Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Schnell Fluorescent Published: November 26, 2014 doi: 10.3791/52053
* These authors contributed equally

Abstract

Kombinieren RNA Fluoreszenz in situ Hybridisierung (FISH) mit Immunfluoreszenz (Immuno-FISH) schafft eine Technik, die auf der Ebene einzelner Zellen verwendet werden können, um die räumliche Dynamik RNA Lokalisierung mit gleichzeitige Einblick in die Lokalisierung von Proteinen, epigenetische Modifikationen und andere Details zu detektieren die durch Immunfluoreszenz markiert werden kann. X-Chromosom-Inaktivierung ist ein Paradigma für lange nicht-kodierende RNA (lncRNA) vermittelte Gen-Silencing. X-inaktiven spezifischen Transkripts (Xist) lncRNA Ansammlung (genannt Xist Wolke) an einem der beiden X-Chromosomen in weiblichen Säugern ist ein kritischer Schritt, um X-Chromosom Inaktivierung initiieren. Xist-RNA direkt oder indirekt in Wechselwirkung mit verschiedenen Chromatin-modifizierende Enzyme und stellt verschiedene epigenetischen Landschaften in den inaktiven X-Chromosom (Xi). Eine bekannte epigenetischen Kennzeichen der Xi ist der Histone H3 trimethyl-Lysin-27 (H3K27me3) Änderung. Hier haben wir eine einfache und schnelle Immun FISH beschreibenProtokoll zum Nachweis von Xist-RNA mit RNA-FISH mit mehreren Oligonukleotid-Sonden in Verbindung mit Immunfluoreszenz von H3K27me3, um die Lokalisierung von Xist-RNA und die damit verbundenen epigenetische Veränderungen zu untersuchen. Verwendung von Oligonucleotidsonden zu einer kürzeren Inkubationszeit und empfindlicher Nachweis von Xist RNA im Vergleich zu in vitro transkribierte RNA-Sonden (Ribosonden). Dieses Protokoll stellt ein leistungsfähiges Werkzeug für das Verständnis der Dynamik von lncRNAs und die damit verbundenen epigenetische Modifikation der Chromatinstruktur, Kern Organisation und Transkriptionsregulation.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Säugetier X-Chromosom Inaktivierung (XCI) ist eine Strategie, um die Unwucht in X-verknüpften Gens Dosis zwischen XX und XY, wobei eines der beiden X-Chromosomen in Weibchen transkriptionell inaktivierten 1 kompensieren. X-Chromosom-Inaktivierung ist eine große Modellsystem für lange nicht-kodierende RNA (lncRNA) Forschung. X-Chromosom-Inaktivierung von mehreren lncRNAs geregelt und wurde ausgiebig in den letzten Jahrzehnten untersucht, um die Übersprechmechanismen zwischen lncRNAs, Transkription, Chromatinstruktur und Kernorganisation 2, 3 aufzudecken.

Die X-Inaktivierung Zentrum (XIC) auf dem X-Chromosom lokalisiert ist eine komplexe genetische Locus einer Reihe von Genen, die Herstellung nicht-kodierenden RNAs 4 besteht. X-inaktiv spezifische Transkript (Xist) lncRNA in eutherian Säugetieren ist eine solche lncRNA, die eine entscheidende Rolle bei der X-Chromosom-Inaktivierung 5,6 spielt. Xist Transkripte umgeben den Ort der futur Xi bis X-Chromosom-Inaktivierung zu initiieren, und erscheinen wie eine Wolke, wenn visualisiert mittels RNA FISH; Diese Formation wird als "Xist Cloud" 7 bezeichnet. Seit Xist-RNA interagiert mit verschiedenen Chromatin-modifizierende Enzyme, wird Co-Lokalisation der Xist Wolken mit verschiedenen epigenetische Modifikationen für stille Chromatin und repressive Transkription während X-Chromosom Inaktivierung 8 beobachtet. Beispielsweise interagiert Xist-RNA mit polycomb repressive komplexen 2 (PRC2), die für H3K27me3 verantwortlich ist und induziert eine repressive Chromatin Zustand 9. Das Auftreten der Xist Wolke am Xi und seine Co-Lokalisierung mit der intensiven H3K27me3 Änderung stellt eine fakultative Heterochromatin Landschaft des Xi 10,11.

Zytogenetischen Techniken, wie DNA / RNA-FISH haben einen langen Weg von der traditionellen Methode mit radioaktiv markierten Sonden 12 auf die jüngsten und modernsten Techniken mit verbesserter Empfindlichkeit und kommenFluoreszenz-Bildgebung mit mehreren Oligonukleotidsonden 13,14. DNA / RNA-FISH in Verbindung mit Immunfluoreszenz wurde routinemäßig als zytologische Werkzeug benutzt, um Raum-Zeit-Atom-Organisation, RNA-Lokalisierung, Chromatinstruktur und Modifikationen zu verstehen. Die Standardsonde Vorbereitung RNA FISH beinhaltet die Verwendung von Plasmid oder bakteriellen künstlichen Chromosoms (BAC) Klonen und deren anschließende Markierung entweder mit Nick-Translation oder Random-Priming-15. Fast 70% der Gene in Mäusen und 40% der Gene in Menschen zeigen jedoch eine Überlappung von Sense- und Antisense-Transkripte 16, daher um Sense- und Antisense-Transkripte unterscheidet die eine strangspezifische FISH-Verfahren. In vitro transkribierte RNA-Sonden (Ribosonde ) werden oft für strangspezifischen RNA-FISH 17,18 verwendet; Dies ist jedoch mit Herstellung eines Plasmid-Klon oder PCR-Produkt mit T7, SP6 oder T3-Promotor und Synthetisieren Ribosonden. Außerdem Ribosonden von genom abgeleitetic DNA oder cDNA enthalten oft unspezifische Regionen und repetitiven Elementen, was zu hohen Hintergrundgeräuschen führen. Ein weiteres Problem ist, dass Ribosonden, die einige hundert Nukleotide lang sind, und enthalten mehrere Fluorophore, nicht effizient in den Zellkern einzudringen. Um dies zu umgehen, wurden mehrere kürzere Oligonukleotidsonden mit einem einzigen Fluorophor am Ende markierten entwickelt worden, die eine gute Empfindlichkeit, einheitliche Signalstärke und der Leichtigkeit der Reinigung und Handhabung von 14 haben. Darüber hinaus sind DNA-Oligonukleotide in der Regel stabiler als RNA. Wir verwendeten eine ähnliche Strategie unter Verwendung von Oligonukleotiden in Xist RNA FISH 19 mit Immunfluoreszenz die epigenetische Dynamik des Xi durch Xist lncRNA während des Prozesses der X-Chromosom Inaktivierung induziert verstehen. Dieses Protokoll beschreibt die Erstellung von Oligonukleotid-Sonden und die richtige Vorbereitung der Zellen, sowie die Verwertung von Immunfluoreszenz und RNA-FISH. Xist-RNA-FISH mit mehreren oligonucleotides ist kostensparenden Lösung in den langfristigen, wenn Xist RNA FISH wird routinemäßig in einem Labor durchgeführt wird. Diese Technik kann verwendet werden, um lncRNAs in Zellen zu identifizieren und gleichzeitig die Abbildung ihrer Co-Lokalisierung mit epigenetische Modifikationen oder Faktoren werden. Ein großer Vorteil des Protokolls ist die Fähigkeit, leicht zu modifizieren, seine Forschungsinteressen gerecht zu werden.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Probe Vorbereitung

  1. Erhalten mehrere einzigartige Oligonukleotide in Xist (20-30 Nukleotide Länge Oligonukleotide, 63-65 ° C Schmelztemperatur, Tabelle 1) mit einem 5'-Amino Änderung und Aussetzung im Wasser.
  2. Pool äquimolare Mengen von Oligonukleotiden mit 5'-Amino-Modifikation (insgesamt 4,5 ug) und Etikett mit aminreaktiven fluoreszierenden Farbstoff nach den Anweisungen des Herstellers.
    1. Lösen Sie den gepoolten Oligonukleotide in letzten 5 ul Nuklease-freies Wasser und fügen Sie 3 ul 1 M Natriumbicarbonat mit dem Oligonukleotid-Lösung.
    2. Add 2 ul DMSO in das Fläschchen mit aminreaktiven Farbstoff und kurz vortexen.
    3. Mischen Sie die Oligonucleotidlösung mit dem Reaktivfarbstoff in DMSO und Inkubation der Mischung bei Raumtemperatur für 1 Stunde im Dunkeln.
  3. Reinige den fluoreszenzmarkierten Oligonukleotidsonden durch G-25-Säule, gefolgt von Ethanolfällung.
    1. In 40 ul Nuklease-freies Wasser auf die in Schritt 1.2.3 hergestellten Markierungsmischung und gelten für die Spalte G-25. Zentrifuge bei 750 × g für 2 min.
    2. Dann werden 50 & mgr; l Nuklease-freies Wasser, 10 & mgr; l 3 M Natriumacetat (pH 5,2) und 250 & mgr; l Ethanol zu der gereinigten Probe aus Schritt 1.3.2. Bei -80 ° C für 30 Minuten und Zentrifugation bei 21.000 xg für 15 min bei 4 ° C.
    3. Einmal mit 1 ml 70% Ethanol waschen fällt Oligonukleotide.
    4. Re-suspendieren in 50 & mgr; l Nuklease-freies Wasser oder TE (10 mM Tris-HCl, pH 7,5; 1 mM EDTA) bei einer Endkonzentration von etwa 10 uM.
  4. Verdünne die fluoreszenzmarkierten Oligonukleotidsonden zu einer Endkonzentration von 250 nM mit Hybridisierungspuffer (10% Formamid; 2 × SSC [300 mM NaCl, 30 mM Natriumcitrat]; 2 mg / ml BSA; 10% Dextransulfat).
    HINWEIS: Mit dieser schnellen FISH-Protokoll, Oligonukleotid-pRoben Xist wurden entworfen und in einer höheren Konzentration als die normale FISH Protokoll unter Verwendung von Oligonucleotidsonden, um die Inkubationszeit für die Hybridisierung verwendet verkürzen.

2. Schieben Vorbereitung

HINWEIS: Die Objektträger für Immun FISH mit embryonalen Stammzellen der Maus (ES) oder Embryoidkörper (EB) vorbereitet werden differenzierenden Zellen 20, 21 entweder durch den Anbau von ihnen direkt auf einem Polylysin behandelten Folie oder mit Cytospin mit Zellsuspension. Hier wird durch Cytospin-Präparat gezeigt.

  1. Absaugen Kulturmedium in einer 6-Napf-Schale. Mit PBS (Raumtemperatur), und saugen Sie gründlich waschen.
  2. 0,5 ml Trypsin in den 6-Well-Platte, Inkubation für 5-10 min bei 37 ° C.
  3. 5 ml Medium und zerstreuen Zellen durch vorsichtiges Auf- und Abpipettieren mehrmals.
  4. Übertragungszellen in ein 15 ml-Röhrchen, Zentrifuge für 5 Minuten bei 200 × g bei Raumtemperatur.
  5. Entsorgen Sie das Medium eind sanft die Zellen in 2 ml PBS.
  6. Zählen von Zellen unter Verwendung eines Hämocytometers und verdünnte Zellsuspension bei 4 x 10 5 Zellen / ml mit PBS.
  7. Bauen Sie eine Diashow, einen Filter-Karte und eine Kammer mit einem Clip und legen Sie sie in die entsprechenden Schlitze in dem Rotor der Cytospin. Fügen Sie 250 ul jeder Probe in Schritt 2.6 in jede Kammer der Baugruppen in der Cytospin vorbereitet. Zentrifuge bei 1.500 Upm für 10 min bei Raumtemperatur.
  8. Füllen 3 Coplin Gläser auf Eis mit 40 ml eiskaltem PBS, CSK-Puffer (10 mM PIPES, pH 6,8, 100 mM NaCl, 300 mM Saccharose; 3 mM MgCl 2) und CSKT Puffer (CSK-Puffer mit 0,5% Triton X-100), jeweils.
  9. Nachdem der Cytospin beendet ist, die Folie schnell in eiskaltem PBS übertragen und Inkubation für 5 min.
  10. Die Objektträger in eiskaltes CSK Puffer und Inkubation für 1 min.
  11. Die Objektträger in eiskaltes CSKT Puffer und Inkubation für 5 min.
  12. Die Objektträger wieder in eiskaltes CSK buffer und Inkubation für 1 min.
  13. Die Objektträger in 4% Paraformaldehyd in PBS und Inkubation für 10 min bei Raumtemperatur.

3. Immunfluoreszenz

  1. Objektträger in eine Coplin-Gefäß mit PBST (1x PBS mit 0,1% Tween-20) für mehrere Sekunden.
  2. Legen Sie die Dias schräg so dass Restpuffer zu fließen auf der Rutsche. Wischen Sie vorsichtig die überschüssige Flüssigkeit aus der Folie und legen Sie sie in einem leeren Pipettenspitzen-Box mit Wasser. Überlagern Sie die Folie mit 40 ul Blockierungslösung (1x PBS, 1% BSA, 0,1% Tween-20), sanft legen Sie eine Deckglas, und Inkubation für 10 min bei Raumtemperatur.
  3. Entfernen Sie das Deckglas, entfernen Sie die Blockierungslösung, und fügen Sie 40 ul der Histone H3K27me3 primären Antikörpers zu einer Konzentration von 1: 500 verdünnt in Blockierungslösung. Legen Sie das Deckglas wieder auf der Folie und Inkubation für 30 min bei Raumtemperatur.
    HINWEIS: Ein RNase-Inhibitor in der Blockierungslösung könnte hilfreich sein, um RNA in dieser RNA FIS erhaltenH-Protokoll bei polyklonalen Antikörpern eingesetzt werden.
  4. Wash schieben 2 mal in Coplin Gläser mit PBST gefüllt, je 5 Minuten, leichtes Schütteln beim Waschen.
  5. Legen Sie die Dias schräg so dass Restpuffer zu fließen auf der Rutsche. Wischen Sie vorsichtig die überschüssige Flüssigkeit und legen Sie die Folie wieder in die Spitze ein. Overlay mit 40 ul des sekundären Antikörpers (1: 500) in Blocking-Lösung verdünnt, setzen Sie ein Deckglas, und Inkubation für 15 min im Dunkeln. Für die folgenden Schritte, halten Sie die Folie in der Dunkelheit zu allen Zeiten.
  6. In Färbetrog mit PBST, wie in Schritt 3.4 Waschen Sie 2 mal.

4. RNA-FISH mit Oligonukleotidsonden

  1. Pre-Aufwärmen eine leere Pipettenspitzen-Box mit Wasser auf dem Boden, um Folien aus dem Trocknen bei 37 ° C für die RNA-FISH in Schritt 4.3 zu verhindern.
  2. Legen Sie die Dias schräg so dass Restpuffer zu fließen auf der Rutsche. Wischen Sie vorsichtig die überschüssige Flüssigkeit aus der Folie aus Schritt 3.6 und platzieren Sie die Folie in der Pipettenspitzen-Box mit water an der Unterseite. Gib 500 ul FISH Waschpuffer (10% Formamid in 2 × SSC) auf dem Objektträger, Inkubation 5 min bei Raumtemperatur.
  3. Entfernen FISH Waschlösung, fügen 8 ul von Oligonukleotid-Sonden auf dem Objektträger, legen Sie ein Deckglas, und übertragen Sie die Folie in eine vorgewärmte Pipettenspitzen-Box mit Wasser auf dem Boden; Inkubieren bei 37 ° C für 1-2 Std.
  4. Platz 3 vorgewärmt Coplin-Glaszylinder in einem Wasserbad bei 37 ° C mit FISH Waschpuffer, FISH Waschpuffer mit DAPI und 2 × SSC.
  5. Nach 1-2 h Inkubation für RNA FISH, setzen Sie den Schieber in die vorgewärmte FISH Waschpuffer.
  6. Inkubieren für ein paar Minuten, bis die Deck fällt der Folie.
  7. Den Objektträger wieder in die Waschpuffer, und weiter Inkubation für 5 min.
  8. Die Objektträger in einem anderen Coplin-Gefäß mit vorgewärmter FISH Waschpuffer mit 0,5 ng / ml DAPI und Inkubation für 5 min.
  9. Die Objektträger in einem anderen Coplin Glas mit vorgewärmten 2x SSC und Inkubation für 5 min.
  10. Legen Sie die Dias schräg so dass Restpuffer zu fließen auf der Rutsche. Wischen Sie vorsichtig die überschüssige Flüssigkeit und legen Sie den Rückfall in einem trockenen Spitze Box. In 4 ul Antifade mit DAPI auf den Objektträger und setzen Sie ein Deckglas.
  11. Deckglasränder mit Nagellack und beobachten unter dem Mikroskop. Der Schieber kann bei 4 ° C im Dunkeln für einige Monate gelagert werden.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Repräsentative Bilder der schnellen Immun FISH in 1A gezeigt. Co-Lokalisation der Xist RNA Wolke und H3K27me3 Signal auf dem Xi in differen weiblichen Zellen nachgewiesen. Am Tag 12 nach Differenzierung, mehr als 90% des EB-Zellen hatte eine Xist Wolke (1B). (; 150 97%, n = 1C) kurze Oligonucleotidsonden effizient in den Zellkern durchdrungen wird, was zu einer Visualisierung mit Xist RNA fast alle H3K27me3 Signale kolokalisiert.

Figur 1
Abbildung 1: Xist-RNA und H3K27me3 Co-Lokalisierung auf der Xi bei der Differenzierung von Maus-EB (A) Immuno-FISH für Xist-RNA mit H3K27me3 Änderung bei der Differenzierung von weiblichen EB Zellen am Tag 12 nach Differenzierung.. Xist Sonden wurden mit Alexa Fluor 488 markiert ist, und Anti-H3K27me3 Primärantikörper de wurdevon Anti-Maus-IgG Alexa Fluor 555-konjugierten Sekundärantikörper geschützt. Die Zellkerne wurden mit DAPI gegengefärbt. Die boxed Region ist in den Bodenplatten vergrößert. Maßstabsbalken:... 10 um (B) Häufigkeit der Xist Cloud- und H3K27me3-positiven Zellen in EB an Tag 12 nach Differenzierung (C) Häufigkeit der Kolokalisation von Xist Wolke mit H3K27me3 Signal EB an Tag 12 nach Differenzierung Bitte Klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Tabelle 1: Reihenfolge der fluoreszenzmarkierten Oligonukleotide für Xist-RNA-FISH. Die 48 Oligonukleotide wurden mit einem 5'-Amino Änderung fluoreszenzmarkierten Oligonukleotid-Sonden für RNA Xist FISH vorzubereiten synthetisiert.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In diesem Papier haben wir eine schnelle Immun FISH-Protokoll, das weniger als 5 Stunden dauert, Präparat, Xist-RNA FISH und Immunfluoreszenz für H3K27me3 abzuschließen präsentiert. Im Vergleich mit der allgemeinen Immun FISH Ansatz für Xist-RNA-Erkennung, die in der Regel braucht Inkubation über Nacht für die RNA-FISH, dieses Protokoll nicht nur deutlich reduziert Zeitaufwand, sondern verbessert auch die Empfindlichkeit der Immun-FISH mit Oligonukleotid-Sonden.

Seit Xist ist hoch während X-Chromosom Inaktivierung transkribiert und ihre Niederschrift festgestellt wird, sammeln sich intensiv auf die Xi in cis, ist es leicht, bei der Differenzierung und differenzierten Zellen durch RNA-FISH unter Verwendung einer relativ kurzen Inkubationszeit erkennen Xist-RNA-Signal. Diese Immuno-FISH Protokoll könnte für andere Proteine ​​von Interesse und reichlich RNA angewendet werden, obwohl die Optimierung in der Immunfluoreszenz und RNA-FISH kann erforderlich sein. Um das Protokoll zu anderen RNA die num gelten,ber möglicher Oligonukleotidsonden müsste berücksichtigt werden, gefolgt durch Versuch und Irrtum optimiert Konzentration der Sonde, Inkubationszeit und Temperatur für die RNA-FISH. Ein Beispiel für andere Anwendungen ist unsere bisherigen Erfolge bei der Aufdeckung von Telomer-RNA mit einzelnen LNA-Sonden 22. Für Sondendesign und der Vorbereitung für den Nachweis von niedrigen reichlich RNA-Zielen finden Sie in dem Artikel von Raj und Tyagi 23. Ein weiteres Problem, das berücksichtigt werden muss, ist die Permeabilisierung Schritt. Die sorgfältige Abwägung in Bezug auf verschiedene Permeabilisierung Zustand erforderlich ist; kann beispielsweise milder Wirkung als das, was in unserem Protokoll beschrieben mit Permeabilisierung nach der Fixierung 15 stattfinden. Verschiedene Permeabilisierung Verfahren müssen auch bei der Durchführung von Immuno-FISH mit verschiedenen Zelltypen zu berücksichtigen. Die Reihenfolge der Immunfluoreszenz und RNA FISH kann auch die Detektion von Targetproteinen, Modifikationen und RNA durch immuno-FISH. Wenn RNA-FISH ist führened vor der Immunfluoreszenz, ist einer einstündigen Inkubation bei der RNA-FISH-Segment genug, um zu erkennen Xist-RNA-Signal. Da jedoch die im Hybridisierungspuffer und FISH Waschpuffer enthalten Formamid wirkt sich negativ auf H3K27me3 Immunfluoreszenz, führen wir immer H3K27me3 Immunfluoreszenz vor Xist-RNA FISH in diesem Protokoll. Für andere Anwendungen, um die Reihenfolge der Verfahren würde auf die Zielproteine ​​und epigenetische Modifikationen hängen durch Immunfluoreszenz beobachtet werden. Als der primäre Antikörper, die wir für H3K27me3 Immunofluoreszenz verwendet wird, einen hohen Titer und Spezifität an H3K27me3 24, sind wir in der Lage, eine kürzere Inkubationszeit für Immunfluoreszenz verwenden. Reaktionszeit und Temperatur für die Immunfärbung sind jedoch abhängig von der verwendeten Antikörper und damit Optimierung für jeden Antikörper benötigt.

Verwendung von Oligonucleotidsonden wurde Xist RNA Nachweis durch RNA FISH deutlich verbessert. In unseren früheren Studien fanden wir, dass eine Teilmenge von difzier Zellen mit H3K27me3 Färbung auf der Xi nicht mit Xist-RNA Signal 25 verbunden. Da H3K27me3 Modifikation am Xi mit PRC2 Rekrutierung durch Xist RNA 9 zugeordnet - 11, 26, folgerten wir, dass dies aufgrund der ineffizienten Eindringen von Ribosonden in die Kerne gegenüber dem Antikörper für Immunfluoreszenz. Durch die Verwendung von Oligonukleotid-Sonden in diesem Protokoll beobachteten wir, dass H3K27me3 Signal bei der Differenzierung von weiblichen Zellen fast immer mit Xist-RNA (Abbildung 1) co-lokalisiert.

Diese schnelle Immun FISH-Protokoll ermöglicht es uns, eine Momentaufnahme der dynamischen Veränderungen rund um Xist lncRNA gewinnen und bietet ein neues Werkzeug, um ein besseres Verständnis der Art und Weise lncRNA funktioniert. IncRNAs verschiedenen zellulären Funktionen wie genomische Prägung, Genregulation, RNA-Translation und RNA-Reifung 27 beeinflussen. Entwicklung eines besseren Verständnis der vielfältigen Rolles durch lncRNA gespielt würde dazu beitragen, das Feld vorwärts zu treiben und damit für zukünftige Entdeckungen in der Regulation der lebenswichtigen zellulären Prozessen im menschlichen Körper, aber auch einen Beitrag zur Entwicklung der potenzielle Ziele für Krankheitsbehandlungen. Da dieses Protokoll kann leicht in Bezug auf andere Marker und lncRNAs von Interesse optimiert werden, es ist ein großartiges Werkzeug, um dazu beitragen, die Geheimnisse der verschiedenen lncRNAs in Zellen.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Xp1 ggtaagtatccaaaaccccgttgg
Xp2 cgatcagcagcaacagtacacg
Xp3 gcaattggttgcttttatccagtcc
XP4 cgcaacaccgcacactaatacg
Xp5 gccatcttagacacattcaagagcat
XP6 cacacgtgaagtaccaagcgaaac
XP7 gccacgtatagagcactgtaagagactatg
Xp8 caaagcacactatcagacgtgtcg
XP9 ggagaatctagatgccataaaggcaag
XP10 tgatggacactgcattttagcactg
Xp11 ggacactgcattttagcaatacgattc
XP12 gtgatgggcactgcattttagc
XP13 agatgggctatctcagtcttataggct
XP14 ggaagtcagtatggagggggtatg
XP15 tgggactgtgactactacagcaatga
Xp16 aagactcaattcctagtcaggattatccac
XP17 gggctgtagctctatgacagtgcttt
Xp18 gtcttcaccagatgcagattactacagtg
XP19 aatagtttgaggaaggggtttcaagtg
XP20 gctgttcaggtttccttctgtagtga
Xp21 gcaagagatacaatggtccgaaaagt
Xp22 agcacttcgtacaaccctctttctg
Xp23 gaagagagcaggtcattcgtcagag
XP24 gcaactgagacactgtagccatatgaag
Xp25 ttcctggaggaagaacggaaaga
XP26 tgattagaaggcttaggtcatcttcca
Xp27 ttttgttcagagtagcgaggacttga
Xp28 aatagagcagaatggcttcctcgaa
Xp29 acattgcttgatcacgctgaagac
XP30 gcaaggaagaaatagacacacaaagc
XP31 ggaagaaatagatgtaacaaagaattagacaca
XP32 cacttcagagccacttgaatcctg
Xp33 agtcacaggtgtcctgtagaaacagttc
Xp34 cctttatgggcaatggcaacaat
Xp35 ggcacatctgcatattgcttgtcta
Xp36 gcaactaagaccatgaacccacaa
Xp37 aaacacactggccttaagtatatggactg
Xp38 cattcatttgcacacatggaacaat
Xp39 tgggagacaatatttagcctccaggt
XP40 cctagcaagggcactgttttgtaataa
XP41 taacatttagcacactgccttgcac
Xp42 cagtgatctacactaggtccacctcaca
Xp43 ttatgttgaaggaatcttggccttg
XP44 aagtgagagctgtagtctcaaggtgtga
Xp45 gtattcaacctctgaggcaaactgtg
XP46 agattgtggaacttagatggctgtca
Xp47 tggaactgcattaaagtcccaacttag
Xp48 gaactcccagacctcttcaacctg
Name Company Catalog Number Comments
oligonucleotides with 5’-amino modification IDT
Alexa Fluor 488 Reactive Dye Life Technologies A32750
MicroSpin G-25 columns GE Healthcare 27-5325-01
Cytospin 2 Shandon 59900102
Bovine Serum Albumin, Molecular Biology Grade (for hybridization buffer) Roche 10715859103
Histone H3K27me3 antibody Active Motif 61017
Alexa Fluor 555 Goat Anti-Mouse, highly cross-adsorbed Life Technologies A21424
ProLong Gold antifade reagent Life Technologies P36931

DOWNLOAD MATERIALS LIST

References

  1. Payer, B., Lee, J. T. X chromosome dosage compensation: how mammals keep the balance. Annu Rev Genet. 42, 733-772 (2008).
  2. Lee, J. T. Gracefully ageing at 50, X-chromosome inactivation becomes a paradigm for RNA and chromatin control. Nat Rev Mol Cell Biol. 12, 815-826 (2011).
  3. Gendrel, A. V., Heard, E. Fifty years of X-inactivation research. Development. 138, 5049-5055 (2011).
  4. Froberg, J. E., Yang, L., Lee, J. T. Guided by RNAs: X-inactivation as a model for lncRNA function. J Mol Biol. 425, 3698-3706 (2013).
  5. Penny, G. D., Kay, G. F., Sheardown, S. A., Rastan, S., Brockdorff, N. Requirement for Xist in X chromosome inactivation. Nature. 379, 131-137 (1996).
  6. Marahrens, Y., Panning, B., Dausman, J., Strauss, W., Jaenisch, R. Xist-deficient mice are defective in dosage compensation but not spermatogenesis. Genes Dev. 11, 156-166 (1997).
  7. Clemson, C. M., McNeil, J. A., Willard, H. F., Lawrence, J. B. XIST RNA paints the inactive X chromosome at interphase: evidence for a novel RNA involved in nuclear/chromosome structure. J Cell Biol. 132, 259-275 (1996).
  8. Sado, T., Brockdorff, N. Advances in understanding chromosome silencing by the long non-coding RNA. Xist. Phil Trans R Soc B. 368, 20110325-20 (2013).
  9. Zhao, J., Sun, B. K., Erwin, J. A., Song, J. J., Lee, J. T. Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome. Science. 322, 750-756 (2008).
  10. Plath, K., et al. Role of histone H3 lysine 27 methylation in X inactivation. Science. 300, 131-135 (2003).
  11. Silva, J., et al. Establishment of histone h3 methylation on the inactive X chromosome requires transient recruitment of Eed-Enx1 polycomb group complexes. Dev Cell. 4, 481-495 (2003).
  12. Gall, J. G. Differential synthesis of the genes for ribosomal RNA during amphibian oogenesis. Proc Natl Acad Sci U S A. 60, 553-560 (1968).
  13. Femino, A. M., Fay, F. S., Fogarty, K., Singer, R. H. Visualization of single RNA transcripts in situ. Science. 280, 585-590 (1998).
  14. Raj, A., van den Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. Imaging individual mRNA molecules using multiple singly labeled probes. Nat Methods. 5, 877-879 (2008).
  15. Chaumeil, J., Augui, S., Chow, J. C., Heard, E. Combined immunofluorescence, RNA fluorescent in situ hybridization, and DNA fluorescent in situ hybridization to study chromatin changes, transcriptional activity, nuclear organization, and X-chromosome inactivation. Methods Mol Biol. 463, 297-308 (2008).
  16. Katayama, S., et al. Antisense transcription in the mammalian transcriptome. Science. 309, 1564-1566 (2005).
  17. Ogawa, Y., Xite Lee, J. T. X-inactivation intergenic transcription elements that regulate the probability of choice. Mol Cell. 11, 731-743 (2003).
  18. Panning, B. X inactivation in mouse ES cells: histone modifications and FISH. Methods Enzymol. 376, 419-428 (2004).
  19. Khalil, A. M., et al. Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc Natl Acad Sci U S A. 106, 11667-11672 (2009).
  20. Martin, G. R., Evans, M. J. Differentiation of clonal lines of teratocarcinoma cells: formation of embryoid bodies in vitro. Proc Natl Acad Sci U S A. 72, 1441-1445 (1975).
  21. Lee, J. T., Lu, N. Targeted mutagenesis of Tsix leads to nonrandom X inactivation. Cell. 99, 47-57 (1999).
  22. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, 685-698 (2009).
  23. Raj, A., Tyagi, S. Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes. Methods Enzymol. 472, 365-386 (2010).
  24. Kimura, H., Hayashi-Takanaka, Y., Goto, Y., Takizawa, N., Nozaki, N. The organization of histone H3 modifications as revealed by a panel of specific monoclonal antibodies. Cell Struct Funct. 33, 61-73 (2008).
  25. Ogawa, Y., Sun, B. K., Lee, J. T. Intersection of the RNA interference and X-inactivation pathways. Science. 320, 1336-1341 (2008).
  26. Kohlmaier, A., et al. A chromosomal memory triggered by Xist regulates histone methylation in X inactivation. PLoS Biol. 2, 171 (2004).
  27. Wang, K. C., Chang, H. Y. Molecular mechanisms of long noncoding RNAs. Mol Cell. 43, 904-914 (2011).
Schnell Fluorescent<em&gt; In-situ-</em&gt; Hybridisierung Protokoll für Xist-RNA in Kombination mit Immunfluoreszenz von Histonmodifikationen in X-Chromosom-Inaktivierung
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yue, M., Charles Richard, J. L., Yamada, N., Ogawa, A., Ogawa, Y. Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation. J. Vis. Exp. (93), e52053, doi:10.3791/52053 (2014).More

Yue, M., Charles Richard, J. L., Yamada, N., Ogawa, A., Ogawa, Y. Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation. J. Vis. Exp. (93), e52053, doi:10.3791/52053 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter