-Solis, R., Rivera-Pérez, J., Wallace, J. D., Wims, M., Zheng, H., Bradley, A. Genomic DNA microextraction: a method to screen numerous samples. Analytical Biochemistry. 201, (2), 331-335 (1992).
  12. Kawasaki, H., et al. Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity. Neuron. 28, (1), 31-40 (2000).
  13. Denham, M., Thompson, L. H., Leung, J., Pébay, A., Björklund, A., Dottori, M. Gli1 is an inducing factor in generating floor plate progenitor cells from human embryonic stem cells. Stem Cells. 28, (10), 1805-1815 (2010).
  14. Smidt, M. P., et al. A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons. Proceedings of the National Academy of Sciences U.S.A. 94, 13305-13310 (1997).
인간 배아 줄기 세포에 표적으로 아연 손가락 핵산 분해 효소 향상된 유전자
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hartley, B. J., Fabb, S. A., Finnin, B. A. L., Haynes, J. M., Pouton, C. W. Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells. J. Vis. Exp. (90), e51764, doi:10.3791/51764 (2014).More

Hartley, B. J., Fabb, S. A., Finnin, B. A. L., Haynes, J. M., Pouton, C. W. Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells. J. Vis. Exp. (90), e51764, doi:10.3791/51764 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter