Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Zink-vinger Nuclease Enhanced gentargeting in menselijke embryonale stamcellen

doi: 10.3791/51764 Published: August 23, 2014

Summary

Reporter cellijnen bieden een middel om te visualiseren, te volgen en te isoleren cellen van belang zijn van de heterogene populatie. Echter, gen targeting met gebruikelijke homologe recombinatie in humane embryonale stamcellen is inefficiënt. Hierin beschrijven we richten CNS middenhersenen specifieke transcriptiefactor PITX3 locus met EGFP met zink-vinger nuclease verbeterde homologe recombinatie.

Abstract

Een belangrijke beperking van de huidige menselijke embryonale stamcellen (ESC) differentiatie protocollen is de generatie van heterogene celpopulaties. Deze kweken bevatten de cellen van belang, maar ook verontreinigd met ongedifferentieerde SER, niet-neurale derivaten en andere neuronale subtypes. Dit beperkt hun gebruik in in vitro en in vivo toepassingen, zoals in vitro model voor geneesmiddelenonderzoek of celvervangingstherapie. Om u te helpen overwinnen van deze, reporter cellijnen, die een middel om te visualiseren, te volgen en te isoleren cellen van belang te bieden, kunnen worden geconstrueerd. Echter, om dit te bereiken in humane embryonale stamcellen via conventionele homologe recombinatie inefficiënt. Dit protocol beschrijft richten van de hypofyse homeobox 3 (PITX3) locus in humane embryonale stamcellen met aangepaste gemaakt zinkvinger nucleasen die plaats-specifieke dubbelstrengs DNA breuken te introduceren, samen met eenPITX3 - EGFP-specifieke DNA donorvector. Na het genereren van de PITX3 reporter cellijn kan dan worden gedifferentieerd door gepubliceerde protocollen voor gebruik in studies zoals in vitro Parkinson ziektemodel of celvervangingstherapie.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Voor deze embryonale stamcel (ESC) differentiatie protocollen resulteren in heterogene celpopulaties, met name wat betreft de afleiding van specifieke neuronale fenotypen. Ofschoon kweken bevatten de gewenste cellulaire fenotype, andere neuronale en niet-neuronale en niet-gedifferentieerde celtypen zijn vaak aanwezig 1. Deze eigenschappen beperken de toepassing van ESC afgeleid cel bronnen voor gebruik in celvervangingstherapie en in vitro ziektemodel.

Genetische reporter cellijnen bieden een middel te visualiseren, te volgen en te isoleren cellen van belang, op voorwaarde dat de expressie van het eiwit (RP) reproduceert endogene expressie. Het gebruik van promoters onmiddellijk stroomopwaarts van een gen coderend gebied kan worden gebruikt om ruwe genetische reporters ontlenen maar dergelijke constructen missen de juiste regulerende elementen dat endogene genexpressie. Daarentegen homologe recombinatie biedtmogelijkheid om high-fidelity uitdrukking van de RP te garanderen. In het verleden, richtende vectoren ontworpen voor homologe recombinatie op specifieke loci plaats zijn gebruikt om RP in muizen SER (mESCs) te zoeken via elektroporatie als middel DNA levering 1,2. De generatie van de reporter cellijnen via conventionele homologe recombinatie is echter zeer inefficiënt voor menselijke SER (hESC 's), en dus alleen onderbouwd in een handvol gevallen (beoordeeld in 3). Door een gemanipuleerde chimere eiwit dat een fusie van een Fok I nuclease met plaatsspecifieke zinkvinger motieven, gezamenlijk bekend als zinkvinger nucleasen (ZFNs), DNA dubbelstrengs breuken op vooraf bepaalde genomische loci worden geïntroduceerd. Wanneer een DNA vector met homologie aan beide zijden van de DNA dubbele streng breuk wordt toegevoegd, kan de genomische locatie worden gerepareerd door homologe recombinatie, waardoor de opname van de DNA-sequentie donor. Deze techniek is nuttig gebleken fof genomische bewerken in zowel humane primaire cellen 4,5 en hESCs 6,7. Meer recent werk is gebruikt transcriptie activator-achtige effector nucleases (Talens), transcriptiefactoren gebruikt door plantenpathogenen 8, om te helpen bij het ​​ontwerp van de site-specifieke nucleasen 9.

In het volgende protocol tonen we de vorming van een hESC reporter cellijn door elektroporatie van een EGFP die homoloog targeting vector 6 met ZFNs voor de menselijke hypofyse homeobox 3 (PITX3) locus. Na antibiotische selectie voor 2-3 weken, kan hESCs met correct geïntegreerde DNA handmatig worden geplukt, uitgebreid en gescreend in eerste instantie via PCR, en vervolgens gevalideerd door Southern blotting.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle procedures worden uitgevoerd in een steriele laminaire stroming kap uitgevoerd. Alle media en oplossingen worden geëquilibreerd tot 37 ° C tenzij anders aangegeven.

1 Uitbreiding van de Mens PSC (hESC 's en hiPSCs, WA-09 gebruikt in dit protocol) voor transfectie

Opmerking: Het is niet nodig om hESCs op Matrigel of Geltrex breiden. hESCs uitgebreid op muis embryonale fibroblasten (MEF) kan worden gebruikt voor elektroporatie of nucleofection na een MEF verwijderingsstap (zie paragraaf 2.8).

  1. Bereid 1 x 100 mm schaal en 1 x 75cm2 kolf van DR4 MEFs op 2,0 x 10 4 cellen per cm2 in MEF media (zie tabel 1) op de vaat vooraf gecoat met 0,1% w / v gelatine.
    Opmerking: CF1, Blk6 of MF1 MEF kan worden gebruikt, echter, is het raadzaam dat de antibiotica-resistente MEF lijnen worden gebruikt, bijvoorbeeld, DR410.
  2. De volgende dag, passage hESC 's op een 100 mm schaal pre-plated met MEF opgesteld in paragraaf 1.1. Om dit te doen ASPItarief hESC media uit culturen gerechten, wassen hESCs met Ca2 + / Mg2 + -vrije Hanks gebalanceerde zoutoplossing (HBSS), voeg Dispase (zie tabel 2 voor de juiste volumes) en plaats in een bevochtigde incubator bij 37 ° C / 5% CO 2. Na 3-5 minuten incubatie, aspireren Dispase en voorzichtig te wassen 1-2 keer met HBSS om MEF verwijderen. Voeg hESC media (zie tabel 3) en met een cel schraper of 5 ml pipet voorzichtig schrapen de kolonies van het oppervlak van de kweekschaal.
  3. Verzamel de kolonie fragmenten in suspensie uit de kweekschaal in een 15 ml centrifugebuis. Spoel cultuur schotel met hESC media en transfer naar de buis van 15 ml. Wees voorzichtig om niet breken klonten in enkele cellen of kleine fragmenten.
  4. Centrifugeer gedurende 5 minuten bij 160 xg om kolonie fragmenten pellet.
  5. Aspireren supernatant. Tik bodem van 15 ml buis met vinger aan kolonie fragment pellet los. Zachtjes hersuspendeer kolonie fragmenten in hESC media volgens de split ratio (normallya split verhouding tussen 1: 4 en 1: 8 is van toepassing). Wees zeer voorzichtig niet te klonten in enkele cellen of kleine fragmenten als deze maken zal beïnvloeden opnieuw platen efficiëntie.
  6. Voorafgaand aan opnieuw platen hESC fragmenten op MEF wassen 1x met HBSS. Voeg langzaam de juiste hoeveelheid (zie tabel 2) van de cel suspensie die hESC fragmenten in hESC media om gerechten pre-plated met MEF.
  7. Plaats cultuur gerechten op plank in incubator en beweeg langzaam heen en weer en heen en weer om kolonie fragmenten gelijkmatig te verdelen.
  8. Vervang dagelijks hESC media.
  9. Om geconditioneerde media van MEF (MEF-CM) bereiden Was de 75 cm 2 fles pre-plated met MEF 1 x met HBSS. Voeg hESC media. Na 24 uur, verzamelen geconditioneerde media en te vervangen door verse hESC media. Dagelijks herhalen voor maximaal 12 dagen. Slaan MEF-CM bij 4 ° C totdat het nodig is.

2 Voorbereiding van de Mens SER voor Transfection

  1. Let op de groei van hESCsonder een microscoop dagelijks. Wanneer kolonies worden 40-50% samenvloeiing, plaat 3 x 100 mm schalen met 2,0 x 10 5 MEF per cm 2.
  2. Wanneer kolonies worden 60-70% samenvloeiing zijn ze klaar om te worden getransfecteerd. 'Groom' kolonies door het verwijderen van gedifferentieerde koloniën of kolonie kernen.
    Let op: Omdat wij geloven hogere transfectie en targeting efficiëntie ontstaan ​​wanneer cellen in de log-fase groei, wordt gesuggereerd dat elektroporatie worden uitgevoerd voordat hESCs bereiken ≥ 70% samenvloeiing.
  3. Was hESC kolonies met HBSS en voeg Accutase.
    Opmerking: Het is niet nodig om voor te behandelen hESCs met ROCK remmer Y-27632 als voldoende remming vindt plaats wanneer geïncubeerd met Y-27632 tijdens stap 2.7
  4. Incubeer gedurende 10 - 20 minuten bij 37 ° C / 5% CO2 totdat kolonies worden weergegeven als enkele cellen bekeken onder een microscoop. Vermaal cellen met een pipet 1 ml.
  5. Voeg hESC media en filter in een 15 ml conische buis met behulp van een 40 micrometer cel strainer om celklonten verwijderen.
  6. Centrifugeer bij 160 xg gedurende 5 minuten. Resuspendeer celpellet in verse hESC media en herhalen om eventueel resterende Accutase oplossing te verwijderen.
  7. Resuspendeer cellen in hESC media met 10 uM Y-27632 en breng de totale celsuspensie om een ​​100 mm schaal vooraf gecoat met gelatine.
  8. Incubeer bij 37 ° C / 5% CO2 gedurende ten minste 30 minuten.
  9. Gedurende deze tijd zal MEF houden aan de gelatine beklede schotel. Collect niet-hechtende hESCs met een pipet 1 ml in een verse 15 ml centrifugebuis en bepalen celdichtheid met behulp van een hemocytometer.

3 Elektroporatie van hESCs

  1. Filter CM-MEF media met een 0,22 urn filter en voeg 10 ng / ml recombinant humaan fibroblast groeifactor 2 (rhFGF2).
  2. Transfer 7.5 x 106 hESCs uit sectie 2.9 in nieuw 15 ml conische buis en centrifugeer bij 160 xg gedurende 5 minuten.
  3. Gedurende deze tijd het opzetten van de electroporator: Kies het programma voor exponentiële electroporation en stel de volgende parameters, Voltage: 250 V, Capaciteit: 500 uF, en Resistance: ∞-.
  4. Zuig het supernatant en resuspendeer cel pellet in 0,8 ml ijskoude 0,22 pm gefilterd HBSS. Breng de oplossing van een steriele 0,4 cm elektroporatie cuvet.
  5. Voeg TV-hPITX3-forward targeting construct (30 pg DNA) en meng voorzichtig met een 200 ul pipet. Incubeer op ijs gedurende 5 minuten. Gedurende deze tijd verwijdert u een monster van PITX3 ZFN mRNA en ontdooien op ijs. Toen ontdooide overdracht 7,5 pi van ZFN mRNA tot DNA / cel mengsel in elektroporatiecuvet. Meng voorzichtig met een 200 ul pipet.
    Opmerking: De locus doelwit is de belangrijkste factor die bijdraagt ​​aan targeting efficiency. Loci coderende stille genen, genen die niet uitgedrukt in SER, zoals PITX3 moeilijk te richten met conventionele homologe recombinatie 6. Dus, maakt gebruik van dit protocol op maat ontworpen ZFNs voor het menselijk PITX3 locus een DNA dubbele streng b inducerenreak.
  6. Electroporate door het volgen van de instructies op het scherm op de electroporator.
  7. Met behulp van een 200 ul pipet breng de inhoud van de elektroporatie cuvet een 15 ml buis met 10 ml hESC media. Was de cuvette tweemaal met 200 ul van hESC media telkens en overbrengen in een 15 ml buis. Er zullen "slijm-achtige" puin bestaande uit DNA en eiwit uit de gelyseerde cellen die negatief uitwerkt celoverleving. Centrifugeer bij 160 xg gedurende 5 minuten bij het vuil te verwijderen.
  8. Zuig het supernatant en tik zachtjes cel pellet los te maken. Re-schorten in 30 ml aangevuld MEF-CM met 10 uM Y-27632 en replate op 3 x 100 mm gerechten preplated met MEF.
  9. Veranderen dagelijks de media. Op dag 2, kan Y-27632 worden ingetrokken en gekweekt in enkel hESC media.
  10. Na 2-3 dagen de hESCs 50-70% confluent zouden zijn. Op dit punt beginnen antibioticumselectie (bijvoorbeeld 0,5 ug / ml puromycine).
  11. Behouden selectie door het toevoegen van verse hESC / puromycine- media dagelijks. Na ~ 7 dagen kleine kolonies zichtbaar zijn. Als antibiotica resistente MEFs niet worden gebruikt, kunnen MEFs worden aangevuld door toevoeging van een extra 1,0 x 10 4 cellen per cm2.

4 Picking Transgene hESC Clones

  1. Ongeveer 14-21 dagen na selectie (wanneer kolonies ~ 1 mm diameter hebben bereikt) bereiden platen voor uitbreiding en screening. Begin met ontdooien een hoeveelheid van Matrigel of Geltrex bij 4 ° C gedurende ten minste 5 uur. Verdun volgens instructies van de fabrikant en voeg 75 ul aan elk putje van 3 x 96-well platen. Bereid 3 x 48-well platen door uitplating MEFs op 2,0 x 10 4 cellen per cm2. Incubeer beide platen O / N bij 37 ° C / 5% CO2.
  2. De volgende dag ontleden kolonies in 16-25 stukken met een 21 G naald op het uiteinde van een pipet 2 ml door snijden van een raster.
  3. Aspireren Matrigel van 96-well platen en vervang met Aanvteerde CM-MEF media. Was MEF in 48-well platen 1 x met HBSS en voeg hESC media.
  4. Met behulp van een pipet 200 ul zacht overdracht 1/3 van de kolonie ontleed in een 48-well plaat voor uitbreiding. Breng de overige 2/3 van de kolonie ontleed in een overeenkomstige 96-wells plaat met aangevuld CM-MEF media.
  5. Aanvullen beide platen door dagelijks wisselende media (aangevuld CM-MEF media voor 96-well Matrigel beklede platen en hESC media voor 48-well platen met MEFs, beide gesupplementeerd met 0,5 ug / ml puromycine).
  6. Expand tot 96-well platen zijn 100% confluent en aanvankelijk screenen via PCR.

5 Screening en uitbreiding van positieve klonen

  1. Om genomische DNA (methode op basis van 11) voor te bereiden verwijder al het papier uit platen door het omkeren, dan deppen op keukenpapier.
  2. Spoel elk putje tweemaal met RT PBS (100 ul / well elke wasbeurt), omkeren en vlek als bij stap 5.1. Plaats platen bij -80 ° Cfof 1-2 uur om te helpen bij cellysis (platen kunnen voor onbepaalde tijd worden opgeslagen als dit).
  3. Terwijl cellen bij -80 ° C te Sarcosyl Lysis Buffer (zie tabel 4) (50 gl / putje). Cellen, warm platen lyseren voor 5 min bij RT en pipetteer vervolgens lysis buffer in elk putje. Verzegel de randen van elke plaat met tape, plaats in een afsluitbare houder met vochtige papieren handdoeken vocht te maken, en incubeer O / N bij 60 ° C.
  4. Na incubatie met 150 ul van 5M NaCl tot 10 ml van -20 ° C absolute ethanol, meng goed en voeg 100 ul aan elk putje (Opmerking: ethanol zal troebel gaan als NaCl wordt toegevoegd). Tik platen voorzichtig te mengen (niet pipet) en laat gedurende minimaal 30 minuten bij kamertemperatuur. Gedurende deze tijd de oplossing helder worden en het DNA precipiteren.
  5. Verwijder oplossing in stap 5.1 voeg 150 pl 70% ethanol aan elke well. Omkeren plaat voorzichtig en dep als voorheen. Herhaal deze stap nog 2x.
    Let op: Omdat de neergeslagen DNA natuurlijk Adheres aan de weefselkweek plastic het niet verdreven tijdens deze stappen wassen geworden.)
  6. Na de laatste wassing kort centrifuge platen bij topsnelheid om het DNA op de bodem van elk putje vervolgens aan de lucht drogen bij kamertemperatuur (of 37 ° C) gedurende ten minste 30 min concentreren.
  7. Voeg 40 - 50 gl T0.1E (pH 8,0) (zie tabel 5) of TE (pH 8,0) aan elk putje en plaats platen bij 65 ° C gedurende 1 uur of bij 4 ° CO / N alvorens voor PCR. Resuspendeer DNA door de zijkanten van de plaat te tikken. Gebruik 1-2 ul geresuspendeerde DNA / 10 ul PCR reactie.
  8. Met behulp van het uitbreiden Long Template PCR System met hPITX3 L arm gen. F en hPITX3 L arm GFP R primers uitvoeren initiële screening van klonen bij 58 ° C annealing, extensie 45 sec, 35 cycli.
  9. Electrophorèse monsters met Hyperladder 1kb in een 1% agarosegel bevattende GelRed bij 100 V gedurende 45 minuten en detecteren positieve klonen via UV belichting.
  10. Bevestig PCR positieve klonen door digestie van genomisch DNA van expahebben gereageerd klonen (zie hieronder) met HindIII en hybridiserende probes 5 'en 3' van de vector homologie-armen een Southern blot (zoals eerder beschreven in 1). Probes worden gegenereerd door PCR met primer paren hPITX3 5 'probe F en R en hPITX3 3'probe F en R, gedigereerd met EcoRI en geligeerd in de algemene kloneringsvector.
  11. Afhankelijk van het aantal positieve klonen te bereiden 2 putjes van een 6-well plaat door pre-plating met MEF (2,0 x 10 4 cellen per cm2).
  12. De volgende dag voorbehandelen positieve klonen in de 48-well plaat met 10 pM Y-27632 minimaal 1 uur.
  13. Was positieve klonen met HBSS en voeg 300 ul Accutase.
  14. Wanneer kolonies worden gerenderd enkele cellen, voeg 1 ml van hESC media en verzamelen in een 15 ml buis.
  15. Veranderen dagelijks de media. Op dag 2, kan Y-27632 worden ingetrokken en de cellen gekweekt in hESC media.
  16. Wanneer kolonies 70 - 80% confluent, subcultuur en vries de rest van de colony fragmenten.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Na co-elektroporatie van de speciaal ontworpen PITX3 zinkvinger pair met de PITX3 - EGFP-specifieke DNA donorvector en daaropvolgende puromycine selectie, werden positieve klonen hESC aanvankelijk gedetecteerd via genomische PCR screening (figuur 1). Southern blot hybridisatie van deze PCR-positieve klonen met 5 'en 3' probes bevestigd correct targeting met exon 1 van het PITX3 locus (figuur 2), met een rendement van 19%. Immunofluorescent beelden weergegeven in figuur 3 tonen EGFP expressie gedreven door de PITX3 promotor volgende differentiatie met behulp van een gepubliceerde PA6 stromale cel differentiatie protocol 12,13. Co-lokalisatie van EGFP kon worden waargenomen met markers van de dopaminerge neuronen zoals FOXA2 (rood) (Figuur 3A) en tyrosine hydroxylase (TH; red) (Figuur 3B), terwijl het belangrijker is geen co-lokalisatie c Ould worden waargenomen met de GABAergic marker, gamma-aminoboterzuur (GABA; red)   (Figuur 3C).

Figuur 1
Figuur 1 Voorafgaande genomische PCR screening. Na kolonieselectie en uitbreiding voorlopige genomische PCR screening gedetecteerd talrijke positieve klonen zoals blijkt uit het PCR product (band bij 984 bp). (Klonen werden gescreend met behulp van primers hPITX3 L arm gen. F, die net buiten het links gerichte arm ligt, en hPITX3 L arm GFP R die is gelegen binnen het EGFP-gen.) Rechter en linker kant rijstroken zijn een 1 kb ladder. Klik hier om een grotere versie van deze afbeelding te bekijken.

ltijd "> Figuur 2
Figuur 2 Validatie van EGFP richten naar de hPITX3 locus met zinkvinger- nucleases in hESCs. (A) Schematische voorstelling van de Southern blot strategie gebruikt om te valideren targeting. Het bovenste paneel schema illustreert de inheemse hPITX3 locus voor targeting. Het onderste paneel schema toont de hPITX3 locus volgende juiste plaatsing van de EGFP transgen. De rode lijnen onder elk paneel tonen de plaatsen waar de 5 'en 3' Southern blot probes binden en komen overeen met de banden in Figuur 2B. (B) Representatieve Southern blot van doelgericht kolonies geselecteerd van PCR pre-screening. Afkortingen: EGFP, versterkt groen fluorescent eiwit; PGK, human fosfoglycerolkinase promotor; PURO, puromycine resistentiegen. Andere kenmerken: loxP plaatsen, paars; polyadenyleringssequentie, blue, hPITX3 exons, oranje. Klik hier om een grotere versie van deze afbeelding te bekijken.

Figuur 3
Figuur 3 hPITX3-EGFP hESCs gesplitste onder PA6 / LSB / SAG / FGF8 omstandigheden. Immunofluorescente afbeeldingen EGFP gelabeld met (A) FOXA2 (rood), (B) TH (rood) en (C) GABA (rood). Tegengekleurd met DAPI (blauw). Schalen bars, 50 um. Klik hier om een grotere versie van deze afbeelding te bekijken.

Volgende co-elektroporatie van de op maat ontworpen PITX3 zinc-finger paar samen met de PITX3 - EGFP -specifieke DNA donorvector en daaropvolgende puromycineselectie, hESC positieve klonen werden oorspronkelijk gedetecteerd door genomische PCR screening (figuur 1). Southern blot hybridisatie van deze PCR-positieve klonen met 5 'en 3' probes bevestigd correct targeting met exon 1 van het PITX3 locus (figuur 2), met een rendement van 19%. Immunofluorescent beelden weergegeven in figuur 3 tonen EGFP expressie gedreven door de PITX3 promotor volgende differentiatie met behulp van een gepubliceerde PA6 stromale cel differentiatie protocol 12,13. Co-lokalisatie van EGFP worden waargenomen met markers van dopaminerge neuronen zoals FOXA2 (rood) (figuur 3A) en tyrosine hydroxylase (TH, red) (figuur 3B), maar belangrijker no co-lokalisatie kan worden waargenomen met de GABAergic marker , gamma-aminoboterzuur (GABA; red) (Figuur 3C).

NHOUD "fo: keep-together.within-page =" always "> Figuur 1
Figuur 1 Voorafgaande genomische PCR screening. Na kolonieselectie en uitbreiding voorlopige genomische PCR screening gedetecteerd talrijke positieve klonen zoals blijkt uit het PCR product (band bij 984 bp). (Klonen werden gescreend met behulp van primers hPITX3 L arm gen. F, die net buiten het links gerichte arm ligt, en hPITX3 L arm GFP R die is gelegen binnen het EGFP-gen.) Rechter en linker kant rijstroken zijn een 1 kb ladder. Klik hier om een grotere versie van deze afbeelding te bekijken.

Figuur 2
Figuur 2 Validatie vanEGFP richten naar de hPITX3 locus met zinkvinger- nucleases in hESCs. (A) Schematische voorstelling van de Southern blot strategie gebruikt om te valideren targeting. Het bovenste paneel schema illustreert de inheemse hPITX3 locus voor targeting. Het onderste paneel schema toont de hPITX3 locus volgende juiste plaatsing van de EGFP transgen. De rode lijnen onder elk paneel tonen de plaatsen waar de 5 'en 3' Southern blot probes binden en komen overeen met de banden in Figuur 2B. (B) Representatieve Southern blot van doelgericht kolonies geselecteerd van PCR pre-screening. Afkortingen: EGFP, versterkt groen fluorescent eiwit; PGK, human fosfoglycerolkinase promotor; PURO, puromycine resistentiegen. Andere kenmerken: loxP plaatsen, paars; polyadenyleringssequentie, blauw, hPITX3 exons, oranje. Klik hier om een grotere versie van deze fi bekijkenguur.

Figuur 3
Figuur 3 hPITX3-EGFP hESCs gesplitste onder PA6 / LSB / SAG / FGF8 omstandigheden. Immunofluorescente afbeeldingen EGFP gelabeld met (A) FOXA2 (rood), (B) TH (rood) en (C) GABA (rood). Tegengekleurd met DAPI (blauw). Schalen bars, 50 um. Klik hier om een grotere versie van deze afbeelding te bekijken.

Stof ml / 100 ml Catalogus nummer (Leverancier)
DMEM 89 10566-016 (Life Technologies)
Fetal Bovine Serum 10 16140-071 (Life Technologies)
Pen / Strep 1 15070-063 (Life Technologies)

Tabel 1.

Component 100 mm schaal 60 mm schotel 6-well 48-well 96-well 75cm 2 fles
HBSS 5 ml 2 ml 1 ml 0.5 ml 0,1 ml 8 ml
Accutase 5 ml 2 ml 1 ml 0.5 ml 0,1 ml 8 ml
Dispase 5 ml 2 ml 1 ml - - -
hESC media 10 ml 6 ml 3 ml 0.5 ml 0.2 ml 15 ml
Matrigel - - - - 0,1 ml -

Tabel 2.

</ Table>

Tabel 3.

Stof ml / 100 ml Catalogus nummer (Leverancier)
DMEM / F12 80 11320-033 (Life Technologies)
KSR 20 10828-028 (Life Technologies)
NEAA 1 11140-050 (Life Technologies)
GlutaMAX 1 35050-061 (Life Technologies)
Pen / Strep 1 15070-063 (Life Technologies)
ß-mercapto-ethanol 0,1 21985-023 (Sigma-Aldrich)
rhFGF2 7 ng / ml [laatste] 233-FB-025 / CF (R & D Systems)
Stof Concentratie Catalogus nummer (Leverancier)
N-lauroylsarcosine-natriumzout-oplossing (Sarcosyl) 0.5% (w / v) 61747 (Sigma-Aldrich)
EDTA 10,0 mM E9884 (Sigma-Aldrich)
NaCl 10,0 mM S3014 (Sigma-Aldrich)
Tris-Cl (pH 7,5) 10,0 mM T3253 (Sigma-Aldrich)
Proteinase K 1,0 mg / ml BIO-37084 (Bioline Australië)

Tabel 4.

Stof Concentratie Catalogus nummer (Leverancier)
Tris-Cl (pH 8,0) 10,0 mM T3253 (Sigma-Aldrich)
EDTA (pH 8,0) 0,1 mM E9884 (Sigma-Aldrich)

Tabel 5.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De generatie van de reporter cellijnen biedt een krachtig middel op te sporen, te visualiseren en te isoleren cellen van belang uit een heterogene populatie afkomstig van hESC '. Echter, gene targeting via conventionele homologe recombinatie heeft bewezen zeer inefficiënt voor menselijke SER 3 zijn. In dit protocol beschrijven we een betrekkelijk eenvoudige techniek voor het inbrengen van een RP in exon een van de PITX3 locus, in hESCs behulp van een algemeen gebruikt richtende vector met ZFNs. In onze handen het gen targeting doeltreffend is, met 19% van puromycine-resistente klonen die een doelgericht PITX3 locus (vergelijkbaar met eerder gepubliceerde 6).

Een beperking met behulp ZFNs aan gene targeting te vergemakkelijken is de moeilijkheid in het ontwerpen ZFNs vanuit het niets in huis. Dus, in dit protocol hebben we gebruikt op maat ontworpen in de handel verkrijgbare ZFNs, die duur om te verkrijgen zijn. & #160; Meer recentelijk heeft de TALEN systeem gebruikt voor gen-targeting middels homologe recombinatie 9. Het gebruik van Talens sterk vermindert de kosten van het gen te bewerken en kan worden ontworpen in eigen huis, bespoediging van het proces. Hoewel niet expliciet getoond in deze studie, kan dit protocol eenvoudig worden aangepast aan het gebruik van Talens nemen als de methode is dezelfde, behalve TALEN plasmiden worden in stap 3.5 in plaats van ZFN mRNA, zie 9.

Bij het ​​gebruik van deze techniek is het noodzakelijk om ervoor te zorgen dat hPSCs zijn in de groei log-fase, (bijvoorbeeld, culturen niet 70% of meer samenvloeiing). Wij geloven dat dit kritisch als het plasmide krijgt toegang tot de nucleus volgende verdeling kernenvelop tijdens de celdeling. Bovendien zal de DNA donor alleen vector integreren in DNA na DNA synthese zoals deze taak exploiteert homologie gerichte herstel tijdens divisie het donor-DNA te integreren in hetgenoom.

Een andere potentiële beperking van de ZFN aanpak is de introductie van DNA breuken elders in het genoom. Hoewel Southern hybridisatie met externe 5 'en 3' probes juiste integratie detecteert geen extra integratiegebeurtenissen of foutgevoelige reparatie detecteren elders in het genoom. Extra integratie evenementen kan worden onderzocht door Southern hybridisatie met vector-specifieke probes (bijvoorbeeld EGFP), terwijl off-target splitsing van de ZFN paren kan worden gedetecteerd met behulp van SELEX 3,6.

Hoewel we geen rechtstreekse effecten in de ontwikkeling van dopaminerge neuronen die rechtstreeks mogelijk op de inactivering van een gen PITX3 heeft gehouden moeten onderzoekers bedenken dat gericht geval wanneer een kopie van een gen wordt verstoord waardoor de kan ontwikkeling van die cel en moet hiermee rekening houden bij het analyseren van de resultaten. Of dit het geval is, zal grotendeels afhangenop het gen doelwit en kunnen alleen worden vastgesteld door het uitvoeren van het experiment.

Met een PA6 gebaseerd differentiatie protocol 12,13 konden we de betrouwbaarheid van het reporter systeem immunofluorescentie bevestigd (figuur 3) en qPCR analyse van EGFP positief versus negatieve populaties na fluorescentie-geactiveerde celsortering (data niet getoond). Als PITX3 is een transcriptiefactor specifiek middenhersenen dopaminergische neuronen 14, zal de techniek van een mens PITX3 reporter cellijn het gebruik van PITX3 + dopaminerge neuronen afgeleid van hESCs in studies in vitro PD modelling of celvervangingstherapie vergemakkelijken.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Werk beschreven in dit protocol werd mede mogelijk gemaakt door financiering uit het Victoriaanse regering als onderdeel van een samenwerkingsproject alliantie met het Californische Instituut voor Regeneratieve Geneeskunde (CIRM).

Materials

Name Company Catalog Number Comments
Mouse Embryonic Fibroblasts (DR4) GlobalStem GSC-6004G
Gelatin Sigma G1393-100ML
HBSS, no Calcium, no Magnesium, no Phenol Red (HBSS) Life Technologies 14175-095
Dispase StemCell Technologies 7923
Cell Scraper Corning 3008
Accutase Life Technologies A11105-01
Y27632 Axon Medchem Axon 1683
Cell Strainer - 40 μm BD Biosciences 352340
33 mm - 0.22 μm filter Millipore SLGP033RS
rhFGF2 R&D Systems 233-FB-025/CF
Electroporator BioRad 165-2661
0.4 cm electroporation cuvette BioRad 165-2088
Human TV-hPITX3-forward targeting construct Addgene 31942
ZFN Kit; Human PITX3 Sigma-Aldrich CKOZFN1050-1KT
Puromycin InvivoGen ant-pr-1
Matrigel BD Biosciences 354277
Geltrex Life Technologies A1569601
NaCl Sigma-Aldrich S3014
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 10566-016
Fetal Bovine Serum, Qualified, Heat Inactivated, US Origin (FBS) Life Technologies 16140-071
Pen/Strep Life Technologies 15070-063
Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12) Life Technologies 11320-033
KnockOut Serum Replacement (KSR) Life Technologies 10828-028
MEM Non-Essential Amino Acids  (NEAA) Life Technologies 11140-050
GlutaMAX Life Technologies 35050-061
ß-mercaptoethanol Life Technologies 21985-023
N-Lauroylsarcosine sodium salt solution (Sarcosyl) (30%) Sigma-Aldrich 61747
EDTA Sigma-Aldrich E9884
Trizma Hydrochloride Sigma-Aldrich T3253
Proteinase K solution (20 mg/ml) Bioline Australia BIO-37084
Expand Long Template PCR System Roche Australia 11681834001
hPITX3 L arm gen. F (primer): 5’ TGTCCTAAGGAGAATGGGTAACAGACA 3’ GeneWorks, Australia
hPITX3 L arm GFP R (primer): 5’ ACACGCTGAACTTGTGGCCGTTTA 3’ GeneWorks, Australia
HyperLadder 1 kb  Bioline Australia BIO-33025
GelRed Jomar Bioscience, Australia 41003

DOWNLOAD MATERIALS LIST

References

  1. Nefzger, C. M., et al. Lmx1a Allows Context-Specific Isolation of Progenitors of GABAergic or Dopaminergic Neurons During Neural Differentiation of Embryonic Stem Cells. Stem Cells. 30, (7), 1349-1361 (2012).
  2. Zeng, W. R., Fabb, S. R. A., Haynes, J. M., Pouton, C. W. Extended periods of neural induction and propagation of embryonic stem cell-derived neural progenitors with EGF and FGF2 enhances Lmx1a expression and neurogenic potential. Neurochemistry International. 59, (3), 394-403 (2011).
  3. Collin, J., Lako, M. Concise review: putting a finger on stem cell biology: zinc finger nuclease-driven targeted genetic editing in human embryonic stem cells. Stem Cells. 29, (7), 1021-1033 (2011).
  4. Carroll, D. Progress and prospects: zinc-finger nucleases as gene therapy agents. Gene Therapy. 15, (22), 1463-1468 (2008).
  5. Urnov, F. D., et al. Highly efficient endogenous human gene correction using designed zinc-finger nucleases. Nature. 435, (7042), 646-651 (2005).
  6. Hockemeyer, D., et al. Efficient targeting of expressed and silent genes in human ESCs and iESCs using zinc-finger nucleases. Nature Biotechnology. 27, (9), 851-857 (2009).
  7. Lombardo, A., et al. Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery. Nature Biotechnology. 25, (11), (2007).
  8. Boch, J., Bonas, U. Xanthomonas AvrBs3 family-type III effectors: discovery and function. Annual Review of Phytopathology. 48, 419-436 (2010).
  9. Hockemeyer, D., et al. Genetic engineering of human embryonic cells using TALE nucleases. Nature Biotechnology. 29, (8), 731-734 (2011).
  10. Tucker, K. L., Wang, Y., Dausman, J., Jaenisch, R. A transgenic mouse strain expressing four drug-selectable marker genes. Nucleic Acids Research. 25, (18), 3745-3746 (1997).
  11. Ramírez-Solis, R., Rivera-Pérez, J., Wallace, J. D., Wims, M., Zheng, H., Bradley, A. Genomic DNA microextraction: a method to screen numerous samples. Analytical Biochemistry. 201, (2), 331-335 (1992).
  12. Kawasaki, H., et al. Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity. Neuron. 28, (1), 31-40 (2000).
  13. Denham, M., Thompson, L. H., Leung, J., Pébay, A., Björklund, A., Dottori, M. Gli1 is an inducing factor in generating floor plate progenitor cells from human embryonic stem cells. Stem Cells. 28, (10), 1805-1815 (2010).
  14. Smidt, M. P., et al. A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons. Proceedings of the National Academy of Sciences U.S.A. 94, 13305-13310 (1997).
Zink-vinger Nuclease Enhanced gentargeting in menselijke embryonale stamcellen
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hartley, B. J., Fabb, S. A., Finnin, B. A. L., Haynes, J. M., Pouton, C. W. Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells. J. Vis. Exp. (90), e51764, doi:10.3791/51764 (2014).More

Hartley, B. J., Fabb, S. A., Finnin, B. A. L., Haynes, J. M., Pouton, C. W. Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells. J. Vis. Exp. (90), e51764, doi:10.3791/51764 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter