Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Fluorescent rapide Published: November 26, 2014 doi: 10.3791/52053
* These authors contributed equally

Abstract

Combinant ARN hybridation fluorescente in situ (FISH) avec immunofluorescence (immuno-FISH) crée une technique qui peut être utilisé au niveau de la cellule unique pour détecter les dynamiques spatiales de localisation d'ARN avec perspicacité simultanée dans la localisation de protéines, les modifications épigénétiques et autres détails qui peut être mis en évidence par immunofluorescence. Inactivation du chromosome X est un paradigme de longue ARN non codant (lncRNA) silençage génique médiée. transcrit spécifique (Xist) accumulation de lncRNA X-inactive (appelé un nuage Xist) sur l'un des deux chromosomes X chez les femelles-mammifères est une étape critique pour initier inactivation du chromosome X. ARN Xist interagit directement ou indirectement avec diverses enzymes de modification de la chromatine et introduit paysages épigénétiques distinctes au chromosome X inactif (Xi). Une des caractéristiques de l'épigénétique connu Xi est l'histone H3 lysine triméthyl-27 (H3K27me3) modification. Ici, nous décrivons un immuno-FISH simple et rapideprotocole pour la détection de l'ARN Xist en utilisant l'ARN FISH avec plusieurs sondes d'oligonucléotides couplés avec immunofluorescence de H3K27me3 d'examiner la localisation des ARN Xist et des modifications épigénétiques associées. Utilisant des sondes oligonucléotidiques se traduit par un temps d'incubation plus courte et une détection plus sensible de l'ARN Xist rapport au transcrit in vitro des sondes d'ARN (des ribosondes). Ce protocole fournit un outil puissant pour comprendre la dynamique de lncRNAs et sa modification épigénétique associé, la structure de la chromatine, organisation nucléaire et la régulation transcriptionnelle.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Mammalian inactivation du chromosome X (XCI) est une stratégie pour compenser le déséquilibre de dosage de gène lié à l'X entre XX et XY, dans lequel l'un des deux chromosomes X chez les femelles est transcriptionnellement 1 inactivé. Inactivation du chromosome X est un système modèle très longtemps ARN non codant (lncRNA) recherche. Inactivation du chromosome X est réglementée par de multiples lncRNAs, et a été largement étudiée au cours des dernières décennies à découvrir les mécanismes de diaphonie entre lncRNAs, la transcription, la structure de la chromatine et l'organisation nucléaire 2, 3.

Le centre d'inactivation X (XIC) situé sur le chromosome X est un locus génétique complexe constitué d'un certain nombre de gènes qui produisent des ARN non codants 4. X-inactive transcrit spécifique (Xist) lncRNA chez les mammifères euthériens est un de ces lncRNA qui joue un rôle crucial dans inactivation du chromosome X 5,6. transcriptions de Xist entourent l'emplacement du future Xi pour lancer inactivation du chromosome X, et apparaît comme un nuage quand visualisées en utilisant l'ARN FISH; cette formation est appelé le "Xist Couverture" 7. Étant donné que l'ARN Xist interagit avec diverses enzymes de modification de la chromatine, la co-localisation des nuages ​​Xist avec différentes modifications épigénétiques de la chromatine et la transcription silencieux répressif est observée au cours de l'inactivation du chromosome X-8. Par exemple, l'ARN Xist interagit avec polycomb complexe répressive 2 (PRC2) qui est responsable de H3K27me3 et induit un état ​​de la chromatine répressive 9. L'apparition du nuage de Xist sur ​​le Xi et son co-localisation avec la modification H3K27me3 intensive représente un paysage de hétérochromatine facultative du Xi 10,11.

Techniques cytogénétiques, comme l'ADN / ARN FISH ont parcouru un long chemin de la méthode traditionnelle en utilisant des sondes radiomarquées 12 aux techniques récentes et avancées avec une sensibilité accrue etl'imagerie de fluorescence en utilisant plusieurs sondes oligonucléotidiques 13,14. ADN / ARN FISH couplé avec immunofluorescence a été régulièrement utilisé comme un outil cytologique de comprendre l'organisation spatio-temporelle nucléaire, localisation d'ARN, la structure de la chromatine et modifications. La préparation de sonde la plus standard pour ARN FISH implique l'utilisation de plasmide ou de chromosomes artificiels (BAC) clones bactériens et leur étiquetage ultérieure soit avec translation de coupure ou amorçage aléatoire 15. Cependant, près de 70% des gènes chez la souris et 40% des gènes chez l'homme montrent un chevauchement des sens et antisens transcriptions 16, donc nécessitant une méthode de FISH spécifique de brin afin de distinguer sens et antisens transcriptions. In vitro des sondes d'ARN transcrits (ribosonde ) sont souvent utilisés pour spécifique de brin ARN FISH 17,18; Toutefois, il se agit de la préparation d'un clone de plasmide ou d'un produit PCR avec T7, SP6, ou le promoteur de T3 et ribosondes de synthèse. En outre, des ribosondes dérivé de génomeic ADN ou ADNc contiennent souvent des régions non-spécifiques et les éléments répétitifs, qui se traduisent par un bruit de fond élevé. Un autre problème est que ribosondes, qui sont à quelques centaines de nucléotides de long et contiennent plusieurs fluorophores, ne peuvent pas pénétrer efficacement dans le noyau. Pour éviter cela, plusieurs sondes oligonucléotidiques courtes marqués avec un fluorophore unique à la fin ont été développées qui ont une bonne sensibilité, la puissance du signal uniforme, et la facilité de purification et de manipulation 14. En outre, les oligonucleotides d'ADN sont généralement plus stables que les ARN. Nous avons appliqué une stratégie similaire en utilisant des oligonucléotides ARN Xist dans FISH 19 avec immunofluorescence de comprendre la dynamique de l'Xi épigénétiques induites par Xist lncRNA pendant le processus d'inactivation du chromosome X. Ce protocole décrit la création de sondes oligonucléotidiques et une bonne préparation des cellules, ainsi que l'utilisation de l'immunofluorescence et l'ARN FISH. ARN Xist FISH utilisant oligonucle multiplesotides est approche rentable à long terme si ARN Xist FISH est effectuée régulièrement dans son laboratoire. Cette technique peut être utilisée pour identifier lncRNAs dans les cellules tout en traçant simultanément son co-localisation avec des modifications ou des facteurs épigénétiques. Un avantage majeur du protocole est la possibilité de modifier facilement pour l'adapter à ses intérêts de recherche.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Préparation de la sonde

  1. Obtenir de multiples oligonucléotides uniques dans Xist (oligonucléotides 20-30 nucléotides de longueur, de 63 à 65 ºC température de fusion, tableau 1) avec une modification 5'-amino et de suspendre dans l'eau.
  2. Piscine quantités équimolaires d'oligonucléotides avec 5'-amino modification (total 4,5 ug) et étiqueter avec colorant fluorescent amine réactive en suivant les instructions du fabricant.
    1. Dissoudre les oligonucléotides regroupés dans Final 5 pi d'eau sans nucléase et ajouter 3 pl de 1 M de bicarbonate de sodium à la solution d'oligonucléotide.
    2. Ajouter 2 ul DMSO pour le flacon de colorant et vortex amine réactive brièvement.
    3. Mélanger la solution d'oligonucléotides avec le colorant réactif dans du DMSO et on incube le mélange à température ambiante pendant 1 heure dans l'obscurité.
  3. On purifie les sondes oligonucléotidiques marquées par fluorescence par colonne G-25 suivie d'une précipitation à l'éthanol.
    1. Ajouter de l'eau sans nucléase 40 pi au mélange d'étiquetage produit dans l'étape 1.2.3 et appliquer à la colonne G-25. Centrifuger à 750 g pendant 2 min.
    2. Ajouter 50 ul d'eau sans nuclease, 10 ul de 3 M d'acétate de sodium (pH 5,2) et 250 ul d'éthanol à la sonde purifiée de l'étape 1.3.2. Conserver à -80 ° C pendant 30 min et centrifuger à 21 000 g pendant 15 min à 4 ° C.
    3. Laver les oligonucleotides précipitées une fois avec 1 ml d'éthanol à 70%.
    4. Remettre en suspension dans 50 pi d'eau sans nuclease ou TE (10 mM Tris-HCl, pH 7,5; 1 mM EDTA) à une concentration finale d'environ 10 uM.
  4. Diluer les sondes oligonucléotidiques marquées par fluorescence à une concentration finale de 250 nM avec un tampon d'hybridation (10% formamide; 2x SSC [NaCl 300 mM; citrate de sodium 30 mM]; 2 mg / ml de BSA; 10% de sulfate de dextrane).
    NOTE: Avec ce protocole FISH rapide, oligonucléotide ppeignoirs dans Xist ont été conçus et utilisés à une concentration supérieure à la normale protocole FISH en utilisant des sondes oligonucléotidiques dans le but de raccourcir le temps d'incubation pour l'hybridation.

2. Préparation de la lame

REMARQUE: Les diapositives peuvent être préparé pour immuno-FISH utilisant souches de souris embryonnaires (ES) ou le corps embryoïdes (EB) la différenciation des cellules 20, 21 soit par leur culture directement sur ​​lame de poly-lysine-traité ou en utilisant cytospin avec suspension cellulaire. Ici, la préparation de lame par cytospin se affiche.

  1. Aspirer le milieu de culture dans une boîte de 6 puits. Laver avec du PBS (température ambiante), et aspirer à fond.
  2. Ajouter 0,5 ml de trypsine dans le plat à 6 puits, incuber pendant 5-10 min à 37 ° C.
  3. Ajouter 5 ml de milieu et de disperser les cellules par pipetage doucement monter et descendre plusieurs fois.
  4. Transférer les cellules dans un tube de 15 ml, centrifuger pendant 5 min à 200 x g à température ambiante.
  5. Jeter un moyenD délicatement les cellules en suspension dans 2 ml de PBS.
  6. Compter les cellules en utilisant un hémocytomètre, et on dilue la suspension de cellules à 4 x 10 5 cellules / ml en PBS.
  7. Assembler un toboggan, une carte de filtre et une chambre avec un clip et placez-les dans les fentes appropriées dans le rotor de la cytospin. Ajouter 250 pi de chaque échantillon préparé à l'étape 2.6 dans chaque chambre des unités assemblées dans le cytospin. Centrifuger à 1500 rpm pendant 10 min à température ambiante.
  8. Remplir trois bocaux de Coplin sur la glace avec 40 ml chacun de tampon PBS, CSK glacée (PIPES 10 mM, pH 6,8; NaCl 100 mM; mM de saccharose 300; 3 mM MgCl 2), et la zone tampon CSKT (tampon CSK avec 0,5% de Triton X-100), respectivement.
  9. Après la cytospin est terminée, transférer rapidement le glissement vers PBS glacé et incuber pendant 5 min.
  10. Placer les lames dans le tampon CSK glacée et incuber pendant 1 min.
  11. Placer les lames dans le tampon CSKT glacée et incuber pendant 5 min.
  12. Transférer le retomber dans glacée CSK buffert et incuber pendant 1 min.
  13. Transférer la diapositive dans 4% de paraformaldehyde dans du PBS et incuber pendant 10 min à température ambiante.

3. immunofluorescence

  1. Placer les lames dans une jarre de Coplin avec du PBST (1x PBS avec 0,1% de Tween-20) pour plusieurs sec.
  2. Placer les lames à une inclinaison permettant tampon restant à se écouler sur le toboggan. Essuyez soigneusement l'excès de liquide hors de la diapositive et placez-le dans une boîte pipette pointe vide avec de l'eau. Superposez la lame avec 40 ul de la solution de blocage (PBS 1x, 1% de BSA, 0,1% de Tween-20), placer délicatement une lamelle, et incuber pendant 10 min à température ambiante.
  3. Retirer la lamelle, retirez la solution de blocage, et ajouter 40 ul de l'anticorps primaire Histone H3K27me3 dilué à une concentration de 1: 500 dans une solution de blocage. Placer la lamelle couvre-objet sur la lame arrière et incuber pendant 30 min à température ambiante.
    REMARQUE: Un inhibiteur de RNase dans la solution de blocage peut être utile pour préserver l'ARN dans cet ARN FISH protocole lorsque les anticorps polyclonaux sont utilisés.
  4. Laver glisser deux fois dans des bocaux de Coplin remplis avec du PBST, pendant 5 minutes chacune, secouant doucement pendant le lavage.
  5. Placer les lames à une inclinaison permettant tampon restant à se écouler sur le toboggan. Essuyez soigneusement l'excès de liquide et placer la lame dans la boîte de pointe. Superposition avec 40 pi de l'anticorps secondaire (1: 500) dilué dans une solution de blocage, placez une lamelle, et incuber pendant 15 minutes dans l'obscurité. Pour les étapes suivantes, garder la lame dans l'obscurité à tout moment.
  6. Laver deux fois en COPLIN bocaux avec du PBST comme dans l'étape 3.4.

4. ARN FISH avec sondes oligonucléotidiques

  1. Préchauffer une boîte pipette pointe vide avec de l'eau au fond pour empêcher les glissements de sécher à 37 ° C pour l'ARN FISH à l'étape 4.3.
  2. Placer les lames à une inclinaison permettant tampon restant à se écouler sur le toboggan. Essuyez soigneusement l'excès de liquide de la lame de l'étape 3.6 et placer la lame dans la boîte pipette pointe avec water au fond. Ajouter 500 ul de tampon de lavage FISH (10% de formamide dans du SSC 2x) sur la lame et incuber pendant 5 minutes à température ambiante.
  3. Retirer la solution de lavage de FISH, ajouter 8 pi de sondes d'oligonucléotides sur la diapositive, placez une lamelle, et transférer la diapositive à une boîte préchauffé pipette pointe avec de l'eau au fond; incuber à 37 ° C pendant 1-2 h.
  4. Placez trois bocaux de Coplin pré-chauffé dans un bain d'eau à 37 ° C avec un tampon de lavage de poisson, tampon de lavage avec du DAPI, et 2x SSC.
  5. Après 1-2 heures d'incubation pour l'ARN FISH, mettre la lame dans le tampon préchauffé lavage FISH.
  6. Incuber la lame pendant quelques minutes jusqu'à ce que la lamelle se détache de la diapositive.
  7. Placer la lame de nouveau dans le tampon de lavage, et continuer l'incubation pendant 5 min.
  8. Transférer la diapositive à l'autre bocal de Coplin avec un tampon de lavage FISH préchauffé avec 0,5 ng / ml DAPI et incuber pendant 5 min.
  9. Transférer la diapositive à l'autre bocal de Coplin avec 2x SSC préchauffé et incuber pendant 5 kmn.
  10. Placer les lames à une inclinaison permettant tampon restant à se écouler sur le toboggan. Essuyez soigneusement l'excès de liquide et placer la lame de nouveau dans une zone de la pointe sèche. Ajouter 4 pi de antifade avec DAPI sur la lame et placez une lamelle.
  11. Sceller la lamelle avec du vernis à ongles et d'observer sous un microscope. Le coulisseau peut être stocké à 4 ° C dans l'obscurité pendant quelques mois.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Des images représentatives de rapide immuno-FISH sont présentés dans la figure 1A. Co-localisation du nuage et H3K27me3 signaux ARN Xist sur le Xi a été détecté dans la différenciation des cellules femelles. Au jour 12 lors de la différenciation, plus de 90% des cellules EB avait un nuage Xist (figure 1B). Des sondes oligonucléotidiques courtes efficacement pénétré dans le noyau, ce qui conduit à une visualisation de la quasi-totalité des signaux H3K27me3 co-localisée avec l'ARN Xist (figure 1C; 97%, n = 150).

Figure 1
Figure 1: ARN Xist et H3K27me3 co-localiser sur le Xi à différencier la souris EB (A) Immuno-FISH pour les ARN Xist avec H3K27me3 modification de la différenciation des cellules EB femmes au jour 12 lors de la différenciation.. sondes de Xist ont été marquées avec Alexa Fluor 488, et anti-H3K27me3 anticorps primaire était laprotégés par des anticorps anti-IgG de souris Alexa Fluor 555 anticorps secondaire conjugué. Les noyaux ont été DAPI. La région encadrée est amplifié dans les panneaux de fond. Barres d'échelle:... 10 um (B) Fréquence de Xist cellules cloud et H3K27me3-positifs dans EB à jour 12 lors de la différenciation (C) Fréquence de la co-localisation de Xist nuage avec le signal H3K27me3 dans EB au jour 12 lors de la différenciation Se il vous plaît cliquez ici pour voir une version plus grande de cette figure.

Tableau 1: Séquence d'oligonucléotides marqués par fluorescence pour ARN Xist FISH. Les 48 oligonucléotides ont été synthétisés avec une modification 5'-amino pour préparer des sondes d'oligonucléotides marqués par fluorescence pour ARN Xist FISH.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dans cet article, nous avons présenté un rapide protocole immuno-FISH qui prend moins de 5 h pour compléter la préparation des lames, ARN Xist FISH, et l'immunofluorescence pour H3K27me3. En comparaison avec l'approche générale immuno-FISH pour les ARN Xist détection, qui a généralement besoin d'une nuit d'incubation pour l'ARN FISH, ce protocole non seulement réduit considérablement le temps passé, mais améliore également la sensibilité du système immunitaire FISH utilisant des sondes oligonucléotidiques.

Depuis Xist est fortement transcrit cours inactivation du chromosome X et de son relevé de notes se trouve à accumuler intensément sur ​​le Xi en cis, il est facile de détecter le signal Xist ARN dans la différenciation des cellules différenciées et par ARN FISH utilisant un temps relativement bref d'incubation. Ce protocole immuno-FISH pourrait être appliquée à d'autres protéines d'intérêt et de l'ARN abondante, bien que l'optimisation en immunofluorescence et de l'ARN FISH peut être nécessaire. Afin d'appliquer le protocole à d'autres ARN, le numbre de sondes oligonucléotidiques possibles devrait être considéré, suivie par l'optimisation essai-erreur de la concentration de la sonde, le temps d'incubation, et la température de l'ARN FISH. Un exemple d'autres applications est notre succès dans la détection précédente ARN télomérique utilisant des sondes LNA simples 22. Pour la conception de la sonde et la préparation pour la détection de cibles d'ARN de faible abondance, reportez-vous à l'article de Raj et Tyagi 23. Une autre question qui doit être considéré est l'étape de perméabilisation. Une attention particulière concernant les différentes conditions de perméabilisation est nécessaire; par exemple, des effets plus doux que ce qui est décrit dans notre protocole peuvent se produire avec perméabilisation 15 après fixation. Diverses procédures de perméabilisation doivent également être pris en compte lors de la réalisation d'immuno-FISH en utilisant différents types de cellules. L'ordre des immunofluorescence et de l'ARN FISH peut également affecter la détection de protéines cibles, modifications et ARN par immuno-FISH. Si l'ARN FISH est effectuered avant immunofluorescence, une heure d'incubation durant le segment ARN FISH est suffisant pour détecter les signaux ARN Xist. Cependant, depuis le formamide contenue dans le tampon d'hybridation et de tampon de lavage FISH affecte négativement H3K27me3 immunofluorescence, nous portons toujours hors H3K27me3 immunofluorescence avant ARN Xist FISH dans ce protocole. Pour d'autres applications, l'ordre des procédures dépendra des protéines cibles et des modifications épigénétiques à observer par immunofluorescence. Comme l'anticorps primaire nous avons utilisé pour H3K27me3 immunofluorescence a un titre élevé et une spécificité de 24 H3K27me3, nous sommes en mesure d'utiliser un temps d'incubation plus courte pour immunofluorescence. Cependant, le temps de réaction et de la température pour une immunocoloration dépendent de l'anticorps utilisé et donc l'optimisation est nécessaire pour chaque anticorps.

Utilisation de sondes oligonucléotidiques, Xist détection d'ARN par l'ARN FISH a été significativement améliorée. Dans nos études précédentes, nous avons trouvé qu'un sous-ensemble de difcellules ferentiating avec H3K27me3 coloration sur le Xi ne sont pas associés avec le signal ARN Xist 25. Depuis H3K27me3 sur la modification Xi est associée à un recrutement de PRC2 par l'ARN Xist 9-11, 26, nous avons supposé que cela était dû à la pénétration de ribosondes inefficace dans les noyaux par rapport à l'anticorps pour immunofluorescence. En utilisant des sondes oligonucléotidiques dans ce protocole, nous avons observé que le signal H3K27me3 dans la différenciation des cellules femelles presque toujours co-localisés avec ARN Xist (Figure 1).

Ce protocole immuno-FISH rapide nous permet de gagner un aperçu des changements dynamiques gravitant autour Xist lncRNA et offre un nouvel outil pour aider à acquérir une meilleure compréhension de la façon dont fonctionne lncRNA. IncRNAs affecter diverses fonctions cellulaires telles que l'empreinte génomique, la régulation des gènes, la traduction de l'ARN, l'ARN et la maturation 27. Développer une compréhension accrue du rôle diversifiés joué par lncRNA aiderait à propulser le domaine de l'avant et de permettre de futures découvertes dans la régulation des processus cellulaires vitaux dans le corps humain, ainsi que de contribuer au développement de cibles potentielles pour les traitements de la maladie. Depuis ce protocole peut être facilement optimisée par rapport à d'autres marqueurs et lncRNAs d'intérêt, ce est un excellent outil pour aider à lutter contre les mystères de diverses lncRNAs dans les cellules.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Xp1 ggtaagtatccaaaaccccgttgg
Xp2 cgatcagcagcaacagtacacg
Xp3 gcaattggttgcttttatccagtcc
XP4 cgcaacaccgcacactaatacg
XP5 gccatcttagacacattcaagagcat
Xp6 cacacgtgaagtaccaagcgaaac
XP7 gccacgtatagagcactgtaagagactatg
XP8 caaagcacactatcagacgtgtcg
XP9 ggagaatctagatgccataaaggcaag
XP10 tgatggacactgcattttagcactg
XP11 ggacactgcattttagcaatacgattc
XP12 gtgatgggcactgcattttagc
XP13 agatgggctatctcagtcttataggct
XP14 ggaagtcagtatggagggggtatg
XP15 tgggactgtgactactacagcaatga
XP16 aagactcaattcctagtcaggattatccac
XP17 gggctgtagctctatgacagtgcttt
Xp18 gtcttcaccagatgcagattactacagtg
XP19 aatagtttgaggaaggggtttcaagtg
XP20 gctgttcaggtttccttctgtagtga
Xp21 gcaagagatacaatggtccgaaaagt
Xp22 agcacttcgtacaaccctctttctg
Xp23 gaagagagcaggtcattcgtcagag
Xp24 gcaactgagacactgtagccatatgaag
Xp25 ttcctggaggaagaacggaaaga
XP26 tgattagaaggcttaggtcatcttcca
Xp27 ttttgttcagagtagcgaggacttga
Xp28 aatagagcagaatggcttcctcgaa
Xp29 acattgcttgatcacgctgaagac
XP30 gcaaggaagaaatagacacacaaagc
Xp31 ggaagaaatagatgtaacaaagaattagacaca
XP32 cacttcagagccacttgaatcctg
Xp33 agtcacaggtgtcctgtagaaacagttc
Xp34 cctttatgggcaatggcaacaat
Xp35 ggcacatctgcatattgcttgtcta
Xp36 gcaactaagaccatgaacccacaa
Xp37 aaacacactggccttaagtatatggactg
Xp38 cattcatttgcacacatggaacaat
Xp39 tgggagacaatatttagcctccaggt
XP40 cctagcaagggcactgttttgtaataa
Xp41 taacatttagcacactgccttgcac
Xp42 cagtgatctacactaggtccacctcaca
Xp43 ttatgttgaaggaatcttggccttg
Xp44 aagtgagagctgtagtctcaaggtgtga
Xp45 gtattcaacctctgaggcaaactgtg
Xp46 agattgtggaacttagatggctgtca
Xp47 tggaactgcattaaagtcccaacttag
Xp48 gaactcccagacctcttcaacctg
Name Company Catalog Number Comments
oligonucleotides with 5’-amino modification IDT
Alexa Fluor 488 Reactive Dye Life Technologies A32750
MicroSpin G-25 columns GE Healthcare 27-5325-01
Cytospin 2 Shandon 59900102
Bovine Serum Albumin, Molecular Biology Grade (for hybridization buffer) Roche 10715859103
Histone H3K27me3 antibody Active Motif 61017
Alexa Fluor 555 Goat Anti-Mouse, highly cross-adsorbed Life Technologies A21424
ProLong Gold antifade reagent Life Technologies P36931

DOWNLOAD MATERIALS LIST

References

  1. Payer, B., Lee, J. T. X chromosome dosage compensation: how mammals keep the balance. Annu Rev Genet. 42, 733-772 (2008).
  2. Lee, J. T. Gracefully ageing at 50, X-chromosome inactivation becomes a paradigm for RNA and chromatin control. Nat Rev Mol Cell Biol. 12, 815-826 (2011).
  3. Gendrel, A. V., Heard, E. Fifty years of X-inactivation research. Development. 138, 5049-5055 (2011).
  4. Froberg, J. E., Yang, L., Lee, J. T. Guided by RNAs: X-inactivation as a model for lncRNA function. J Mol Biol. 425, 3698-3706 (2013).
  5. Penny, G. D., Kay, G. F., Sheardown, S. A., Rastan, S., Brockdorff, N. Requirement for Xist in X chromosome inactivation. Nature. 379, 131-137 (1996).
  6. Marahrens, Y., Panning, B., Dausman, J., Strauss, W., Jaenisch, R. Xist-deficient mice are defective in dosage compensation but not spermatogenesis. Genes Dev. 11, 156-166 (1997).
  7. Clemson, C. M., McNeil, J. A., Willard, H. F., Lawrence, J. B. XIST RNA paints the inactive X chromosome at interphase: evidence for a novel RNA involved in nuclear/chromosome structure. J Cell Biol. 132, 259-275 (1996).
  8. Sado, T., Brockdorff, N. Advances in understanding chromosome silencing by the long non-coding RNA. Xist. Phil Trans R Soc B. 368, 20110325-20 (2013).
  9. Zhao, J., Sun, B. K., Erwin, J. A., Song, J. J., Lee, J. T. Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome. Science. 322, 750-756 (2008).
  10. Plath, K., et al. Role of histone H3 lysine 27 methylation in X inactivation. Science. 300, 131-135 (2003).
  11. Silva, J., et al. Establishment of histone h3 methylation on the inactive X chromosome requires transient recruitment of Eed-Enx1 polycomb group complexes. Dev Cell. 4, 481-495 (2003).
  12. Gall, J. G. Differential synthesis of the genes for ribosomal RNA during amphibian oogenesis. Proc Natl Acad Sci U S A. 60, 553-560 (1968).
  13. Femino, A. M., Fay, F. S., Fogarty, K., Singer, R. H. Visualization of single RNA transcripts in situ. Science. 280, 585-590 (1998).
  14. Raj, A., van den Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. Imaging individual mRNA molecules using multiple singly labeled probes. Nat Methods. 5, 877-879 (2008).
  15. Chaumeil, J., Augui, S., Chow, J. C., Heard, E. Combined immunofluorescence, RNA fluorescent in situ hybridization, and DNA fluorescent in situ hybridization to study chromatin changes, transcriptional activity, nuclear organization, and X-chromosome inactivation. Methods Mol Biol. 463, 297-308 (2008).
  16. Katayama, S., et al. Antisense transcription in the mammalian transcriptome. Science. 309, 1564-1566 (2005).
  17. Ogawa, Y., Xite Lee, J. T. X-inactivation intergenic transcription elements that regulate the probability of choice. Mol Cell. 11, 731-743 (2003).
  18. Panning, B. X inactivation in mouse ES cells: histone modifications and FISH. Methods Enzymol. 376, 419-428 (2004).
  19. Khalil, A. M., et al. Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc Natl Acad Sci U S A. 106, 11667-11672 (2009).
  20. Martin, G. R., Evans, M. J. Differentiation of clonal lines of teratocarcinoma cells: formation of embryoid bodies in vitro. Proc Natl Acad Sci U S A. 72, 1441-1445 (1975).
  21. Lee, J. T., Lu, N. Targeted mutagenesis of Tsix leads to nonrandom X inactivation. Cell. 99, 47-57 (1999).
  22. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, 685-698 (2009).
  23. Raj, A., Tyagi, S. Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes. Methods Enzymol. 472, 365-386 (2010).
  24. Kimura, H., Hayashi-Takanaka, Y., Goto, Y., Takizawa, N., Nozaki, N. The organization of histone H3 modifications as revealed by a panel of specific monoclonal antibodies. Cell Struct Funct. 33, 61-73 (2008).
  25. Ogawa, Y., Sun, B. K., Lee, J. T. Intersection of the RNA interference and X-inactivation pathways. Science. 320, 1336-1341 (2008).
  26. Kohlmaier, A., et al. A chromosomal memory triggered by Xist regulates histone methylation in X inactivation. PLoS Biol. 2, 171 (2004).
  27. Wang, K. C., Chang, H. Y. Molecular mechanisms of long noncoding RNAs. Mol Cell. 43, 904-914 (2011).
Fluorescent rapide<em&gt; In Situ</em&gt; Protocole hybridation pour ARN Xist combinée avec d&#39;immunofluorescence Histone Modification dans inactivation du chromosome X
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yue, M., Charles Richard, J. L., Yamada, N., Ogawa, A., Ogawa, Y. Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation. J. Vis. Exp. (93), e52053, doi:10.3791/52053 (2014).More

Yue, M., Charles Richard, J. L., Yamada, N., Ogawa, A., Ogawa, Y. Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation. J. Vis. Exp. (93), e52053, doi:10.3791/52053 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter