Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Парные Рост конкуренции Анализ для определения репликации Фитнес человека вируса иммунодефицита

doi: 10.3791/52610 Published: May 4, 2015

Introduction

Вирусный фитнес репликации определяется как способность вируса для производства инфекционного потомства в данной среде 1 и является важным фактором в определении распространенности вируса варианта на популяционном уровне в течение долгого времени 2. Как и в естественных условиях фитнес исследования не представляется возможным с патогенными человеческих вирусов, таких как ВИЧ-1, различные в пробирке и экс естественных условиях репликации фитнес анализы были разработаны для изучения эффектов на фитнес, вытекающие из лекарственной устойчивости и иммунной мутаций эвакуации, эпистаза и эволюции вирусных популяций 3-6. Среди различных фитнес-анализов, конкуренция рост анализы признаются, получая более чувствительные и достоверные меры фитнес различий, а два или больше вариантов вируса конкурировать за тот же популяции клеток в точно таких же условиях окружающей среды, как это происходит в естественных условиях 1,7,8. Перед началом роста конкуренции эксперименты, несколько variabле должны быть определены, в том числе с использованием различных кратностей инфекции (МВД), отношение вирусной входного и времени выборки для анализа. Мы изучили влияние этих параметров на вирусных кинетики роста и об итогах конкурса экспериментов, и определили ключевые факторы, необходимые для надежных измерений ВИЧ-1 фитнеса в культуре клеток 9.

В дополнение к анализа переменных, есть множество способов количественного вирусных вариантов в конкуренции рост экспериментов. Массовое 10,11 или 12,13 клонального последовательности была использована для определения соотношения конкурирующих вирусов на основе нуклеотидных частот на участке (ах) интерес. Относительная пригодности происходит от изменений в этом соотношении с течением времени. Этот метод удобен, как секвенирование ДНК услуги широко доступны. Параллельно аллель-специфической последовательности метод (ПАСЕ) позволяет последовательности в нескольких сайтах и обнаружение рекомбинантами 14 15 или синонимичные мутации 4,16-18 как теги отличить конкурирующие вирусы от последовательности, гетеродуплексной отслеживания анализы (ОТЗ) 4,7,17,19 или обратной транскрипции-количественный ПЦР в реальном времени (RT-КПЦР) 15,16,18,20, все из которых могут быть применимы для изучения конкурирующих штаммов независимо от сходства последовательностей. Дополнительный шаг ввести теги в вирусных геномов и анализ RT-КПЦР также требует специфических реагентов и приборов. Мы обнаружили, что объемные Sanger секвенирования дает сопоставимые результаты 9.

После конкурса роста, вирусный фитнес репликации представлена ​​в виде относительной пригодности, или фитнес-соотношения тWO вирусных вариантов. Относительное пригодности вируса могут быть определены в качестве конечного пропорции в вирусной варианте нормированное исходное пропорции в инокулята или как разность чистый прирост между двумя конкурирующими вирусов. Мы обнаружили, что последний способ, с помощью продольных точек данных только в экспоненциальной фазе роста, производится наиболее надежные результаты 9,20.

В пробирке фитнес анализы используются в основном для изучения биологических клонов 6-8 и инфекционных молекулярные клоны ВИЧ-1. Последнее, будучи поддаются генетической манипуляции, которые часто используются для изучения влияния на фитнес от конкретных мутаций или определенных последовательностей интерес 3-5,21,22. Следующие протоколы описывают рабочий процесс с точки строительстве новых полнометражных инфекционных ВИЧ-1 молекулярных клонов с помощью ВИЧ-1 векторов, содержащих метку последовательности, введения мутаций, представляющих интерес, делая вирусные штаммы и установления кинетики роста вируса, Выполнением конкуренции рост анализа и расчета относительного фитнес (рисунок 1).

Используя наши оптимизированные процедуры, мы создали три рекомбинантных ВИЧ-1 мутантов и определяли их репликации фитнеса. Рекомбинантный молекулярного клонирования был построен путем замены затычки-p24 генный область pNL4-3, плазмиды, содержащей полноразмерный инфекционный геном ВИЧ-1 штамма лаборатории NL4-3 ВИЧ-1, синтетическим COTB (Center-of Дерево, подтип В) кляп р24 последовательности 23, чтобы создать напряжение прототип. Холост изменения аминокислот (T186M, T242N и I256V) затем были введены, чтобы создать три мутантных клонов. Каждый мутант соревновались против вируса прототипа наблюдать фитнес влияние каждой мутации в данном генетического фона. Три мутанты продемонстрировали различные уровни репликации fsitness от легкого до значительно ниже, чем вирус-прототипа. Мутация T242N ранее сообщалось, умеренный басс стоить 24-26 похож на результат, показанный в данном исследовании. Пригодности Стоимость двух других мутаций не было сообщено ранее.

Protocol

ПРИМЕЧАНИЕ: Протокол, как описано ниже, не включает в себя пациента информацию, и, таким образом, не рассматривается человека Субъекты Исследования Университета Вашингтона институциональной наблюдательного совета или Отдел людях.

1. Строительство химерных ВИЧ-1 NL4-3 молекулярных клонов

1.1) Усиление Вставить Фрагмент ДНК

  1. Дизайн химерных праймеров. 5'половинки и прямого и обратного праймеров содержать вектор последовательность ВИЧ-1, при котором фрагмент будет вставлен. 3 'половину из праймеров должен содержать конец последовательности вставки (рисунок 2). Убедитесь, что химерные праймера сохраняет оригинальные открытые рамки считывания.
    1. Использование праймеров по крайней мере 20 оснований в длину, с температурой плавления, большей или равной 60 ° С, ~ 50% содержанием GC и низкой тенденцией к образованию димеров праймеров, гетеродимеры и / или шпильки структуры. Оценить эти свойствас помощью веб-инструмента OligoAnalyzer ( https://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ ).
  2. Использование ПЦР 27 и химерные праймеры для амплификации ДНК-вставки (рисунок 2). Для каждой реакции ПЦР, используйте 1X высокой точностью буфер, 0,2 мм дНТФ, 1 U высокой верности ДНК-полимеразы, 0,5 мкМ вперед химерного праймера, 0,5 мкМ обратного праймера химерных и 1 pg0 нг образца ДНК, несущего вставки региона. Добавить дН 2 O до конечного объема 50 мкл.
  3. Установите тепловые действия велосипедные следующим образом: Выполните начальную стадию денатурации ДНК при 98 ° С в течение 10 сек. Amplify 30 циклов денатурации ДНК при 98 ° С в течение 10 сек и ДНК отжига при температуре 3 ° С выше самой низкой температуры плавления двух праймеров для 20 сек. Выполнение конечным удлинением при 72 ° С в течение 10 мин. Хранить продукты ПЦР при 4 ° С.
  4. Возьмите 5 мкл ПЦР-продуктов изпредыдущий шаг и запустить агарозном геле 28.
    1. Использование 0,7% агарозном геле, 1x TAE буфер (40 мМ Трис-ацетат, 1 мМ ЭДТА), 0,5 мкг / мл этидий бромид (EtBr) конечной концентрации и 1 кб лестнице в качестве размера ДНК маркера. Набор напряжения источника питания до 5 В / см расстояния между электродами. Остановка электрофореза, когда загрузка краситель мигрирует через примерно 2/3 длины геля. Представьте себе гель, используя систему документации геля 28.
      ПРИМЕЧАНИЕ: EtBr является канцерогеном и должны быть утилизированы неправильно, за правилами учреждения. Перчатки должны всегда носить при работе с гелями, содержащие EtBr. Замените их на новые перчатки после обработки закончить EtBr материала, содержащего и до обработки других материалов или оборудования для предотвращения перекрестного загрязнения.
  5. Если только одна полоса ДНК с размером, соответствующим желаемому продукту ПЦР обнаружено, очистить остальную часть продукта ПЦР с использованием коммерческого набора, такие как ПЦР QIAquick набора для очистки соответствииING с протоколами производителя.
    1. Если другие, неспецифические полосы также присутствуют, использовать остальную часть продукта ПЦР для запуска препаративного гель-электрофореза. Используйте те же параметры и условия, указанные в пункте 1.1.4. Убедитесь, что также гель является достаточно большим, чтобы загрузить ~ 45 мкл ПЦР-продуктов. Вырежьте полосу интерес и извлечь ДНК из геля с использованием набора для экстракции QIAquick гель в соответствии с протоколами производителя.

1.2) Введем Вставить фрагмент в полной длины инфекционных ВИЧ-1 подтипа B Vector (pNL4-3)

  1. Используйте очищенные продукты ПЦР с шага 1.1.5 как ПЦР-праймеров. Используйте pNL4-3VifA 20 в матричной ДНК в одном ПЦР и использовать pNL4-3VifB 20 в качестве шаблона в другой реакции (рис 2). Для каждой реакции ПЦР, использовать буфер 1x высокой точностью, 0,2 мМ дНТФ, 2 ед High Fidelity ДНК-полимеразы, 500 нг праймера ДНК и 50 нг ДНК-матрицы в конечном обумэ 50 мкл. Установка тепловых параметров велосипедные чтобы: 98 ° С в течение 30 сек, 35 циклов при 98 ° С в течение 10 сек, 48 ° С в течение 1 мин и 72 ° С в течение 10 мин, затем 72 ° С в течение 10 мин.
  2. Добавить 10 U ДПН я к 50 мкл ПЦР-реакции и инкубировать при 37 ° С в течение 1 часа, чтобы переварить матричной ДНК. Убедитесь, что плазмидную ДНК выделяли из метилирования компетентным бактериального штамма, например., TOP10 химически компетентным кишечной палочки.
  3. Использование Dpn переваренного продукта, чтобы трансформировать компетентные клетки бактерий. Используйте теплового шока трансформацию TOP10 химически компетентную E. палочка, в соответствии с протоколом производителя. Чтобы выбрать для бактериальных клеток, содержащих рекомбинантную плазмиду, используют бульон Лурии (LB) культуральные планшеты, содержащие 100 мг / л карбенициллина.
    1. Pick ~ 10 хорошо разделенных колонии растут и каждый в отдельности в 3 мл LB жидкой среде, содержащей 100 мг / л карбенициллина и инкубируют при 30 ° С вШейкер O / N.
    2. Использование QIAprep Spin Miniprep набор для выделения плазмидной ДНК из бактериальной культуральной жидкости, в соответствии с протоколом производителя.
  4. Используйте двойной рестрикции пищеварение 29, чтобы определить, содержит ли ДНК плазмиды надлежащего вставки. Убедитесь, что один из сайтов рестрикции существует только в области вставки, а другой сайт рестрикции существует только один раз в векторе ВИЧ-1, за пределами области вставки.
    1. Дайджест по крайней мере, 300 нг плазмидной ДНК в 10 мкл конечного объема реакционной смеси. Выберите буферы ограничения, температура инкубации и времени инкубации по протоколу производителя выбранных ферментов рестрикции. Возьмите 9 мкл переваренной ДНК и запустить гель-электрофореза, как описано в шаге 1.1.4. Выберите рекомбинантные плазмиды, которые имеют группы ДНК прогнозируемых размеров.
  5. Подтверждение целостности последовательности рекомбинантных плазмид Sanger секвенирования. В то время как редкий, нежелательныемутации (ы) может быть введен во ПЦР-реакций.
    1. Последовательность обе нити ДНК плазмиды. Следуйте инструкциям в шаге 1.1.1.1 дизайн праймеры для секвенирования. Кроме того, убедитесь, что прямого и обратного праймеров секвенирования отжиг по меньшей мере 50 п.н. выше и ниже области вставки в рекомбинантной плазмиде, соответственно.
    2. Отправить плазмиды ДНК и праймеры для секвенирования с коммерческим провайдером услуг секвенирования ДНК. Подготовка образца ДНК и праймеров, как указано поставщиком услуг.
  6. Сделать эндотоксина фри мутантного ДНК плазмиды с использованием набора бесплатно плазмидной ДНК эндотоксина в соответствии с протоколом производителя. Подготовьте по крайней мере, 1 мкг эндотоксина свободной ДНК плазмиды для трансфекции на следующей стадии.

1.3) Представьте Малый Мутации через сайт-направленного мутагенеза

  1. Дизайн мутагенных праймеров с перекрытием прямого и обратного праймеров, содержащих требуемую Mutatион (ы). Расположите базу (ы) должны быть заменены, встроены или удален в середине праймеров, в окружении 10-15 гомологичных оснований. Следуйте инструкциям в шаге 1.1.1.1.
  2. Используйте ПЦР для синтеза мутантных плазмид. Для каждой реакции ПЦР, использовать буфер 1x высокой точностью, 10 мМ дНТФ, 2 ед High Fidelity ДНК-полимеразы, 0,5 мкМ вперед мутагенного праймера, 0,5 мкМ обратного мутагенного праймера и 50 нг химерного pNL4-3VifB, с шага 1.2.6 , в конечном объеме 50 мкл. Установка тепловых параметров велосипедные чтобы: 98 ° С в течение 30 сек, 25 циклов при 98 ° С в течение 10 сек, 48 ° С в течение 1 мин и 72 ° С в течение 10 мин, затем 72 ° С в течение 10 мин.
  3. Повторите шаг 1.2.2 для 1.2.6.

2. Генерация вирусный штамм Использование трансфекции

  1. Рассчитать количество вирусных фондовой желании и плазмидной ДНК требуется. С титра вируса 10 4 МЕ / мл или выше, 1,8 мл вирусного наличии достаточно для двух комплектов конкуренции рост АссаYS, в том числе моноинфекциями, каждый сделал в трех экземплярах. Для трансфекции сделано в 6-луночный планшет, около 1,8 мл супернатант собирают на лунку. Один мкг плазмидной ДНК необходима для каждой трансфекции сделано в 6-луночный планшет.
  2. Для каждой лунке 6-луночного планшета, готовят 100 мкл трансфекции смеси, например., Состоящий из 1 мкл X-tremeGENE 9 реагента для трансфекции (или сопоставимый продукт), 1 мкг плазмидной ДНК и бессывороточной DMEM.
    1. Определить объем плазмидной ДНК, необходимой, используя 1 мкг плазмидной ДНК на лунку. Убедитесь, что конечная концентрация плазмидной ДНК, по крайней мере 50 нг / мкл.
    2. Определить, сколько бессывороточной среде Игла (DMEM) необходим на лунку, используя формулу: Общий объем DMEM в мкл = 100 мкл - объем ДНК мкл.
  3. Добавить 10 6 HEK 293T-17 (АТСС) клеток / лунку в 2 мл распространения среды Игла (DMEM + 10% фетальной бычьей сыворотки (FBS)) в 6-луночный планшет. Инкубировать в течение 1 ч при 37 ° С в5% атмосфере СО 2. Семенной столько скважин при необходимости (определяется на этапе 2.1).
  4. Для приготовления смеси для трансфекции, аликвоту соответствующий объем бессывороточной DMEM, как рассчитано выше, в 1,8 мл полипропиленовую центрифужную пробирку, а затем добавить реагента для трансфекции.
    1. Внесите реагент непосредственно в раствор массовой информации, не добавляйте его в пластиковой поверхности трубки микроцентрифужных. Добавить в прошлом плазмиды ДНК. Внесите вверх и вниз, осторожно, чтобы перемешать раствор. Инкубировать в течение 15 мин при комнатной температуре (15 ° С до 25 ° С), чтобы позволить образование трансфекции комплексов.
    2. Добавить смесь в каплям таким образом, чтобы клетки высевают в пластине 6-а. Слегка встряхните или закружить в колодцы, чтобы обеспечить равномерное распределение трансфекции комплексов.
    3. Печать пластины с пластиковой пленкой.
  5. Инкубируйте культур при 37 ° С в 5% СО 2 атмосферы в течение 48 ч.
  6. Используйте пипетку тщательно собирать и передавать супернатант в 15 мл трубки throuGH вершину 0,22 мкм фильтра.
  7. Использование пипетки для передачи 250 мкл или более отфильтрованной надосадочной жидкости до 1,8 мл микроцентрифужных пробирках с резиновыми прокладками в крышках.
  8. Магазин фильтруют супернатанты при -80 ° С до использования.

3. Определить Инфекционный титр вирусных запасов на мононуклеарных клеток периферической крови (МНПК)

  1. Стимулировать МНПК фитогемагглютинином (PHA). За один вирусный штамм, семян 2 х 10 6 РВМС в модифицированной среде Дульбекко полном Искова (cIMDM; IMDM с добавлением 20 ед / мл человеческого интерлейкина 2 (ГИП-2), 10% фетальной бычьей сыворотки и 1% пенициллина / стрептомицина), дополненной ФГА (1,5 мкг / мл). Семенной РВМС на 2 × 10 6 клеток / мл. Инкубируйте РВМС при 37 ° С в 5% СО 2 атмосферы в течение 72 ч.
  2. Урожай PHA стимулирует МНПК. Передача неприлипающими PHA-МНПК к 50 мл коническую пробирку. Спин трубку при 228 мкг в течение 10 мин. Осторожно снимите супернатант, не disruptinг осадок клеток. Повторное приостановить осадок клеток в конечной концентрации 2 × 10 5 РВМС / мл в cIMDM.
  3. Семенной 2 х 10 4 ФГА PBMC, стимулированных / лунку в 100 мкл / лунку в cIMDM с круглым дном 96-луночного планшета.
  4. Сделать разбавление вирусной складе 1:10. Затем из первого разбавленной складе, чтобы двенадцать 3-кратные серийные разведения в мастер 96-луночного планшета. Эта схема разбавления рекомендуется для обнаружения вирусные титры в диапазоне от 10 4 до 10 6 инфекционное отделение (МЕ) на мл.
    1. Например, можно добавить 20 мкл вирусного штамма 180 мкл среды в 1,5 мл пробирку. Смешайте разбавления с помощью пипетки осторожно. Затем перенесите 90 мкл разбавленного складе в 180 мкл среды первой скважины и хорошо перемешать с помощью пипетки.
    2. Продолжить серию разбавления путем передачи 90 мкл из текущего скважины до 180 мкл среды в следующую лунку еще одиннадцать раз. Увеличение или уменьшение начального разбавления, если титры выше, чем 10 6 МЕ / млили ниже, чем 10 4 МЕ / мл, как ожидается, соответственно.
  5. Добавить 40 мкл серийно разведенного вирусного складе с мастер разбавления пластины к пластине сеяной МНПК (со стадии 3.3) в четырех экземплярах. Планшеты инкубируют при 37 ° С в 5% СО 2 атмосферы в течение 16-24 ч.
  6. Осторожно удалить 100 мкл супернатанта из каждой лунки, и заменить 160 мкл свежей cIMDM до общего объема 200 мкл / лунку. Планшеты инкубируют при 37 ° С с 5% СО 2 атмосферы (1 день).
  7. В дни 4, 7, 10 и 13 передачи 100 мкл супернатанта из каждой лунки 100 мкл буфера нарушения (2% Тритон Х-100 в PBS), и заменить 100 мкл свежей cIMDM. Хранить супернатантов при -20 ° С.
    1. Держите проб и добавления свежей cIMDM каждые три дня, пока титр не стабилизируется.
  8. Определить 50% зараженной культуры ткани дозу (TCID 50) вируса складе по р24 ELISA с использованием 7 день и 13 пробы, как описано в пункте 4.
    1. Если TCID 50 получают из 13-й день явно выше, чем титр от 7 день, вирус складе, возможно, потребуется больше времени, чтобы расширить. Повторите р24 ELISA с использованием более поздние образцы до инфекционные титры из двух проб моменты времени не станет стабильным (или уменьшение). Выберите запасы из образцов с высоким титром.

4. ELISA (связанный Immunoabsorbant анализ) Обнаружение ВИЧ-1 p24 для определения титра вирусных инфекционных

ПРИМЕЧАНИЕ: Следующий протокол был разработан с использованием антигена р24 захвата пластины, приготовленные в нашей лаборатории 30. Коммерческий ВИЧ-1 р24 ELISA пластины / комплекты могут быть также использованы, в соответствии с протоколом производителя.

  1. До работы с образцами, готовить рабочие запасы первичного антитела (кролик анти-ВИЧ-1 р24 SF2 антисыворотки).
    1. Оттепель р24 антисыворотку при комнатной температуре.
    2. Смешайте 2,5 мл глицерина с 2 мл 10% FBS в Phosphatе буфер солевой раствор (PBS).
    3. Добавить 0,5 мл антисыворотки, перемешать.
    4. Магазин 1 мл аликвотах при -20 ° C.
  2. Оттепель образцы шагом 3,7 в 37 ° C инкубатора.
  3. Вымойте P24 захватить пластина 5 раз промывочным буфером (PBS 1x с 0,05% Tween-20).
  4. Добавить 50 мкл / лунку Разбавитель образца (1% бычьего сывороточного альбумина (БСА), 0,2% Твин-20 в RPMI-1640), а затем добавить 50 мкл образца в соответствующие лунки. Включите по крайней мере три скважины с разбавителя образца только как макет / отрицательных контролей. Инкубируют в течение 2 ч при 37 ° С или O / N при 4 ° С.
  5. Подготовка первичный раствор антител свежий перед использованием. Сделать 1: 2000-кратное разбавление первичного антитела рабочей запасов с использованием разбавитель первичных антител (12% FBS в RPMI-1640). Обеспечить, чтобы подготовить достаточно для использования 100 мкл раствора на каждой пробы / контроль скважины в 96-луночный планшет.
    1. Например, чтобы сделать достаточно решение в течение одного 96-луночного планшета, добавляют 5 мкл первичных антител Workiнг запасов в разбавителе первичных антител до конечного объема 10 мл.
  6. Вымойте захватить пластина 5 раз промывочным буфером.
  7. Добавьте 100 мкл раствора первичных антител в каждую лунку. Инкубируют в течение 1 ч при 37 ° С в 5% СО 2 атмосферы.
  8. Подготовка вторичного свежего раствора антител перед использованием. Сделать 1: 14400-кратное разбавление вторичных антител (1 мг / мл козьих антител против кроличьего HRP) с помощью вторичного антитела разбавитель (7% FBS, 0.01% Твин-20 в RPMI-1640). Для уменьшения ошибок пипетки, выполнить два шага серийное разведение. Обеспечить, чтобы подготовить достаточно для использования 100 мкл раствора на каждой пробы / контроль скважины в 96-луночный планшет.
    1. Например, чтобы сделать достаточно решение в течение одного 96-луночного планшета, сначала добавить 1 мкл вторичного антитела к 99 мкл вторичного антитела разбавителем. Затем добавляют 70 мкл первого разведения до вторичного антитела разбавителя для конечного объема 10 мл.
  9. Вымойте захвата пластины 5 тимES с промывочного буфера.
  10. Добавьте 100 мкл раствора вторичного антитела в каждую лунку. Инкубируют в течение 1 ч при 37 ° С в 5% СО 2 атмосферы.
  11. Промывают планшет 5 раз промывочным буфером.
  12. Добавить 100 мкл субстрата ТМВ РТ. Инкубируют 30 минут при комнатной температуре в закрытом контейнере для защиты от света.
  13. Добавить 100 мкл стоп-раствора RT (1 NH 2 SO 4).
  14. Оптическую плотность при 450-650 нм в каждой лунке с помощью микропланшет-ридера. Используйте значение абсорбции забить друг также зараженного или неинфицированных. Рассмотрим хорошо содержать инфекционный вирус, если значение оптической плотности, по крайней мере в три раза выше, чем значение из ложных / отрицательный скважин управления. Рассчитать TCID 50 вирусного складе методом Рида-Meunch 31.

5. Установите Вирусный кинетика роста

5.1) Моноинфекция

  1. Семена 3 х 10 5 РНА-стимулированные РВМС / лунку в 48-луночный планшетс в общем объеме 500 мкл / лунку. Держите культуру пластин при 37 ° С в 5% СО 2 атмосферы до прививки.
  2. Для каждого вируса, подготовить инокулята, содержащего 6000 МЕ в 2 мл cIMDM.
  3. Посев скважин в трех экземплярах добавлением 500 мкл инокулята (1500 МЕ) с семенами клеток. Конечный объем культуры инфицированная клетка 1 мл / лунку и МВД 0,005.
  4. Алиготе 200 мкл оставшейся посевного к каждой из двух 96-луночных планшетах для выделения РНК, один из которых сохраняется в качестве резервного.
  5. Инкубируйте культур при 37 ° С в 5% СО 2 атмосферы в течение 16-24 ч.
  6. Вымойте культуры 16-24 ч после прививки.
    1. Снимите и выбросьте 750 мкл супернатанта культуры.
    2. Добавить 750 мкл свежей cIMDM. Оберните пластин в пластиковой упаковке и спина в течение 10 минут при 300 х г. Снимите и выбросьте 750 мкл супернатанта.
    3. Добавить 750 мкл свежей cIMDM. Инкубируют при 37 ° С с 5% CO 2 вмосферу (1 день).
  7. Примеры культур ежедневно с 2 дня до 7 дня.
    1. Передача 500 мкл супернатанта культуры в 1,8 мл центрифужную пробирку. Спин в течение 1 мин при 3000 х г.
    2. Передача 200 мкл бесклеточного супернатанта в двух выборок 96-а для выделения РНК, снова экономия одну пластину в качестве резервного. Магазин супернатанты при -80 ° С до выделения РНК.
    3. Добавить 500 мкл свежей cIMDM для каждой культуры. Инкубируют при 37 ° С в 5% СО 2 атмосферы.
    4. Откажитесь культур в Wescodyne в конце эксперимента.
    5. Изолировать РНК из 200 мкл супернатанта (использование коммерческих наборов, таких как QIAamp РНК вируса Mini Kit) следующих стандартного протокола производителя. Для большого числа образцов, с помощью набора Qiagen QIAxtractor.
    6. Образцы магазин РНК при -80 ° С до синтеза кДНК.

5.2) Синтез кДНК (обратной транскрипции)

  1. Для каждого РНК сдостаточно добавить 1,2 нмоль дНТФ и 1,2 пмоль праймера дл синтеза кДНК, (5'-GTTGATCCTTTAGGTATCTTTCCACAGC-3 ', НХВ2 нуклеотидную 7968 до 7995) к 10 мкл вирусной РНК. Добавьте воду до конечного объема 14 мкл. Flick трубку для смешивания и кратко вращаться для сбора жидкости на дне пробирки.
  2. Инкубируют смесь в течение 5 мин при 65 ° С, а затем провести при 4 ° С до тех пор, пока мастер смесь подготовлена.
  3. Подготовьте основной смеси с помощью 5x первой нити буфера (250 мМ Трис-HCl, рН 8,3, 375 мМ KCl, 15 мМ MgCl 2), 5 мМ ДТТ, 120 ед SuperScriptIII и 240 U РНКазы ингибитор. Добавьте воду до конечного объема 10 мкл.
  4. Добавьте 10 мкл мастер смеси для РНК смеси, фильм, чтобы смешать и спин собирать.
  5. Инкубируют смесь в течение 90 мин при 50 ° С, чтобы позволить синтез кДНК. Инкубировать в течение 15 мин при 70 ° С для инактивации обратной транскриптазы. Удержание при 4 ° С по мере необходимости.
  6. Добавить 2 U РНКазы Н, фильм, чтобы смешать, а затем спина, чтобы собрать.
  7. Выдержите 20 минутпри 37 ° С. Магазин кДНК при -20 ° С.

5.3) кДНК Количественное Использование КПЦР системы

  1. Подготовьте стандартный ряд разбавления. У 10-кратное серийное разведение, от 3 ​​х 10 6 копий / мкл до 30 копий / мкл, в pNL4-3VifA. Используйте дистиллированную воду для разведения. Подготовьте стандартное разведение ряд свежий перед использованием или подготовить небольшие партии и держать при температуре -20 ° C. Не замораживать-оттаивать стандартов более чем в три раза.
  2. Настройка 96-а КПЦР реакции пластину. Убедитесь, что каждая пластина содержит, по меньшей мере, одну лунку отрицательного контроля, в трех экземплярах стандартной серии разведений, и по крайней мере дубликат каждого образца кДНК.
  3. Для каждой реакции КПЦР, использовать 12,5 мкл КПЦР мастер смеси, 0,2 мкМ зонда, 0,8 мкм каждого из прямого и обратного праймеров и 1 мкл кДНК или стандарт серии разведений или вода / буфер (для отрицательного контроля). Добавьте воду до конечного объема 25 мкл. КПЦР зонд свет сенаsitive. Держите его в закрытом контейнере.
    1. Для обнаружения кДНК, полученную из основанного pNL4-3VifA молекулярной клона, использовать VIFA праймера-зонд: VifAB прямого праймера (GGTCTGCATACAGGAGAAAGAGACT), VIFA обратный праймер (5'-AGGGTCTACTTGTGTGCTATATCTCTTTT-3 ') и VifAB зонд (6FAM-5'-CTCCATTCTATGGAGACTC-3 "-MGBNFQ). Для кДНК, полученной из клона, основанной pNL4-3VifB, использовать VifB праймера-зонд: VifAB прямой праймер, VifAB зонд и VifB обратного праймера (5'-CACCTGCGTGCTATACCTTTTCT-3 ').
  4. Установка параметров велосипедные ПЦР до 50 ° С в течение 2 мин, 95 ° С в течение 10 мин, и 40 циклов 95 ° С в течение 15 сек и 60 ° С в течение 1 мин. Обратитесь поддержки документ производителя для работы машины КПЦР.
  5. Рассчитать стандартную кривую, используя данные из трех экземплярах стандартной серии разбавления. Сравнение данных амплификации образца кДНК стандартной кривой для определения числа копий. Обратитесь поддержки документ производителя для DAобработка та.

5.4) Определить Вирусный экспоненциальный рост этап

  1. Участок вирусные кинетику роста с днем дискретизации вдоль оси Х и числа копий кДНК вдоль оси ординат и определить вирусную экспоненциальной фазе роста, то есть., Когда вирусные кДНК копировать номера увеличение в экспоненциальной прогрессии.
  2. С помощью веб-инструмента GRC ( http://indra.mullins.microbiol.washington.edu/grc/ ) для расчета вирусной темпы роста (г). В этом приложении, инструмент GRC принимает кДНК копировать номера из по меньшей мере двух временных точках в качестве входных данных, и выводит вирусный рост (G). Используйте только данные момент времени в экспоненциальной фазе роста (см шаг 5.4.1 выше), чтобы получить точные темпы роста. Для более подробного описания математической модели, используемой в веб-инструмента GRC, см 20.

6. Рост конкуренции Анализ

  1. Семя 3 х 10 5 </ SUP> PHA-стимулированных РВМС (или 1 × 10 5 клеток CEMx174) в 500 мкл общего объема на лунку в 48-луночных плоским дном пластины.
  2. Держите тарелку 37 ° С в 5% СО 2 атмосферы до прививки.
  3. Для каждого вируса, подготовить 3 мл инокулята, содержащего 6000 МЕ.
  4. Передача 1,5 мл каждого вирусного посевного материала в стерильную пробирку, чтобы создать двойной инфекцией инокулята. Добавить 500 мкл двойной инокулята (1500 МЕ) 3 х 10 5 клеток в 48-луночный планшет. Конечный объем культура 1 мл / лунку. Аликвоты 200 мкл инокулята в двух 96-луночных планшетах для выделения РНК; сохранить одну пластину в качестве резерва.
  5. Инкубируйте инокулированных клеток при 37 ° С с 5% CO 2 атмосфере в течение 16-24 ч.
  6. Вымойте культуры 16-24 ч после прививки.
    1. Снимите и выбросьте 750 мкл супернатанта культуры.
    2. Добавить 750 мкл свежей cIMDM. Оберните пластин в пластиковой упаковке и спина в течение 10 мин при 300 х г. Снимите и выбросьте 75081; л супернатанта.
    3. Добавить 750 мкл свежей cIMDM. Инкубируют при 37 ° С с 5% CO 2 атмосфере (1 день).
  7. Выберите время выборки, чтобы включать по меньшей мере 3 очка времени, в течение экспоненциальной фазы роста, наблюдаемого в стадии 5.4.1.
    1. Для каждого отбора проб, выполните шаг 5.1.7.
  8. Выполните синтеза кДНК, как описано в разделе 5.2.
  9. Определить вирусную соотношение вариант, используя КПЦР.
    1. Приготовьте серию стандартных серийных разведений в трех экземплярах, разбавляя в 10 раз на каждом этапе от 3 ​​× 10 6 копий / мкл до 30 копий / мкл pNL4-3VifA.
    2. Настройка 96-а КПЦР реакции пластину. Убедитесь, что каждая пластина содержит по меньшей мере один отрицательный контроль, стандартный ряд разбавления в трех экземплярах, и дубликаты каждого образца кДНК.
    3. Для каждой реакции КПЦР, использовать 12,5 мкл КПЦР Master Mix, 0,2 мкМ зонд, 0,8 мкМ каждого из прямого и обратного праймеров и 1 мкл кДНК или Стандарт D ilution серии или вода / буфер (для отрицательных контрольных лунках). Добавьте воду до конечного объема 25 мкл. КПЦР зонд является светочувствительным, держать его в закрытом контейнере.
      1. Используйте Vifa праймера-зонд для обнаружения сигналов в отрицательных контролей и стандартного серии разведений и с одной дубликата образца кДНК. Используйте VifB праймера-зонд с другой дубликат образца кДНК.
    4. Установка параметров велосипедные ПЦР до 50 ° С в течение 2 мин, затем 95 ° С в течение 10 мин, а затем 40 циклов при 95 ° С в течение 15 сек и 60 ° С в течение 1 мин. Обратитесь поддержки документ производителя для работы машины КПЦР.
    5. Рассчитайте стандартную кривую, используя данные амплификации из стандартного ряда разведения. Сравнение данных амплификации образцов кДНК с калибровочной кривой для определения числа копий. Обратитесь поддержки документ производителя для обработки данных.
    6. С помощью веб-инструмента GRC (ol.washington.edu/grc/">http://indra.mullins.microbiol.washington.edu/grc/) для вычисления относительного вирусной пригодность (D).
      ПРИМЕЧАНИЕ: инструмент GRC принимает кДНК копировать номера или хроматограмма пиковых высот, по крайней мере, двух временных точках, как на входе, и выдает разницу чистый прирост (г) между двумя вирусами. В то время как инструмент может рассчитать чистую скорость роста от двух данных точек время, настоятельно рекомендуется, чтобы входных данных из трех или более точек времени. Используйте только данные, полученные от временных точках в пределах фазы экспоненциального роста (см шаг 5,4), чтобы получить точные темпы роста. Для более подробного описания математической модели, используемой в веб-инструмента GRC, см 20.
  10. Определить вирусных отношения с помощью хроматограмме пика высоты
    1. ПЦР-амплификации ВИЧ-1 VIF фрагменты, содержащие последовательность тег VifAB используя VifFwd (5'-GAAAGAGACTGGCATTTGGGTCAGGG-3 '; НХВ2 позиции 5266-5291) и VifRev праймеры (5'-GTCTTCT GGGGCTTGTTCCATCTGTCC-3 '; НХВ2 позиции 5579-5553).
      1. Для каждой реакции ПЦР, используют 1 мкл кДНК, 1х NH 4 буфер, 1,5 мМ MgCl 2, 0,2 мМ дНТФ, 2,5 ед Taq-полимеразы, и 0,45 мкМ каждого праймера. Добавьте воду до конечного объема 50 мкл.
      2. Установка параметров велосипедные ПЦР 3 циклов при 94 ° С в течение 1 мин, 55 ° С в течение 1 мин и 70 ° С в течение 1 мин, а затем 34 циклов при 94 ° С в течение 15 сек, 58 ° C в течение 30 сек, и 70 ° С в течение 1 мин, а затем провести при 4 ° С.
    2. Очищают продуктов ПЦР, используя набор для очистки ПЦР QIAquick в соответствии с протоколом производителя.
    3. Отправить очищенные продукты ПЦР к поставщику услуг для секвенирования ДНК последовательности Sanger.
    4. Проверьте средний балл качества чтения, которые должны быть предоставлены службой секвенирования. Если средняя точность база вызов менее 85%, повторить шаг 6.10.1 6.10.3 для
    5. С помощью веб-инструмента ChromatQuan (f="http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi">http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi ) для вычисления вирусной соотношение в каждый момент времени. Инструмент требует файл последовательность трассировки (*) .ab1 и последовательность 5 'к нуклеотидной сайта интереса. Инструмент измеряет интенсивность пика на указанном сайте. Отношение пиковой интенсивности соответствует рациону двух вирусов (фиг.4В).
    6. С помощью веб-инструмента (GRC http://indra.mullins.microbiol.washington.edu/grc/ ) и записанные интенсивности пиков в качестве входных данных для вычисления относительного вирусной пригодность (D). См шаг 6.10.6. 20

Representative Results

Для изучения тренажерный влияние изменений отдельных аминокислот в ВИЧ-1 Gag-p24, мы использовали олигонуклеотид-направленного мутагенеза для введения мутации в плазмиду, содержащую pNL4-3 COTB-p24 гена 23,32,33 ВИЧ-1. Вирусные исходные были получены путем трансфекции клеток 293Т и собирали через 48 часов. Мы оценили 50% тканевой культуры инфекционного дозы (TCID 50) каждого вирусного складе по методу Рида-Мюнх 31. TCID 50 прототипа и мутантные вирусы колебалась от 10 4 до 10 5 МЕ / мл (фиг.3А).

Кинетика роста рекомбинантных вирусов были созданы в МНПК от одного донора на МВД 0,005. RT-КПЦР был использован для определения вирусной кДНК количество копий в день в течение шести дней. Все мутантные вирусы и прототип росли экспоненциально между днем ​​2 и 4 день, после чего замедляется вирусной роста, как указано снижением наклона увеличением числа копий вирусной РНК (<сильный> 3В). Уменьшение кДНК скопировать число в диапазоне от 0 день (в соответствии с инокулята) и 2-й день из-за поглощения вируса к клеткам и удаление несвязанных вирионов с каждым днем ​​1 стирки (этап 5.1.6). В экспоненциальной фазе роста, все три мутанта имел более низкую скорость роста (г), чем вирус-прототипа (рис 3C).

Все три мутанта были соревновались против вируса прототипа в конкурсе рост анализов на общую МВД 0,005. Вирусные кинетики роста в дуально Инфицированные культуры аналогична моноинфекции; вирусный экспоненциальной фазе роста было промежутке между 2 и 4, и вирусный рост достигало плато вокруг день 5 (фиг.4А).

Вирусные различия скорости роста были получены по изменению вирусной соотношении с течением времени. Вирусный отношение было вычислено на основе кДНК числа копий задания и мутантных вирусов с помощью RT-КПЦР, и сравнения высот пиковв последовательности нуклеотидов в хроматограмм сайтов, отличающих два вируса (рис 4б). Различия темпов роста, определяемые с помощью пик-высоту и вирусных РНК копирования методов номер дали сходные результаты (рис 4в). Все три мутанта были ниже, чем фитнес репликации прототипа вирусов с мутантным I256V, имеющего самую низкую пригодность (рис 4C).

Фигура 1
Рисунок 1: Блок-схема протоколов, представленных в данном документе Вирус протоколы Подготовка обеспокоенность строительство ВИЧ-1 рекомбинантных клонов и генерация вирусных акций.. Протоколы Фитнес анализы для установления вирусных кинетики роста и определения относительной вирусной фитнеса. Пунктирные линии представляют альтернативные потоки для протоколов. Например, мутации могут быть введены непосредственно в ВИЧ-1 NL4-3Молекулярная клон без генерирования рекомбинантного клона.

Рисунок 2
Рисунок 2:. Строительство ВИЧ-1 NL4-3 COTB Gag-p24 рекомбинантных молекул с использованием клонов расширение перекрытия ПЦР (A) Дизайн химерных праймеров. 5'половинки праймеров содержит последовательность вектора NL4-3 и 3'-половины содержат концы последовательности вставки. (B) Химерные праймеры для амплификации вставки фрагмента, COTB Gag-р24. (C) Фрагменты вставок используются в качестве праймеров для ПЦР второй генерировать новую рекомбинантную плазмиду.

Рисунок 3
Рисунок 3:. Вирусные характеристики роста в МНПК () Вход 10 TCID 50 (Б) Вирусные кинетики роста в моноинфекциями начали на МВД = 0,005. (C) Вирусные темпы роста в течение шести дней, в том числе экспоненциальной фазе роста (2-4 дней), полученной из панели (B). Величины, показанные представляют собой среднее из трех повторов из одного эксперимента. Столбики ошибок обозначают 95% доверительные интервалы.

Рисунок 4
Рисунок 4: Вирусный роста и относительной фитнес определения (A) Вирусный рост двойственно зараженных культур РВМС.. (B) Коэффициенты T242N и прототипов вирусов определяли с помощью RT-КПЦР или метод секвенирования пика высоты. (С) Чистые различия вирусные скорость роста (г) между мутантом и прототипа вирусов в инфицированных культурах дуально, как показано на (А). D значения были рассчитаны еПЗУ вирусных данные соотношении, показанном в (б). Величины, показанные представляют собой среднее из трех повторов из одного эксперимента. Столбики ошибок обозначают 95% доверительные интервалы.

Discussion

Протоколы, представленные состоял из двух основных частей: строительство рекомбинантных ВИЧ-1 молекулярных клонов и конкуренции рост анализов. Для того чтобы отличить два вируса в дуально инфицированной клеточной культуры, важно, чтобы конкурирующие молекулярные клоны содержат метки последовательности, которые могут быть обнаружены с помощью грунтовки-зонда анализа RT-КПЦР или путем Sanger секвенирования. Этот протокол использует в VIFA и VifB тегов, которые занимают ту же область ВИЧ-1 NL4-3 VIF и кодируют ту же самую аминокислотную последовательность, но отличаются от шести синонимичных мутаций. Эти мутации были показаны не влияет вирусная репликация фитнес 20. ПЦР-метод, основанный клонирования, использованной в данном протоколе обеспечивает большую гибкость в выборе сайты клонирования, по сравнению с клонированием основе сайт рестрикции. Тем не менее, эффективность ПЦР клонирования уменьшается по мере увеличения размера вставки. Ток предел размера вставки ~ 5 кб 34. Для ПЦР-клонирования и сайт-направленный mutagenesiс, использование высококачественного ДНК-полимеразы важно, чтобы уменьшить вероятность дополнительных мутаций. Использование минимального количества циклов ПЦР, необходимых для получения достаточного количества продуктов также рекомендуется. По нашему опыту, мы не обнаружили каких-либо дополнительных мутаций после клонирования и сайт-направленного мутагенеза шагов на основе ПЦР, описанных здесь. Тем не менее, ПЦР-продукты должны быть упорядочены, чтобы проверить наличие нежелательных мутаций. В идеале, весь регион кодирования ВИЧ должно быть resequenced.

По крайней мере, три выборки моменты времени должны быть рассмотрены в течение экспоненциальной фазы роста 9. Вирусные кинетика роста должны сначала быть установлены с помощью ежедневного отбора проб для определения соответствующего периода культура и времени выборки точек для участия в конкурсе роста. Одним из факторов, который влияет на вирусные кинетики роста множественность заражения (МВД). Этот протокол использует общую МВД 0,005 для обоих моноинфекции и конкуренции роста, как это было показано для получения более робюст результаты, чем нижней множественностью инфекции 9. Тем не менее, более низкие MÕIS могут быть использованы для получения более экспоненциальной фазе роста, если это необходимо, но за счет результата консистенции. Этот протокол предполагает первоначальный коэффициент заражения 50:50, предполагая, что фитнес отличия вирусов, как правило, заранее неизвестно. Тем не менее, использование неравные соотношения входных подходят, когда есть предварительные данные, согласно существенных различий в вирусной репликации кинетики. В этих случаях, отношение инфекции 70:30 Рекомендуется, чтобы для обнаружения большой разницы пригодности, где менее приспособленных вируса находится в избытке 9.

Протокол для определения TCID 50, вирусные кинетика роста, а также для выполнения рост конкурентных анализах были оптимизированы с помощью ВИЧ-1 подтипа B, NL4-3 COTB-p24, и РВМС от одного донора, чей РВМС показали последовательную восприимчивость к ВИЧ- 1 инфекции в пробирке. Период культураи указывает время выборки, представленные в этом протоколе, вероятно, будут пригодны для изучения ВИЧ-1 группы М вирусы в человеческих МКПК. Использование МНПК из одного источника настоятельно рекомендуется получить достоверные результаты, как вирусная репликация может варьироваться в разных донорских клеток 35. Несмотря на то, менее желательно, РВМС Объединенные из нескольких доноров может быть использован в качестве замены при условии, что тот же пул используется во всех экспериментах. Другой альтернативой является использование клеточных линий. Протокол, представленные здесь успешно используется с Т-клеточной линии CEMx174 23,36. Тем не менее, важно, что число клеток, посеянных повторно оптимизированы для достижения устойчивого роста клеток. Вирусные кинетики роста должен быть восстановлен, как это, скорее всего, меняться в различных клеточных линиях, чтобы определить соответствующие временные точки отбора проб на стадиях конкуренции рост.

Существует два способа, чтобы определить вирусную соотношение для вычисления пригодности включены в protocол. Первый использует RT-КПЦР для измерения вирусной кДНК количество копий в каждый момент времени выборки точки. Затем вирусный пригодности репликации рассчитывали из вирусного соотношении, на основе числа копий кДНК. Кроме того, вирусный отношение может быть определено на основании соотношения высоты пика хроматограммы на участках VifAB тегов. Эти два метода дали сопоставимые результаты (рисунок 4). Способ по высоте пика хроматограммы могут быть применены к другим штаммам ВИЧ-1, не сконструированного тега последовательности. Для RT-КПЦР, использование праймеров или зондов, чтобы отличить вирусные варианты должны быть сначала тщательно оценивать (см 20). Тем не менее, РТ-КПЦР обеспечивает лучшую чувствительность для образцов с небольшим количеством вирусной РНК, такие, как те, с первого момента времени в экспоненциальной фазе роста. Прямое измерение вирусной кДНК также позволяет выявить технические проблемы, которые могут возникнуть в результате добычи РНК и синтеза кДНК. Использование молекулярных клонов с тегами последовательности обеспечивает экономически эффективное решение ТО методах RT-КПЦР, а только две пары праймеров и зондов необходимо изучить несколько вирусов. Эта стратегия также позволяет избежать проблем изменения пик высоты в последовательности хроматограмм из-за соседних баз 37, а последовательность делается в том же месте во всех вирусов в исследовании. ПЦР продукты, производимые для RT-КПЦР и Sanger секвенирования может быть использование с другими методами для определения вирусной соотношение таких как насыпной последовательности отдельных клонов 12,13, HTA 4,7,17,19 или олигонуклеотид лигирования анализа (УПВ) 38 ,

Disclosures

Авторы заявляют, что у них нет конкурирующих финансовых интересов. Мнения, высказанные здесь, являются мнениями авторов и не должны быть истолкованы в качестве официальной или представляющих взгляды Министерства обороны США или Министерства армии.

Materials

Name Company Catalog Number Comments
Construction of recombinant clones
Chimeric primer/Mutagenic/Sequencing primers IDT Custom DNA oligos
pNL4-3VifA and pNL4-3VifB plasmid Please contact Dr. James I Mullins (jmullins@uw.edu)
High-Fidelity DNA polymerase Thermo Scientific F-549S
High-fidelity buffer Thermo Scientific F-549S
dNTP Bioline Bio-39026
Thermal cycler Life Technologies Applied Biosystems® GeneAmp® PCR System 9700
DNA loading dye Thermo Scientific R0631
1 kb Plus DNA ladder Invitrogen 10787-018
QIAquick PCR Purification Kit Qiagen 28104
QIAquick gel extraction kit Qiagen 28704
DpnI enzyme New England Biolabs R0176S
TOP10 chemically competent Escherichia coli Invitrogen C4040-10
Luria Broth base powder Invitrogen 12795-084
Carbenicillin Research Products International C46000-25.0
QIAprep Spin Miniprep kit  Qiagen 27104
EndoFree Plasmid Maxi Kit Qiagen 12362
Transfection
X-tremeGENE 9 DNA transfection reagent Roche 6365787001
HEK 293T-17 ATCC CRL-11268 http://www.atcc.org/
0.22 μm filter top tube VWR International 89220-716 
Cell culture
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 10566016
Iscove′s Modified Dulbecco′s Medium (IMDM) Life Technologies 31980-030
RPMI-1640 media Life Technologies 61870-036
Phytohemagglutinin (PHA) Thermo Scientific R30852801
Human Interleukin-2 Roche 11147528001
Fetal bovine serum JR Scientific 43640
Penicillin and Streptomycin Corning Cellgro 30-001-CI
6 well plate VWR Scientific 73520-906
48 well plate VWR Scientific 62407-338
96 well flat-bottomed plate ISC Bioexpress T-3015-4
96 well round-bottomed plate BD Falcon 353077
1.5 ml Microcentrifuge Tube Mt. Baker Bio MBD-1500
1.5 ml tubes w/ O-ring VWR Scientific 89004-290
50 ml conical tube ISC Bioexpress C-3317-6
ELISA
Triton-X 100 Sigma-Aldrich X100
Phosphate buffer saline (PBS) Invitrogen 14190-250
Fetal bovine serum (FBS) Sigma-Aldrich F0392
glycerol Sigma-Aldrich G5516
Tween 20 Sigma-Aldrich P1379
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153
Rabbit anti-HIV-1 SF2 p24 antiserum NIH AIDS Reagent Program 4250
Goat anti-rabbit HRP KPL 474-1516
TMB Microwell Peroxidase Substrate KPL 52-00-01
H2SO4 Fisher Scientific A300-500 Causes severe burns by all exposure routes. Use personal protective equipment. Use only under a chemical fume hood. Wash off immediately with plenty of water for at least 15 min.
HIV p24 standard AIDS and Cancer Virus program (NCI-Frederick) For order details please contact Julian Bess, Jr. (bessjw@mail.nih.gov); http://ncifrederick.cancer.gov/Programs/Science/Acvp/bio/Bess.aspx
Microplate reader Molecular Devices VMax Kinetic ELISA Microplate Reader
RNA isolation cDNA synthesis
QIAxtractor Qiagen http://www.qiagen.com/products/catalog/automated-solutions/sample-prep/qiaxtractor
QIAamp Viral RNA Mini Kit Qiagen 52906
dNTP Bioline Bio-39026
SuperscriptIII Invitrogen 18080-085
First-strand buffer  Invitrogen 18080-085
Dithiothreitol (DTT) Invitrogen 18080-085
Rnase inhibitor Roche 3335402001
RnaseH Invitrogen 18021-071
qPCR
Real-time qPCR machine Life Technologies Applied Biosystems 7300 Real-Time PCR 
TaqMan® Gene Expression Master Mix Life Technologies 4369016
Forward, reverse primer IDT Custom order
Probe Life Technologies Custom order
optical 96 well reaction plate Life Technologies I19N3Q216
PCR+sequencing
Taq DNA polymerase (Biolase) Bioline Bio-21043
NH4 buffer  Bioline Bio-21043
MgCl2 Bioline Bio-21043
Sequencing primer IDT Custom order
QIAxcel Qiagen http://www.qiagen.com/products/catalog/automated-solutions/detection-and-analysis/qiaxcel-advanced-system
DNA sequencing service provider http://www.htseq.org/
GRC web tool http://indra.mullins.microbiol.washington.edu/grc/
ChromatQuan web tool http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi

DOWNLOAD MATERIALS LIST

References

  1. Domingo, E., Holland, J. J. RNA virus mutations and fitness for survival. Annu Rev Microbiol. 51, 151-178 (1997).
  2. Domingo, E. Mechanisms of viral emergence. Veterinary research. 41, (6), 38 (2010).
  3. Martinez-Picado, J., Martinez, M. A. HIV-1 reverse transcriptase inhibitor resistance mutations and fitness: a view from the clinic and ex vivo. Virus Res. 134, (1-2), 104-123 (2008).
  4. Troyer, R. M. Variable fitness impact of HIV-1 escape mutations to cytotoxic T lymphocyte (CTL) response. PLoS Pathog. 5, (4), e1000365 (2009).
  5. Rolland, M. Amino-acid co-variation in HIV-1 Gag subtype C: HLA-mediated selection pressure and compensatory dynamics. PLoS One. 5, (9), e12463 (2010).
  6. Abraha, A. CCR5- and CXCR4-tropic subtype C human immunodeficiency virus type 1 isolates have a lower level of pathogenic fitness than other dominant group M subtypes: implications for the epidemic. J Virol. 83, (11), 5592-5605 (2009).
  7. Quinones-Mateu, M. E. A dual infection/competition assay shows a correlation between ex vivo human immunodeficiency virus type 1 fitness and disease progression. J Virol. 74, (19), 9222-9233 (2000).
  8. Ball, S. C. Comparing the ex vivo fitness of CCR5-tropic human immunodeficiency virus type 1 isolates of subtypes. B and C. J Virol. 77, (2), 1021-1038 (2003).
  9. Lanxon-Cookson, E. C. Factors affecting relative fitness measurements in pairwise competition assays of human immunodeficiency viruses. J Virol Methods. 194, (1-2), 7-13 (2013).
  10. Garcia-Lerma, J. G., MacInnes, H., Bennett, D., Weinstock, H., Heneine, W. Transmitted human immunodeficiency virus type 1 carrying the D67N or K219Q/E mutation evolves rapidly to zidovudine resistance in vitro and shows a high replicative fitness in the presence of zidovudine. J Virol. 78, (14), 7545-7552 (2004).
  11. Sharma, P. L., Crumpacker, C. S. Attenuated replication of human immunodeficiency virus type 1 with a didanosine-selected reverse transcriptase mutation. J Virol. 71, (11), 8846-8851 (1997).
  12. Martinez-Picado, J., Savara, A. V., Sutton, L., D'Aquila, R. T. Replicative fitness of protease inhibitor-resistant mutants of human immunodeficiency virus type 1. J Virol. 73, (5), 3744-3752 (1999).
  13. Wang, J. The HIV-1 reverse transcriptase mutants G190S and G190A, which confer resistance to non-nucleoside reverse transcriptase inhibitors, demonstrate reductions in RNase H activity and DNA synthesis from tRNA(Lys, 3) that correlate with reductions in replication efficiency. Virology. 348, (2), 462-474 (2006).
  14. Song, H. Impact of immune escape mutations on HIV-1 fitness in the context of the cognate transmitted/founder genome. Retrovirology. 9, (89), (2012).
  15. Ali, A., Yang, O. A novel small reporter gene and HIV-1 fitness assay. Journal of Virological Methods. 133, (1), 41-47 (2006).
  16. Maarseveen, N. M. A novel real-time PCR assay to determine relative replication capacity for HIV-1 protease variants and/or reverse transcriptase variants. J Virol Methods. 133, (2), 185-194 (2006).
  17. Liu, Y. Evolution of human immunodeficiency virus type 1 cytotoxic T-lymphocyte epitopes: fitness-balanced escape. J Virol. 81, (22), 12179-12188 (2007).
  18. Anastassopoulou, C. G., Ketas, T. J., Klasse, P. J., Moore, J. P. Resistance to CCR5 inhibitors caused by sequence changes in the fusion peptide of HIV-1 gp41. Proc Natl Acad Sci U S A. 106, (13), 5318-5323 (2009).
  19. Abraha, A., Troyer, R. M., Quinones-Mateu, M. E., Arts, E. J. Methods to determine HIV-1 ex vivo fitness. Methods Mol Biol. 304, 355-368 (2005).
  20. Liu, Y. A sensitive real-time PCR based assay to estimate the impact of amino acid substitutions on the competitive replication fitness of human immunodeficiency virus type 1 in cell culture. J Virol Methods. 189, (1), 157-166 (2013).
  21. Brumme, Z. L. Reduced replication capacity of NL4-3 recombinant viruses encoding reverse transcriptase-integrase sequences from HIV-1 elite controllers. J Acquir Immune Defic Syndr. 56, (2), 100-108 (2011).
  22. Nomura, S. Significant reductions in Gag-protease-mediated HIV-1 replication capacity during the course of the epidemic in. Japan. J Virol. 87, (3), 1465-1476 (2013).
  23. Rolland, M. HIV-1 conserved-element vaccines: relationship between sequence conservation and replicative capacity. J Virol. 87, (10), 5461-5467 (2013).
  24. Martinez-Picado, J. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. J Virol. 80, (7), 3617-3623 (2006).
  25. Brockman, M. A. Escape and Compensation from Early HLA-B57-Mediated Cytotoxic T-Lymphocyte Pressure on Human Immunodeficiency Virus Type 1 Gag Alter Capsid Interactions with Cyclophilin A. J Virol. 81, (22), 12608-12618 (2007).
  26. Miura, T. HLA-associated alterations in replication capacity of chimeric NL4-3 viruses carrying gag-protease from elite controllers of human immunodeficiency virus type 1. J Virol. 83, (1), 140-149 (2009).
  27. Basic Methods in Cellular and Molecular Biology, PCR: The Polymerase Chain Reaction. JoVE. Cambridge, MA. Available from: http://www.jove.com/science-education/5056/pcr-the-polymerase-chain-reaction (2014).
  28. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments : JoVE. 62, (Apr 20), (2012).
  29. Basic Methods in Cellular and Molecular Biology, Restriction Enzyme Digests. JoVE. Cambridge, MA. Available from: http://www.jove.com/science-education/5070/restriction-enzyme-digests (2014).
  30. McClure, J., van't Wout, A. B., Tran, T., Mittler, J. E. Granulocyte-monocyte colony-stimulating factor upregulates HIV-1 replication in monocyte-derived macrophages cultured at low density. J Acquir Immune Defic Syndr. 44, (3), 254-261 (2007).
  31. Reed, L. J., Muench, H. A simple method of estimatingfifty percent endpoints. Am J Hyg. 27, (3), 493-497 (1938).
  32. Nickle, D. C. Consensus and ancestral state HIV vaccines. Science. 299, (5612), 1515-1518 (2003).
  33. Rolland, M. Reconstruction and function of ancestral center-of-tree human immunodeficiency virus type 1 proteins. J Virol. 81, (16), 8507-8514 (2007).
  34. Bryksin, A. V., Matsumura, I. Overlap extension PCR cloning: a simple and reliable way to create recombinant plasmids. Biotechniques. 48, (6), 463-465 (2010).
  35. Spira, A. I., Ho, D. D. Effect of different donor cells on human immunodeficiency virus type 1 replication and selection in vitro. J. Virol. 69, (1), 422-429 (1995).
  36. Manocheewa, S., Swain, J. V., Lanxon-Cookson, E., Rolland, M., Mullins, J. I. Fitness costs of mutations at the HIV-1 capsid hexamerization interface. PLoS One. 8, (6), e66065 (2013).
  37. Zakeri, H., Amparo, G., Chen, S. M., Spurgeon, S., Kwok, P. Y. Peak height pattern in dichloro-rhodamine and energy transfer dye terminator sequencing. Biotechniques. 25, (3), 406-410 (1998).
  38. Lalonde, M. S. Sensitive oligonucleotide ligation assay for low-level detection of nevirapine resistance mutations in human immunodeficiency virus type 1 quasispecies. J Clin Microbiol. 45, (8), 2604-2615 (2007).
Парные Рост конкуренции Анализ для определения репликации Фитнес человека вируса иммунодефицита
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Manocheewa, S., Lanxon-Cookson, E. C., Liu, Y., Swain, J. V., McClure, J., Rao, U., Maust, B., Deng, W., Sunshine, J. E., Kim, M., Rolland, M., Mullins, J. I. Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses. J. Vis. Exp. (99), e52610, doi:10.3791/52610 (2015).More

Manocheewa, S., Lanxon-Cookson, E. C., Liu, Y., Swain, J. V., McClure, J., Rao, U., Maust, B., Deng, W., Sunshine, J. E., Kim, M., Rolland, M., Mullins, J. I. Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses. J. Vis. Exp. (99), e52610, doi:10.3791/52610 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter