Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Nucleasa dedo de zinc-gen mejorada en células madre embrionarias humanas

doi: 10.3791/51764 Published: August 23, 2014

Summary

Líneas celulares Reporter ofrecen un medio para visualizar, controlar y aislar las células de interés por parte de las poblaciones heterogéneas. Sin embargo, gen de la orientación mediante recombinación homóloga convencional en células madre de embriones humanos es extremadamente ineficiente. Aquí se describe la orientación del SNC locus cerebro medio específico Pitx3 factor de transcripción con EGFP usando nucleasa dedo de zinc mejorado recombinación homóloga.

Abstract

Una de las principales limitaciones con células madre embrionarias (ESC) protocolos de diferenciación actuales es la generación de poblaciones de células heterogéneas. Estos cultivos contienen las células de interés, pero también se contaminan con los CES indiferenciadas, derivados no neurales y otros subtipos neuronales. Esto limita su uso en in vitro y en aplicaciones in vivo, tales como el modelado in vitro para el descubrimiento de fármacos o la terapia de reemplazo celular. Para ayudar a superar esto, las líneas celulares reporteras, que ofrecen un medio para visualizar, controlar y aislar las células de interés, se pueden diseñar. Sin embargo, para lograr esto en células madre embrionarias humanas a través de recombinación homóloga convencional es extremadamente ineficiente. Este protocolo describe la orientación de la homeobox pituitaria 3 (Pitx3) locus de células madre embrionarias humanas mediante nucleasas de dedos de zinc de diseño personalizado, que introducen rupturas de doble hebra de ADN específicas del lugar, junto con unPitx3 - EGFP específico de vector donante de ADN. Después de la generación de la línea celular reportera Pitx3, entonces se puede diferenciar usando protocolos publicados para su uso en estudios in vitro tales como el modelado de la enfermedad o el reemplazo de células en la terapia de Parkinson.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Células madre embrionarias (ESC) protocolos de diferenciación actuales resultan en poblaciones de células heterogéneas, particularmente con respecto a la derivación de fenotipos neuronales específicas. Por lo tanto, aunque los cultivos contienen el fenotipo celular deseada, otra neuronal, tipos celulares disociados de la ONU no neuronal y están a menudo presentes 1. Estas características limitan la aplicación de ESC deriva fuentes de células para su uso en la terapia de reemplazo celular y en el modelado de la enfermedad vitro.

Líneas celulares reporteras genéticos ofrecen un medio para visualizar, rastrear y aislar las células de interés, a condición de que la expresión de la proteína indicadora (RP) reproduce la expresión endógena. El uso de promotores inmediatamente aguas arriba de una región codificante del gen se puede utilizar para derivar reporteros genéticos crudo pero tales construcciones carecen de los elementos reguladores precisos que controlan la expresión génica endógena. En contraste, la recombinación homóloga ofrece laoportunidad de asegurar la expresión de alta fidelidad de la RP. En el pasado, apuntando vectores diseñados para la recombinación homóloga en los loci específico de interés se han utilizado para RPs en ratón CES (mESCs) apuntar usando electroporación como medio de suministro de ADN 1,2. Sin embargo, la generación de líneas celulares reportero a través de recombinación homóloga convencional es extremadamente ineficiente para CME humanas (hESCs), y por tanto sólo se ha documentado en un puñado de casos (revisado en 3). Mediante el uso de una proteína quimérica de ingeniería que contiene una fusión de una nucleasa Fok I con motivos de dedos de zinc específicos del sitio, conocidas colectivamente como nucleasas de dedos de zinc (ZFNs), la DNA se rompe la doble cadena se pueden introducir en loci genómico predeterminado. Cuando se añade un vector de ADN con homología a ambos lados de la ruptura del ADN de doble cadena, el sitio genómico se puede reparar mediante recombinación homóloga, permitiendo la incorporación de la secuencia donante de ADN. Esta técnica ha demostrado ser útil fo edición genómico tanto en las células primarias humanas 4,5 y 6,7 hESCs. Un trabajo más reciente de transcripción ha utilizado activador de nucleasas efectoras (Talens), factores de transcripción utilizados por fitopatógenos 8, para ayudar en el diseño de nucleasas específicas de sitio 9.

En el siguiente protocolo se demuestra la generación de una línea celular de células madre reportero por electroporación de un EGFP que contiene homóloga vector de orientación 6 junto con ZFNs para el homeobox pituitaria humana 3 (Pitx3) locus. Tras la selección de antibióticos durante 2-3 semanas, hESCs con ADN integrado correctamente pueden ser recogidos manualmente, se expandieron y se seleccionaron inicialmente mediante PCR, y posteriormente validados por transferencia de Southern.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Todos los procedimientos se llevaron a cabo en una campana de flujo laminar estéril. Todos los medios y soluciones se equilibraron a 37 ° C a menos que se especifique lo contrario.

1. Ampliación del PSC Humanos (hESCs y hiPSCs, WA-09 utilizado en el presente Protocolo) para la transfección

Nota: No es necesario ampliar hESCs en Matrigel o Geltrex. hESCs Ampliado de fibroblastos de embriones de ratón (MEFs) pueden ser utilizados para la electroporación o nucleofection después de una etapa de eliminación del MEF (ver sección 2.8).

  1. Preparar 1 x 100 mm plato y 1 x frasco de 75cm2 DR4 MEFs a 2,0 x 10 4 células por cm 2 en los medios de comunicación del MEF (ver Tabla 1) en los platos pre-recubierto con 0,1% w / v de gelatina.
    Nota: CF1, BLK6 o MF1 MEFs se puede utilizar, sin embargo, se recomienda que se utilicen líneas MEF resistentes a los antibióticos, por ejemplo, DR410.
  2. Al día siguiente, hESCs paso en una placa de 100 mm pre-plateado con MEFs preparados en la sección 1.1. Para ello aspitasa hESC medios de culturas platos, lavar hESCs con solución salina equilibrada de Ca2 + / Mg2 + exento de Hanks (HBSS), añadir Dispasa (ver Tabla 2 en volúmenes apropiados), y meterlo en un incubador humidificado a 37 ° C / 5% de CO 2. Después de 3-5 minutos de incubación, aspirado Dispasa y suavemente lavar 1-2 veces con HBSS para eliminar MEFs. Añadir medios células madre (véase la Tabla 3) y usando un raspador de células, o 5 ml pipeta, raspar suavemente las colonias de la superficie de la placa de cultivo.
  3. Recoger los fragmentos de colonias en la suspensión de la placa de cultivo en un tubo de centrífuga de 15 ml. Placa de cultivo Enjuague con medios de comunicación y traslado al tubo de 15 ml de células madre. Tenga cuidado de no romper los grumos en células individuales o pequeños fragmentos.
  4. Centrifugar durante 5 minutos a 160 xg para sedimentar los fragmentos de colonias.
  5. Aspirar el sobrenadante. Toque en el fondo del tubo de 15 ml con el dedo para aflojar colonia fragmento de pellets. Fragmentos suavemente volver a suspender las colonias en medios de células madre según la relación de división (normallya dividir relación entre 1: 4 y 1: 8 es apropiado). Tenga mucho cuidado de no hacer grumos en las células individuales o pequeños fragmentos ya que esto afectaría replating eficiencia.
  6. Antes de resiembra fragmentos de células madre en MEFs lavan 1 vez con HBSS. Poco a poco agregue la cantidad apropiada (véase la Tabla 2) de la suspensión de células que contiene fragmentos de células madre en los medios de comunicación de células madre a los platos pre-plateados, MEFs.
  7. Coloque placas de cultivo en la repisa en la incubadora y se mueven lentamente hacia adelante y hacia atrás y de lado a otro para distribuir uniformemente fragmentos de colonias.
  8. Vuelva a colocar los medios de comunicación de células madre a diario.
  9. Para preparar los medios de MEFs (MEF-CM) acondicionado lavar el 75 cm 2 frasco de pre-plateado con MEFs 1 x con HBSS. Añadir medios hESC. Después de 24 horas, recoja medio condicionado y reemplazar con los medios de comunicación hESC fresco. Repita todos los días durante un máximo de 12 días. Almacenar MEF-CM a 4 ° C hasta que se necesite.

2 Preparación de los CES Humanos de transfección

  1. Observar el crecimiento de hESCsbajo un microscopio todos los días. Cuando las colonias se convierten en un 40-50% de confluencia, la placa 3 x 100 mm platos con 2,0 x 10 5 MEFs por cm 2.
  2. Cuando las colonias se convierten en 60 - 70% de confluencia que están listos para ser transfectadas. 'novio' colonias mediante la eliminación de colonias diferenciadas o núcleos de colonias.
    Nota: Como creemos más alta eficiencia de transfección y dirigidos ocurren cuando las células están en fase logarítmica de crecimiento, se sugiere que la electroporación se llevó a cabo antes de hESCs alcanzan ≥ 70% de confluencia.
  3. Lávese las colonias de células madre con HBSS y añadir Accutase.
    Nota: No es necesario hESCs el pretratamiento con el inhibidor ROCA Y-27632 de inhibición suficiente se producirá cuando se incubaron con Y-27632 durante el paso 2.7
  4. Incubar durante 10 - 20 min a 37 ° C / 5% de CO 2 hasta que las colonias se vuelven células individuales como se observa bajo un microscopio. Las células se tritura con una pipeta de 1 ml.
  5. Añadir medios hESC y filtro en un tubo cónico de 15 ml utilizando un Straine 40 micras celularR para eliminar grupos de células.
  6. Se centrifuga a 160 × g durante 5 min. Resuspender pellet de células en medios de células madre recién reconstituido y repetir para eliminar cualquier solución Accutase residual.
  7. Resuspender las células en los medios de comunicación de células madre que contienen 10 M Y-27632 y transferir la suspensión total de células a una placa de 100 mm pre-recubierto con gelatina.
  8. Se incuba a 37 ° C / 5% de CO2 durante un mínimo de 30 min.
  9. Durante este tiempo MEFs se adhiere al plato de gelatina recubierta. Recoger hESCs no adherentes utilizando una pipeta de 1 ml en un tubo de centrífuga de 15 ml fresco y determinar la densidad de células usando un hemocitómetro.

3. electroporación de hESCs

  1. Los medios filtrantes-CM MEF que utilizan un filtro de 0,22 micras y añadir 10 ml de factor de crecimiento / fibroblasto humano recombinante ng 2 (rhFGF2).
  2. Transferir 7,5 x 106 hESCs de la sección 2.9 a un nuevo tubo cónico de 15 ml y centrifugar a 160 xg durante 5 min.
  3. Durante este tiempo configurar el electroporador: Seleccione el programa para ele exponencialctroporation y establezca los siguientes parámetros, Voltaje: 250 V, capacitancia: 500 mF, y Resistance: ∞-.
  4. Aspirar el sobrenadante y volver a suspender pellet de células en 0,8 ml de helado de 0,22 micras HBSS filtrada. Transfiera la solución a un 0,4 cm cubeta de electroporación estéril.
  5. Añadir construcción de la orientación TV-hPITX3-forward (30 g de ADN) y mezclar suavemente con una pipeta de 200 l. Incubar en hielo durante 5 min. Durante este tiempo, retirar una alícuota de Pitx3 ZFN ARNm y descongelar en hielo. Cuando descongelado transferencia de 7,5 l de ADN ZFN ARNm para mezcla / célula en cubeta de electroporación. Mezclar suavemente con una pipeta de 200 l.
    Nota: El lugar está dirigido es el principal factor que contribuye a la eficiencia de la focalización. Codificación Loci genes silenciosos, los genes no se expresan en los CES, como Pitx3 son difíciles de destino mediante recombinación homóloga convencional 6. Por lo tanto, este protocolo utiliza ZFNs diseñado a medida para el locus Pitx3 humana para inducir un ADN de doble cadena break.
  6. Electroporar siguiendo las instrucciones que aparecen en pantalla en el electroporador.
  7. Usando una pipeta transferir 200 l el contenido de la cubeta de electroporación de un tubo de 15 ml que contiene 10 ml de medio de células madre. Lave la cubeta dos veces con 200 l de los medios de comunicación de células madre cada vez y de transferencia a un tubo de 15 ml. Habrá "-mucosa como" escombros formado por ADN y proteínas de las células lisadas que repercutirán negativamente en la supervivencia celular. Se centrifuga a 160 g durante 5 minutos para eliminar estos desechos.
  8. Aspirar el sobrenadante y golpee suavemente sedimento celular para aflojar. Vuelva a suspender en 30 ml suplementadas MEF-CM que contienen 10 M Y-27632 y replate a 3 x 100 mm platos preplated con MEFs.
  9. Cambie los medios de comunicación todos los días. El día 2, Y-27632 puede ser retirado y las células cultivadas en los medios de prensa de células madre.
  10. Después de 2-3 días los hESCs deben ser 50-70% de confluencia. En este punto, comenzará la selección de antibióticos (por ejemplo, 0,5 mg / ml de puromicina).
  11. Mantener selexión añadiendo fresca medios hESC / puromicina diaria. Después de ~ 7 días pequeñas colonias deben ser visibles. Si no se utilizan MEFs resistentes a los antibióticos, MEFs se puede complementar con la adición de una células adicionales 1,0 x 10 4 por cm 2.

4. Picking clones transgénicos de células madre

  1. Aproximadamente el 14 - 21 días después de la selección (cuando las colonias han alcanzado ~ 1 mm de diámetro) se preparan placas de expansión y proyección. Comience por descongelar una alícuota de Matrigel o Geltrex a 4 ° C durante un mínimo de 5 horas. Diluir según las instrucciones del fabricante y añadir 75 l a cada pocillo de placas de 3 x 96 pocillos. Preparar placas 3 x 48 pocillos en placas MEF a 2,0 x 10 4 células por cm 2. Incubar ambas placas O / N a 37 ° C / 5% de CO 2.
  2. El día siguiente diseccionar colonias en 16-25 pedazos usando una aguja 21 en el extremo de una pipeta de 2 ml mediante la reducción de una cuadrícula.
  3. Aspirar Matrigel de placas de 96 pocillos y reemplazar con suplemmedios entados CM-MEF. Lave MEFs en placas de 48 pocillos 1 x con HBSS y añadir medios células madre.
  4. Usando una pipeta de 200 l transferir suavemente tercio de la colonia diseccionado en una placa de 48 pocillos para la expansión. Transferir el otro 2/3 de la colonia diseccionado en una placa de 96 pocillos correspondiente que contiene medios suplementados CM-MEF.
  5. Mantener ambas placas cambiando los medios de comunicación al día (complementado los medios de comunicación CM-MEF para placas Matrigel de 96 pocillos recubiertos y medios de células madre para placas de 48 pocillos que contenían MEFs; tanto suplementado con 0,5 mg / ml de puromicina).
  6. Expandir hasta placas de 96 pocillos son 100% confluentes y luego inicialmente pantalla a través de PCR.

5. Selección y expansión de clones positivos

  1. Para preparar ADN genómico (método basado en 11) eliminar todos los soportes de las placas mediante la inversión, luego seque sobre toallas de papel.
  2. Enjuague cada pocillo dos veces con PBS RT (100 l / pocillo de cada lavado), invertido y blot como para el paso 5.1. Coloque las placas a -80 ° C fo 1 - 2 horas para ayudar en la lisis celular (placas pueden almacenarse indefinidamente como este).
  3. Mientras que las células son a -80 ° C. hacer Sarcosilo tampón de lisis (véase la Tabla 4) (50 l / pocillo). Para lisar las células, placas calientes durante 5 min a TA, luego tampón de lisis pipeta en cada pocillo. Selle los bordes de cada placa con cinta, colocar en un recipiente hermético que contiene toallas de papel húmedas para crear la humedad, e incubar O / N a 60 ° C.
  4. Después de la incubación añadir 150 l de NaCl 5 M a 10 ml de -20 ° C etanol absoluto, se mezcla bien y añadir 100 ml a cada pocillo (Nota: etanol irá turbia cuando se añade NaCl). Golpeadores suavemente para mezclar (no pipeta) y salen por un mínimo de 30 minutos a temperatura ambiente. Durante este tiempo la solución irá claro y el ADN se precipitará.
  5. Retire la solución como en el paso 5.1 a continuación, añadir 150 l de etanol al 70% a cada pocillo. Invierta la placa suavemente y secar como antes. Repita este paso una mayor 2x.
    Nota: Debido a que el ADN precipitado natural adheres a la de plástico de cultivo de tejidos que no se desplacen durante estas etapas de lavado.)
  6. Después del lavado final placas de centrifugar brevemente a la máxima velocidad para concentrar el ADN a la parte inferior de cada pocillo a continuación secar al aire a temperatura ambiente (o 37 ° C) durante al menos 30 min.
  7. Añadir 40 - 50 l T0.1E (pH 8,0) (véase la Tabla 5) o TE (pH 8,0) a cada pocillo y colocar las placas a 65 ° C durante 1 hora oa 4 ° CO / N antes de usarlo por PCR. Resuspender el ADN golpeando suavemente los lados de la placa. Utilice 1-2 l de re-suspendido de ADN / 10 l de reacción de PCR.
  8. Usando el Sistema de Alto PCR Expand Plantilla con brazo hPITX3 L gen. F y cebadores GFP brazo hPITX3 R L realizan la selección inicial de los clones a 58 ° C de recocido, extensión 45 seg, 35 ciclos.
  9. Muestras de electroforesis con 1kb Hyperladder en un gel de agarosa al 1% que contiene GelRed a 100 V durante 45 min y detectar los clones positivos a través de iluminación UV.
  10. Validar clones positivos de PCR mediante la digestión de ADN genómico de expaclones nded (ver más abajo) con HindIII y de hibridación sondas 5 'y 3' de los brazos de homología del vector a una transferencia Southern (como se ha descrito anteriormente en 1). Las sondas se generaron por PCR utilizando los pares de cebadores hPITX3 5 'de la sonda F y R, y hPITX3 3' de la sonda F y R, se digirió con EcoRI y se ligó en un vector de clonación general.
  11. Dependiendo del número de clones positivos, preparar 2 pocillos de una placa de 6 pocillos pre-chapado con MEFs (2,0 x 10 4 células por cm 2).
  12. Al día siguiente pretratar clones positivos en la placa de 48 pocillos con 10 M Y-27632 durante un mínimo de 1 hr.
  13. Lave clones positivos con HBSS y añadir 300 l de Accutase.
  14. Cuando las colonias se vuelven células individuales, añadir 1 ml de medio de células madre y recoger en un tubo de 15 ml.
  15. Cambie los medios de comunicación todos los días. El día 2, Y-27632 puede ser retirado y las células cultivadas en medios de células madre.
  16. Cuando las colonias son de 70 - 80% de confluencia, subcultura y congelar el resto de la colofragmentos ny.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Después de co-electroporación de la Pitx3 par zinc-finger de diseño personalizado junto con el Pitx3 - EGFP ADN específico de vector donante, y la selección de puromicina posterior, los clones de células madre positivas se detectaron inicialmente a través de la selección por PCR genómico (Figura 1). Hibridación de transferencia Southern de estos clones positivos de PCR con 5 'y 3' sondas específicas confirmó la orientación correcta para el exón 1 del locus Pitx3 (Figura 2), con una eficiencia del 19%. Imágenes de inmunofluorescencia muestran en la Figura 3 demuestran la expresión de EGFP dirigido por el promotor Pitx3 después de la diferenciación de células del estroma usando un protocolo de diferenciación PA6 publicada 12,13. Co-localización de EGFP se pudo observar con los marcadores de las neuronas dopaminérgicas del mesencéfalo tales como FOXA2 (rojo) (Figura 3A) y la tirosina hidroxilasa (TH; rojo) (Figura 3B), mientras que importante no co-localización c Ould ser observado con el marcador GABAérgica, ácido gamma-aminobutírico (GABA; rojo)   (Figura 3C).

Figura 1
Figura 1. selección por PCR genómica preliminar. Después de la recolección y la expansión de colonias, selección preliminar genómico PCR detectó numerosos clones positivos como se muestra por el producto de la PCR (banda a 984 pb). (Los clones fueron seleccionados utilizando primers brazo hPITX3 L gen. F, que se encuentra a las afueras del brazo de guía izquierdo y brazo hPITX3 L GFP R que se encuentra dentro del gen EGFP.) De la mano derecha y los carriles laterales de la izquierda son un 1 kb escalera. Haga clic aquí para ver una versión más grande de esta figura.

iempre "> Figura 2
Figura 2. Validación de EGFP dirigido al locus hPITX3 mediante nucleasas de dedos de zinc en hESCs. (A) Esquema de la estrategia de transferencia de Southern empleado para validar la focalización. El panel superior esquemática ilustra el locus hPITX3 nativa antes de la orientación. El esquema panel inferior representa el locus hPITX3 siguiente la correcta inserción del transgén EGFP. Las líneas rojas debajo de cada panel ilustran los sitios en los que el 5 'y 3' sondas Southern blot se unirán, y corresponden a las bandas en la Figura 2B. (B) Southern blot Representante de colonias correctamente dirigidos seleccionados de PCR pre-selección. Abreviaturas: EGFP, proteína fluorescente verde mejorada; PGK, promotor de fosfoglicerol quinasa humana; PURO, gen de resistencia a puromicina. Otras características: sitios loxP, púrpura; secuencia de poliadenilación, blue, exones hPITX3, naranja. Por favor haga clic aquí para ver una versión más grande de esta figura.

Figura 3
Figura 3.-EGFP hPITX3 hESCs diferenciarse en condiciones PA6 / LSB / SAG / FGF8. Imágenes de inmunofluorescencia de EGFP marcado con (A) FOXA2 (rojo), (B) TH (rojo) y (C) GABA (rojo). Counterstained con DAPI (azul). Escalas bares, 50 m. Por favor haga clic aquí para ver una versión más grande de esta figura.

Después de co-electroporación del Pitx3 par zinc-finger diseño personalizado junto con el Pitx3 - EGFP específico de Vector de ADN de los donantes, y la selección de puromicina posterior, clones de células madre positivos fueron detectados inicialmente a través de la selección por PCR genómica (Figura 1). Hibridación de transferencia Southern de estos clones positivos de PCR con 5 'y 3' sondas específicas confirmó la orientación correcta para el exón 1 del locus Pitx3 (Figura 2), con una eficiencia del 19%. Imágenes de inmunofluorescencia muestran en la Figura 3 demuestran la expresión de EGFP dirigido por el promotor Pitx3 después de la diferenciación de células del estroma usando un protocolo de diferenciación PA6 publicada 12,13. Co-localización de EGFP se pudo observar con los marcadores de las neuronas dopaminérgicas del mesencéfalo tales como FOXA2 (rojo) (Figura 3A) y la tirosina hidroxilasa (TH; rojo) (Figura 3B), mientras que importante no co-localización se pudo observar con el marcador GABAérgica , ácido gamma-aminobutírico (GABA; rojo) (Figura 3C).

ontenido "fo: keep-together.within-page =" always "> Figura 1
Figura 1. selección por PCR genómica preliminar. Después de la recolección y la expansión de colonias, selección preliminar genómico PCR detectó numerosos clones positivos como se muestra por el producto de la PCR (banda a 984 pb). (Los clones fueron seleccionados utilizando primers brazo hPITX3 L gen. F, que se encuentra a las afueras del brazo de guía izquierdo y brazo hPITX3 L GFP R que se encuentra dentro del gen EGFP.) De la mano derecha y los carriles laterales de la izquierda son un 1 kb escalera. Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2. Validación deEGFP dirigido al locus hPITX3 mediante nucleasas de dedos de zinc en hESCs. (A) Esquema de la estrategia de transferencia de Southern empleado para validar la focalización. El panel superior esquemática ilustra el locus hPITX3 nativa antes de la orientación. El esquema panel inferior representa el locus hPITX3 siguiente la correcta inserción del transgén EGFP. Las líneas rojas debajo de cada panel ilustran los sitios en los que el 5 'y 3' sondas Southern blot se unirán, y corresponden a las bandas en la Figura 2B. (B) Southern blot Representante de colonias correctamente dirigidos seleccionados de PCR pre-selección. Abreviaturas: EGFP, proteína fluorescente verde mejorada; PGK, promotor de fosfoglicerol quinasa humana; PURO, gen de resistencia a puromicina. Otras características: sitios loxP, púrpura; secuencia de poliadenilación, azules, los exones hPITX3, naranja. Haga clic aquí para ver una versión más grande de esta figura.

Figura 3
Figura 3.-EGFP hPITX3 hESCs diferenciarse en condiciones PA6 / LSB / SAG / FGF8. Imágenes de inmunofluorescencia de EGFP marcado con (A) FOXA2 (rojo), (B) TH (rojo) y (C) GABA (rojo). Counterstained con DAPI (azul). Escalas bares, 50 m. Por favor haga clic aquí para ver una versión más grande de esta figura.

Sustancia ml / 100 ml Catálogo No. (Proveedor)
DMEM 89 10566-016 (Life Technologies)
Suero bovino fetal 10 16140-071 (Life Technologies)
Pen / Strep 1 15070-063 (Life Technologies)

Tabla 1.

Componente 100 mm plato 60 mm plato 6-así De 48 pocillos De 96 pocillos 75cm 2 frasco
HBSS 5 ml 2 ml 1 ml 0,5 ml 0,1 ml 8 ml
Accutase 5 ml 2 ml 1 ml 0,5 ml 0,1 ml 8 ml
Dispasa 5 ml 2 ml 1 ml - - -
medios de células madre 10 ml 6 ml 3 ml 0,5 ml 0,2 ml 15 ml
Matrigel - - - - 0,1 ml -

Tabla 2.

</ Table>

Tabla 3.

Sustancia ml / 100 ml Catálogo No. (Proveedor)
DMEM / F12 80 11320-033 (Life Technologies)
KSR 20 10828-028 (Life Technologies)
NEAA 1 11140-050 (Life Technologies)
GlutaMAX 1 35050-061 (Life Technologies)
Pen / Strep 1 15070-063 (Life Technologies)
ß-mercaptoetanol 0,1 21985-023 (Sigma-Aldrich)
rhFGF2 7 ng / ml [definitiva] 233-FB-025 / CF (R & D Systems)
Sustancia Concentración Catálogo No. (Proveedor)
Solución de sal de sodio de N-lauroilsarcosina (Sarcosilo) 0.5% (w / v) 61747 (Sigma-Aldrich)
EDTA 10,0 mM E9884 (Sigma-Aldrich)
NaCl 10,0 mM S3014 (Sigma-Aldrich)
Tris-Cl (pH 7,5) 10,0 mM T3253 (Sigma-Aldrich)
Proteinasa K 1,0 mg / ml BIO-37084 (Bioline Australia)

Tabla 4.

Sustancia Concentración Catálogo No. (Proveedor)
Tris-Cl (pH 8,0) 10,0 mM T3253 (Sigma-Aldrich)
EDTA (pH 8,0) 0,1 mM E9884 (Sigma-Aldrich)

Tabla 5.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La generación de líneas celulares reporteras ofrece un medio poderoso para realizar un seguimiento, visualizar y aislar células de interés a partir de una población heterogénea derivadas de hESCs. Sin embargo, la orientación de genes por recombinación homóloga convencional ha demostrado ser extremadamente ineficiente para humanos CES 3. En este protocolo se describe una técnica relativamente sencilla para la introducción de un RP en el exón uno de los locus Pitx3, en hESCs usando un vector de orientación ampliamente disponibles, junto con ZFNs. En nuestras manos el sistema de selección de genes es eficiente, con un 19% de los clones resistentes a puromicina contienen un locus Pitx3 correctamente orientada (similar a la previamente publicada el 6).

Una limitación con el uso de ZFNs para facilitar la orientación de genes es la dificultad en el diseño de ZFNs desde cero en casa. Por lo tanto, en este protocolo hemos utilizado diseñamos a medida ZFNs disponibles en el mercado, que pueden ser caros de adquirir. & #160; Más recientemente, el sistema TALEN se ha utilizado para la orientación de genes usando recombinación homóloga 9. El uso de Talens reduce en gran medida el costo de la edición de genes y puede ser diseñado en la casa, acelerar el proceso. Aunque no se ha demostrado de forma explícita en este estudio, este protocolo puede ser fácilmente modificado para incorporar el uso de Talens como la metodología es la misma, excepto TALEN plásmidos se utilizan en el paso 3.5 en lugar de ZFN ARNm, como se muestra en 9.

Al utilizar esta técnica es imprescindible para asegurar que hPSCs están en fase logarítmica de crecimiento, (por ejemplo, las culturas no son el 70% o más confluente). Creemos que esto es crítico como el plásmido obtiene acceso al núcleo siguiente desglose envoltura nuclear durante la división celular. Por otra parte, el vector donante de ADN sólo incorporar en el ADN tras la síntesis de ADN ya que este proceso de reparación explota homología dirigida durante la división para incorporar el ADN del donante en elgenoma.

Otra limitación potencial con el enfoque ZFN es la introducción de ADN se rompe en otras partes del genoma. Aunque la hibridación de Southern con externa 5 'y 3' de las sondas detecta correcta integración no detectará eventos de integración adicionales o reparación propenso a errores en otras partes del genoma. Eventos de integración adicionales pueden ser examinadas mediante hibridación Southern utilizando sondas específicos del vector (por ejemplo, EGFP), mientras que fuera de objetivo escisión de los pares ZFN puede detectarse utilizando SELEX 3,6.

Aunque no se observó ningún efecto obvio en el desarrollo de las neuronas dopaminérgicas del cerebro medio que puede atribuirse directamente a la inactivación de un gen Pitx3, los investigadores deben tener en cuenta que cualquier caso la orientación en la que se interrumpe una copia de un gen puede ser perjudicial para la desarrollo de esa celda y debe tener esto en cuenta al analizar los resultados. Si este es el caso dependerá en gran medidaen el gen de ser blanco y sólo puede ser determinado mediante la realización del experimento.

El uso de un protocolo de diferenciación basada PA6 12,13 pudimos confirmar la fidelidad del sistema reportero por inmunofluorescencia (Figura 3) y el análisis de qPCR de EGFP positivas frente a negativas poblaciones siguiente celular activada por fluorescencia (datos no mostrados). Como Pitx3 es un factor de transcripción específico para las neuronas dopaminérgicas del mesencéfalo 14, la ingeniería de una línea celular reportera Pitx3 humano facilitar el uso de Pitx3 + neuronas dopaminérgicas del mesencéfalo derivados de hESCs en los estudios de modelado, ya sea in vitro o PD terapia de reemplazo celular.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

El trabajo descrito en este protocolo fue posible gracias a la financiación del Gobierno de Victoria como parte de una alianza de colaboración con el Instituto de California para la Medicina Regenerativa (CIRM).

Materials

Name Company Catalog Number Comments
Mouse Embryonic Fibroblasts (DR4) GlobalStem GSC-6004G
Gelatin Sigma G1393-100ML
HBSS, no Calcium, no Magnesium, no Phenol Red (HBSS) Life Technologies 14175-095
Dispase StemCell Technologies 7923
Cell Scraper Corning 3008
Accutase Life Technologies A11105-01
Y27632 Axon Medchem Axon 1683
Cell Strainer - 40 μm BD Biosciences 352340
33 mm - 0.22 μm filter Millipore SLGP033RS
rhFGF2 R&D Systems 233-FB-025/CF
Electroporator BioRad 165-2661
0.4 cm electroporation cuvette BioRad 165-2088
Human TV-hPITX3-forward targeting construct Addgene 31942
ZFN Kit; Human PITX3 Sigma-Aldrich CKOZFN1050-1KT
Puromycin InvivoGen ant-pr-1
Matrigel BD Biosciences 354277
Geltrex Life Technologies A1569601
NaCl Sigma-Aldrich S3014
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 10566-016
Fetal Bovine Serum, Qualified, Heat Inactivated, US Origin (FBS) Life Technologies 16140-071
Pen/Strep Life Technologies 15070-063
Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12) Life Technologies 11320-033
KnockOut Serum Replacement (KSR) Life Technologies 10828-028
MEM Non-Essential Amino Acids  (NEAA) Life Technologies 11140-050
GlutaMAX Life Technologies 35050-061
ß-mercaptoethanol Life Technologies 21985-023
N-Lauroylsarcosine sodium salt solution (Sarcosyl) (30%) Sigma-Aldrich 61747
EDTA Sigma-Aldrich E9884
Trizma Hydrochloride Sigma-Aldrich T3253
Proteinase K solution (20 mg/ml) Bioline Australia BIO-37084
Expand Long Template PCR System Roche Australia 11681834001
hPITX3 L arm gen. F (primer): 5’ TGTCCTAAGGAGAATGGGTAACAGACA 3’ GeneWorks, Australia
hPITX3 L arm GFP R (primer): 5’ ACACGCTGAACTTGTGGCCGTTTA 3’ GeneWorks, Australia
HyperLadder 1 kb  Bioline Australia BIO-33025
GelRed Jomar Bioscience, Australia 41003

DOWNLOAD MATERIALS LIST

References

  1. Nefzger, C. M., et al. Lmx1a Allows Context-Specific Isolation of Progenitors of GABAergic or Dopaminergic Neurons During Neural Differentiation of Embryonic Stem Cells. Stem Cells. 30, (7), 1349-1361 (2012).
  2. Zeng, W. R., Fabb, S. R. A., Haynes, J. M., Pouton, C. W. Extended periods of neural induction and propagation of embryonic stem cell-derived neural progenitors with EGF and FGF2 enhances Lmx1a expression and neurogenic potential. Neurochemistry International. 59, (3), 394-403 (2011).
  3. Collin, J., Lako, M. Concise review: putting a finger on stem cell biology: zinc finger nuclease-driven targeted genetic editing in human embryonic stem cells. Stem Cells. 29, (7), 1021-1033 (2011).
  4. Carroll, D. Progress and prospects: zinc-finger nucleases as gene therapy agents. Gene Therapy. 15, (22), 1463-1468 (2008).
  5. Urnov, F. D., et al. Highly efficient endogenous human gene correction using designed zinc-finger nucleases. Nature. 435, (7042), 646-651 (2005).
  6. Hockemeyer, D., et al. Efficient targeting of expressed and silent genes in human ESCs and iESCs using zinc-finger nucleases. Nature Biotechnology. 27, (9), 851-857 (2009).
  7. Lombardo, A., et al. Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery. Nature Biotechnology. 25, (11), (2007).
  8. Boch, J., Bonas, U. Xanthomonas AvrBs3 family-type III effectors: discovery and function. Annual Review of Phytopathology. 48, 419-436 (2010).
  9. Hockemeyer, D., et al. Genetic engineering of human embryonic cells using TALE nucleases. Nature Biotechnology. 29, (8), 731-734 (2011).
  10. Tucker, K. L., Wang, Y., Dausman, J., Jaenisch, R. A transgenic mouse strain expressing four drug-selectable marker genes. Nucleic Acids Research. 25, (18), 3745-3746 (1997).
  11. Ramírez-Solis, R., Rivera-Pérez, J., Wallace, J. D., Wims, M., Zheng, H., Bradley, A. Genomic DNA microextraction: a method to screen numerous samples. Analytical Biochemistry. 201, (2), 331-335 (1992).
  12. Kawasaki, H., et al. Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity. Neuron. 28, (1), 31-40 (2000).
  13. Denham, M., Thompson, L. H., Leung, J., Pébay, A., Björklund, A., Dottori, M. Gli1 is an inducing factor in generating floor plate progenitor cells from human embryonic stem cells. Stem Cells. 28, (10), 1805-1815 (2010).
  14. Smidt, M. P., et al. A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons. Proceedings of the National Academy of Sciences U.S.A. 94, 13305-13310 (1997).
Nucleasa dedo de zinc-gen mejorada en células madre embrionarias humanas
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hartley, B. J., Fabb, S. A., Finnin, B. A. L., Haynes, J. M., Pouton, C. W. Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells. J. Vis. Exp. (90), e51764, doi:10.3791/51764 (2014).More

Hartley, B. J., Fabb, S. A., Finnin, B. A. L., Haynes, J. M., Pouton, C. W. Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells. J. Vis. Exp. (90), e51764, doi:10.3791/51764 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter