Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Parvis Growth Konkurrence Assay til Bestemmelse af Replication Fitness af Human Immunodeficiency Virus

doi: 10.3791/52610 Published: May 4, 2015

Introduction

Viral replikation fitness defineres som evnen af en virus til at producere infektiøst afkom i et givet miljø 1 og er en vigtig medvirkende faktor til bestemmelse af forekomsten af et virus variant på populationsniveau over tid 2. Som in vivo fitness undersøgelser er ikke muligt med patogene humane vira, såsom HIV-1, forskellige in vitro og ex vivo replikering fitness assays er blevet udviklet til at studere virkningerne på fitness følge af lægemiddelresistens og immune escape mutationer, epistasis og udviklingen på virale populationer 3-6. Blandt forskellige fitness-analyser, er væksten konkurrencemæssige analyser anerkendt for at give mere følsomme og gyldige mål for fitness forskelle, som to eller flere virale varianter konkurrerer om den samme celle befolkningen under præcis de samme miljøforhold, som forekommer i vivo 1,7,8. Før du starter vækst konkurrencemæssige eksperimenter, flere variables skal fastlægges, herunder brug af forskellige infektionsmultipliciteter (MOI), viral input forhold, og timingen af ​​prøveudtagning til analyse. Vi har undersøgt virkningerne af disse parametre på virale vækstkinetik og om resultaterne af konkurrencemæssige eksperimenter, og har identificeret centrale faktorer, der er nødvendige for robuste målinger af HIV-1 fitness i cellekultur 9.

Foruden assay variabler, er der en række fremgangsmåder til kvantificering af virale varianter i vækst konkurrenceforsøg. Bulk 10,11 eller klonal sekventering 12,13 er blevet anvendt til at bestemme forholdet mellem konkurrerende vira baseret på nucleotid frekvenser på stedet (r) af interesse. Relativ fitness er afledt af ændringer i dette forhold over tid. Denne metode er praktisk som DNA-sekventering tjenester er bredt tilgængelige. Den parallelle allel-specifikke sekventering (PASS) metode gør det muligt sekventering på flere steder og påvisning af rekombinanter 14 15 eller synonyme mutationer 4,16-18 som koder til at skelne de konkurrerende virus ved sekventering, heteroduplex sporing analyser (MTV) 4,7,17,19 eller transskription-kvantitativ real-time polymerasekædereaktion vende (RT-qPCR) 15,16,18,20, som alle kan gøres gældende for at studere konkurrerende stammer uanset sekvenslighed. Et yderligere trin er nødvendigt at indføre tags i virusgenomer og RT-qPCR assay kræver også specifikke reagenser og instrumentering. Vi har fundet, at bulk- Sanger sekventering udbytter sammenlignelige resultater 9.

Efter vækst konkurrence, er viral replikation fitness præsenteres som relativ fitness, eller et fitnesscenter forhold mellem two virale varianter. Den relative egnethed af et virus kan defineres som det endelige andel af en viral variant normaliseret ved dens oprindelige andel i podestoffet eller som nettet vækstrate forskel mellem de to konkurrerende virus. Vi fandt, at den sidstnævnte metode, ved hjælp af langsgående datapunkter kun inden den eksponentielle vækstfase, produceret de mest robuste resultater 9,20.

In vitro fitness assays anvendes primært til at undersøge biologiske kloner 6-8 og infektiøse molekylære kloner af HIV-1. Sidstnævnte, som er modtagelige for genetisk manipulation, anvendes ofte til at undersøge virkningen på fitness fra bestemte mutationer eller specifikke sekvenser af interesse 3-5,21,22. Følgende protokoller beskrive en arbejdsgang fra det punkt at konstruere nye fuld længde smitsomme HIV-1 molekylære kloner bruger HIV-1 vektorer, som indeholder en sekvens tag, indføre mutationer af interesse, hvilket gør virale lagre og etablering af virale vækstkinetik, Udførelse af væksten konkurrerende analyse og beregning relativ fitness (figur 1).

Ved hjælp af vores optimerede procedurer, vi skabt tre rekombinante HIV-1-mutanter og bestemt deres replikation fitness. Det rekombinante molekylære klon blev først konstrueret ved at erstatte HIV-1 gag-p24-gen-regionen i pNL4-3, et plasmid indeholdende en fuld længde infektiøs genomet af HIV-1 lab stamme NL4-3, med en syntetisk COTB (Center-of træ, subtype B) gag-p24-sekvensen 23 til at skabe prototypen stamme. Single amino ændringer (T186M, T242N og I256V) blev derefter indført for at skabe tre mutant-kloner. Hver mutant blev konkurrerede mod prototype virus at observere fitness effekten af ​​hver mutation i den givne genetiske baggrund. De tre mutanter demonstreret varierende niveauer af replikation fsitness fra let til væsentligt lavere end den prototype virus. Den T242N mutationen er tidligere rapporteret at have en moderat fitnessrumss koste 24-26, svarer til det resultat, der er vist i denne undersøgelse. Fitness udgifter til de to andre mutationer var ikke blevet indberettet tidligere.

Protocol

BEMÆRK: Protokollen, som beskrevet nedenfor, ikke omfatter enhver patient identificerbare oplysninger, og er således ikke betragtes personmotiver Forskning ved University of Washington Institutional Review Board eller personmotiver Division.

1. Konstruktion af kimære HIV-1 NL4-3 Molekylære Clones

1.1) Amplify Insert DNA-fragment

  1. Design kimære primere. 5'halvdele af både forward og reverse primere indeholder et HIV-1-vektor-sekvens, hvor fragmentet vil blive indsat. 3'-halvdelen af primerne skal indeholde ende af indsatsen sekvens (figur 2). Sørg for, at den kimære primersekvens bevarer de oprindelige åbne læserammer.
    1. Anvende primere mindst 20 baser i længde, med en smeltetemperatur større end eller lig med 60 ° C, ~ 50% GC-indhold og en lav tendens til at danne primer-dimerer, heterodimerer og / eller hårnålestrukturer. Vurdere disse egenskaberhjælp af OligoAnalyzer webværktøjet ( https://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ ).
  2. Brug PCR 27 og de ​​kimære primere for at amplificere indsat DNA (figur 2). For hver PCR-reaktion, bruge 1X high fidelity-puffer, 0,2 mM dNTP'er, 1 U high fidelity DNA-polymerase, 0,5 uM frem kimære primer, 0,5 uM af revers kimære primer og 1 pg0 ng DNA prøve transporterer insert region. Tilføj dH2O til et endeligt volumen på 50 pi.
  3. Sæt termiske cykling trin som følger: Udfør en indledende DNA denatureringstrin ved 98 ° C i 10 sek. Forstærk med 30 cykler af DNA denaturering ved 98 ° C i 10 sek og DNA annealing ved 3 ° C over den laveste smeltetemperatur af de to primere i 20 sekunder. Udfør en endelig ekstension ved 72 ° C i 10 min. Opbevar PCR-produkter ved 4 ° C.
  4. Tage 5 pi af PCR-produkterne fraforegående trin og køre agarosegelelektroforese 28.
    1. Brug en 0,7% agarosegel, 1x TAE-buffer (40 mM Tris-acetat, 1 mM EDTA), 0,5 ug / ml ethidiumbromid (EtBr) slutkoncentration og 1 kb ladder som DNA størrelse markør. Set strømkilde spænding til 5 V / cm afstanden mellem elektroderne. Stop elektroforese når læsning farvestoffet migrerer gennem ca. 2/3 af længden gel. Visualiser gelen ved hjælp af en gel dokumentationssystem 28.
      BEMÆRK: EtBr er en mistænkt carcinogen, og skal bortskaffes korrekt, pr institutionens regler. Handsker bør altid anvendes ved håndtering geler, der indeholder EtBr. Skift til nye handsker efter slut håndtering EtBr materiale og før håndtering andre materialer eller udstyr for at undgå krydskontaminering.
  5. Hvis der detekteres kun ét DNA-bånd med størrelse svarende til det ønskede PCR-produkt, oprense resten af ​​PCR-produktet ved anvendelse af et kommercielt kit, såsom QIAquick PCR Purification Kit according med producentens protokoller.
    1. Hvis andre, ikke-specifikke bånd er også til stede, bruge resten af ​​PCR-produktet til at køre præparativ gelelektroforese. Brug de samme parametre og betingelser i trin 1.1.4. Sikre at gelen brønd er stor nok til at indlæse ~ 45 pi PCR-produkter. Skåret ud båndet af interesse og ekstrahere DNA fra gelen under anvendelse af QIAquick Gel Extraction kit ifølge producentens protokoller.

1.2) Indføre Indsæt Fragment i fuld længde Infektiøs HIV-1 Subtype B Vector (pNL4-3)

  1. Anvende oprensede PCR-produkter fra trin 1.1.5 som PCR-primere. Bruge pNL4-3VifA 20 som template-DNA i en PCR-reaktion og bruge pNL4-3VifB 20 som template i den anden reaktion (figur 2). For hver PCR-reaktion, brug 1x high fidelity-buffer, 0,2 mM dNTP'er, 2 U af high fidelity DNA-polymerase, 500 ng af primer-DNA og 50 ng template-DNA i en endelig volume af 50 pi. Indstille de termiske cykliseringsparametre til: 98 ° C i 30 sekunder, 35 cykler ved 98 ° C i 10 sek, 48 ° C i 1 min og 72 ° C i 10 minutter, efterfulgt af 72 ° C i 10 min.
  2. Tilsæt 10 U Dpnl til 50 pi af PCR-reaktionen og inkuberes ved 37 ° C i 1 time til at fordøje template-DNA'et. Sikre, at plasmid-DNA'et isoleres fra en methylering kompetent bakteriestamme, f.eks., TOP10 kemisk kompetente Escherichia coli.
  3. Brug Dpnl-fordøjet produkt til at transformere kompetente bakterieceller. Brug varme-shock transformation med TOP10 kemisk kompetent E. coli, ifølge producentens protokol. At selektere for bakterielle celler indeholdende det rekombinante plasmid, bruge Luria Broth (LB) dyrkningsplader indeholdende 100 mg / l carbenicillin.
    1. Pick ~ 10 godt adskilte kolonier og vokse hver for sig i 3 ml LB flydende medium indeholdende 100 mg / L carbenicillin og inkuberes ved 30 ° C i enshaker O / N.
    2. Brug QIAprep Spin Miniprep kit til at isolere plasmid-DNA fra den bakterielle flydende kultur, ifølge producentens protokol.
  4. Bruge dobbelt restriktionsspaltning 29 at fastslå, om plasmid-DNA'et indeholder den korrekte insert. Sikre, at en af ​​restriktionsstederne eksisterer kun inden i indsatsen regionen og den anden restriktionssted findes kun én gang i HIV-1-vektor, uden for insertet region.
    1. Digest mindst 300 ng plasmid-DNA i en 10 pi endeligt reaktionsvolumen. Vælg restriktionssteder buffere, inkubationstemperatur og inkubationstid ifølge fabrikantens protokol af de udvalgte restriktionsenzymer. Tage 9 pi af det fordøjede DNA og køre gelelektroforese som beskrevet i trin 1.1.4. Vælg rekombinante plasmider, der har DNA-bånd af de forudsagte størrelser.
  5. Bekræft sekvens integritet af de rekombinante plasmider ved Sanger-sekventering. Selvom det er sjældent, uønsketmutation (er) kan indføres i løbet af PCR-reaktionerne.
    1. Sekvens begge strenge af plasmid-DNA. Følge instruktionerne i trin 1.1.1.1 til at designe sekventeringsprimere. Endvidere sikre, at den fremadrettede og reverse sekventeringsprimere annealer mindst 50 bp opstrøms og nedstrøms for insert-regionen i det rekombinante plasmid, henholdsvis.
    2. Indsende plasmid-DNA og sekvensprimere til en kommerciel DNA-sekventering tjenesteudbyder. Forbered DNA-prøve og primere som angivet af tjenesteudbyderen.
  6. Afgiv et endotoksin-free stock af det muterede plasmid-DNA under anvendelse af et Endotoxin frit plasmid DNA kit ifølge producentens protokol. Fremstilles mindst 1 ug endotoksin-frit plasmid-DNA til transfektion i det følgende trin.

1.3) Indføre Mindre Mutationer Via mutagenese

  1. Designe mutagene primere med overlappende forward og reverse primere indeholdende det ønskede Mutation (er). Placer base (r), der skal substitueres, indsættes eller slettes i midten af ​​primerne, flankeret af homologe 10-15 baser. Følg anvisningerne i trin 1.1.1.1.
  2. Anvende PCR til at syntetisere mutante plasmider. For hver PCR-reaktion, brug 1x high fidelity-puffer, 10 mM dNTP'er, 2 U af high fidelity DNA-polymerase, 0,5 uM fremad mutagen primer, 0,5 uM reverse mutagene primer og 50 ng af kimært pNL4-3VifB, fra trin 1.2.6 , i et slutvolumen på 50 pi. Indstille de termiske cykliseringsparametre til: 98 ° C i 30 sekunder, 25 cykler ved 98 ° C i 10 sek, 48 ° C i 1 min og 72 ° C i 10 minutter, efterfulgt af 72 ° C i 10 min.
  3. Gentag trin 1.2.2 til 1.2.6.

2. Generering af Viral Stock Brug Transfektion

  1. Beregne mængden af ​​viral stock ønsket og plasmid DNA, der kræves. Med en viral titer på 10 4 IU / ml eller højere, 1,8 ml viral bestand er tilstrækkelig til to sæt vækst konkurrence ASSAys, herunder monoinfections, hver udført in triplo. For en transfektion udført i en 6-brønds plade, er ca. 1,8 ml supernatant høstet per brønd. Et pg af plasmid-DNA er nødvendig for hver transfektion udført i en 6-brønds plade.
  2. For hver brønd af en 6-brønds plade, forberede 100 pi transfektionsblandingen, f.eks., Bestående af 1 pi X-tremeGENE 9 transfektionsreagens (eller tilsvarende produkt), 1 ug plasmid-DNA og serum-frit DMEM.
    1. Bestemme mængden af ​​plasmid-DNA nødvendigt, under anvendelse af 1 ug plasmid-DNA per brønd. Sikre at den endelige koncentration af plasmid-DNA'et er mindst 50 ng / pl.
    2. Afgøre hvor meget serum-frit medium (DMEM) er nødvendig per brønd ved hjælp af formlen: Samlet volumen af ​​DMEM i pi = 100 pi - DNA mængden i pi.
  3. Tilsæt 10 6 HEK 293T-17 (ATCC) celler / brønd i 2 ml formering medium (DMEM + 10% føtalt bovint serum (FBS)) i en 6-brønds plade. Der inkuberes i 1 time ved 37 ° C i en5% CO2-atmosfære. Frø så mange brønde efter behov (bestemt i trin 2.1).
  4. For at fremstille transfektionsblandingen alikvoter det passende volumen af ​​serum-frit DMEM, som beregnet ovenfor, i et 1,8 ml polypropylen mikrocentrifugerør, og tilsæt derefter transfektionsreagens.
    1. Pipette reagens direkte i medierne løsning, skal du ikke føje den til plastic overflade mikrocentrifugerør. Tilføj plasmid-DNA sidst. Pipetter op og ned forsigtigt for at blande opløsningen. Der inkuberes i 15 minutter ved stuetemperatur (15 ° C til 25 ° C) for at tillade dannelsen af ​​transfektionskomplekser.
    2. Tilsæt blandingen i en dråbevis måde til celler podet i 6-brønds plade. Forsigtigt ryste eller swirl brøndene for at sikre en jævn fordeling af transfektion komplekser.
    3. Seal plader med plast wrap.
  5. Inkuberes kulturerne ved 37 ° C i en 5% CO2-atmosfære i 48 timer.
  6. Brug en pipette til omhyggeligt at indsamle og overføre supernatanten til et 15 ml rør through et 0,22 um filter toppen.
  7. Brug pipette til at overføre 250 pi eller flere af den filtrerede supernatant til 1,8 ml mikrocentrifugerør med gummipakninger i lågene.
  8. Opbevares filtrerede supernatanter ved -80 ° C indtil anvendelse.

3. Bestem Infektiøs Titer af Viral Lagre på perifere mononukleære blodceller (PBMC'er)

  1. Stimulere PBMC'er med phytohemagglutinin (PHA). Pr en viral lager, frø 2 x 10 6 PBMC'er i fuldstændig Iscoves Modificeret Dulbeccos Medium (cIMDM; IMDM suppleret med 20 U / ml human interleukin 2 (hIL-2), 10% føtalt bovint serum og 1% penicillin / streptomycin) suppleret med PHA (1,5 pg / ml). Seed PBMC'er ved 2 x 10 6 celler / ml. Inkuber PBMC'er ved 37 ° C i en 5% CO2-atmosfære i 72 timer.
  2. Harvest PHA stimulerede PBMC'er. Overføre ikke-klæbende PHA-PBMC'er til en 50 ml konisk rør. Spinde rør ved 228 xg i 10 min. Fjern forsigtigt supernatanten uden disrupting cellepelleten. Resuspender cellepelleten til en slutkoncentration på 2 x 10 5 PBMC'er / ml i cIMDM.
  3. Seed 2 x 10 4 PHA stimulerede PBMC'er / brønd i 100 pi / brønd cIMDM i en rundbundet 96-brønds plade.
  4. Lav en 1:10 fortynding af det virale lager. Derefter, fra den første fortyndede lager, gør tolv 3-fold seriefortyndinger i en 96-brønds masterplade. Denne fortynding ordning anbefales til detektering virale titere i området fra 10 april - 10 juni infektiøs enhed (IU) pr ml.
    1. For eksempel tilsættes 20 pi virus lager til 180 pi medier i 1,5 ml rør. Bland fortyndingen ved omhyggeligt at pipettere. Derefter overføres 90 ul af fortyndet materiale i 180 pi medier af den første brønd og bland godt ved pipettering.
    2. Fortsæt fortyndingsrække ved at overføre 90 pi fra den aktuelle brønd til 180 pi medier i den næste brønd elleve gange mere. Øge eller mindske den indledende fortynding, hvis titre højere end 10 6 IE / mleller lavere end 10 4 IU / ml forventes hhv.
  5. Tilsæt 40 ​​ul af seriefortyndet virusstamme fra master fortyndingsplade til den podede PBMC'er plade (fra trin 3.3) i fire eksemplarer. Pladerne inkuberes ved 37 ° C i en 5% CO2-atmosfære i 16-24 timer.
  6. Fjern forsigtigt 100 pi supernatant fra hver brønd, og erstat med 160 pi frisk cIMDM til et samlet volumen på 200 pl / brønd. Pladerne inkuberes ved 37 ° C med 5% CO2-atmosfære (dag 1).
  7. På dag 4, 7, 10 og 13 transfer 100 pi supernatant fra hver brønd til 100 pi forstyrrelser buffer (2% TritonX-100 i PBS), og erstatte med 100 ul frisk cIMDM. Opbevar supernatanterne ved -20 ° C.
    1. Hold prøveudtagning og tilføje frisk cIMDM hver tredje dag, indtil titeren stabiliserer.
  8. Bestem vævskultur infektiøs dosis 50% (TCID 50) af virusstamme ved p24-ELISA under anvendelse af dag 7 og 13 prøver som beskrevet i trin 4.
    1. Hvis TCID50 opnået fra dag 13 er klart højere end titeren fra dag 7, kan virusstamopløsningen brug for en længere tid til at ekspandere. Gentag p24 ELISA hjælp senere prøver, indtil de smitsomme titre fra to prøveudtagningssteder tidspunkter bliver stabile (eller fald). Vælg lagre fra prøver med de højeste titre.

4. ELISA (Enzyme-linked immunabsorbans Assay) Påvisning af HIV-1 p24 for Bestemmelse Viral Infektiøs Titer

BEMÆRK: Følgende protokol blev udviklet ved hjælp af p24 antigen capture plader udarbejdet i vores laboratorium 30. Kommercielle HIV-1 p24 ELISA-plade / kits kan også anvendes efter producentens protokol.

  1. Forud for arbejdet med prøver, forberede arbejder lagre af primært antistof (kanin anti-HIV-1 SF2 p24 antiserum).
    1. Tø p24 antiserum ved stuetemperatur.
    2. Bland 2,5 ml glycerol med 2 ml 10% FBS i Phosphate puffer saltvand (PBS).
    3. Tilføj 0,5 ml antiserum og blandes.
    4. Store 1 ml alikvoter ved -20 ° C.
  2. Tø prøver fra trin 3.7 i en 37 ° C inkubator.
  3. Vask p24 capture pladen 5 gange med vaskebuffer (1x PBS med 0,05% Tween-20).
  4. Der tilsættes 50 gl / brønd af prøve fortynder (1% bovint serumalbumin (BSA), 0,2% Tween-20 i RPMI-1640), hvorefter der tilsættes 50 ul prøve til passende brønde. Omfatte mindst tre brønde med prøve fortynder kun som mock / negative kontroller. Inkubere i 2 timer ved 37 ° C eller O / N ved 4 ° C.
  5. Forberede det primære antistofopløsning frisk før brugen. Lav en 1: 2.000 ganges fortynding af det primære antistof arbejder lagre ved hjælp af den primære antistof fortyndingsmiddel (12% FBS i RPMI-1640). Sikre at forberede nok til anvendelse af 100 pi opløsning pr hver prøve / kontrol brønd i en plade med 96 brønde.
    1. For eksempel at gøre nok opløsning til en 96-brønds plade tilsættes 5 pi af det primære antistof working bestande til det primære antistof fortyndingsmiddel til et endeligt volumen på 10 ml.
  6. Vask capture plade 5 gange med vaskepuffer.
  7. Tilsættes 100 pi af det primære antistof-opløsning til hver brønd. Der inkuberes i 1 time ved 37 ° C i en 5% CO2-atmosfære.
  8. Forberede det sekundære antistof opløsning frisk før brugen. Lav en 1: 14.400 ganges fortynding af det sekundære antistof (1 mg / ml gede-anti-kanin-HRP) ved hjælp af den sekundære antistof diluent (7% FBS, 0,01% Tween-20 i RPMI-1640). For at reducere pipetteringsfejl, udføre en to-trins seriel fortynding. Sikre at forberede nok til anvendelse af 100 pi opløsning pr hver prøve / kontrol brønd i en plade med 96 brønde.
    1. For eksempel at gøre nok opløsning til en 96-brønds plade, først tilsættes 1 ml af det sekundære antistof til 99 pi af det sekundære antistof fortyndingsmiddel. Derefter tilsættes 70 pi første fortynding til det sekundære antistof fortyndingsmiddel til et endeligt volumen på 10 ml.
  9. Vask capture plade 5 times med vaskebuffer.
  10. Tilsættes 100 pi af det sekundære antistof-opløsning til hver brønd. Der inkuberes i 1 time ved 37 ° C i en 5% CO2-atmosfære.
  11. Pladen vaskes 5 gange med vaskebuffer.
  12. Tilsættes 100 pi RT TMB-substrat. Inkuber 30 minutter ved stuetemperatur i en lukket beholder for at beskytte mod lys.
  13. Tilsættes 100 pi RT stopopløsning (1 NH 2 SO 4).
  14. Absorbansen aflæses ved 450-650 nm i hver brønd under anvendelse af en mikropladelæser. Brug absorbansværdien at score hver samt inficeret eller ikke-inficeret. Overvej en brønd til at indeholde infektiøst virus, hvis absorbansværdien er mindst tre gange højere end den værdi læst fra mock / negative kontrolbrønde. Beregne TCID50 af det virale stock hjælp af Reed-Meunch metode 31.

5. Etablere Viral vækstkinetik

5.1) Monoinfection

  1. Seed 3 x 10 5 PHA-stimulerede PBMC / brønd i 48-brønds plades i et totalt volumen på 500 pl / brønd. Holde dyrkningsplader ved 37 ° C i en 5% CO2-atmosfære indtil inokulering.
  2. For hver virus, forberede et inokulum indeholdende 6.000 IE i 2 ml cIMDM.
  3. Inokulering brønde i tre eksemplarer ved tilsætning 500 pi af inoculum (1.500 IE), til de podede celler. Det endelige volumen af ​​den inficerede cellekultur er 1 ml / brønd og MOI er 0,005.
  4. Alikvot 200 pi af den resterende inokulum til hver af to 96-brønds plader for RNA-isolering, hvoraf den ene er gemt som en backup.
  5. Inkuberes kulturerne ved 37 ° C i en 5% CO2-atmosfære i 16-24 timer.
  6. Vask kulturer 16-24 timer efter inokulering.
    1. Fjern og kassér 750 pi kultursupernatant.
    2. Med 750 pi frisk cIMDM. Wrap plader i plastfolie og centrifugering i 10 minutter ved 300 x g. Fjern og kassér 750 pi supernatant.
    3. Med 750 pi frisk cIMDM. Der inkuberes ved 37 ° C med en 5% CO2 vedbar atmosfære (dag 1).
  7. Sample kulturer dagligt fra dag 2 til dag 7.
    1. Overføre 500 pi kultursupernatant til en 1,8 ml centrifugerør. Spin for 1 min ved 3000 x g.
    2. Transfer 200 pi af den cellefrie supernatant af de to 96-brønds prøveplader for RNA-isolering, igen sparer en plade som backup. Opbevar supernatanter ved -80 ° C indtil RNA-isolering.
    3. Tilsættes 500 pi frisk cIMDM til hver kultur. Der inkuberes ved 37 ° C i en 5% CO2-atmosfære.
    4. Kassér kulturer i Wescodyne ved afslutningen af ​​forsøget.
    5. Isolere RNA fra 200 pi supernatant (brug kommercielle kits, såsom QIAamp Viral RNA Mini Kit) efter producentens standardprotokol. For et stort antal prøver, bruge Qiagen QIAxtractor.
    6. Store RNA-prøver ved -80 ° C indtil cDNA-syntese.

5.2) cDNA Synthesis (Reverse transskription)

  1. For hver RNA srigelig, tilsættes 1,2 nmol dNTP og 1,2 pmol af cDNA-syntese primer (5'-GTTGATCCTTTAGGTATCTTTCCACAGC-3 ', HXB2 nukleotid 7968-7995) til 10 pi viralt RNA. Tilsæt vand til et slutvolumen på 14 pi. Flick røret for at blande og spin kort for at samle væske på bunden af ​​røret.
  2. Inkuber blandingen i 5 minutter ved 65 ° C, derefter holde ved 4 ° C indtil master mix fremstilles.
  3. Forbered masterblanding hjælp 5x første streng puffer (250 mM Tris-HCI, pH 8,3, 375 mM KCI, 15 mM MgCl2), 5 mM DTT, 120 U SuperScriptIII og 240 U RNase inhibitor. Tilsæt vand til slutvolumen på 10 pi.
  4. Tilføj 10 pi mester mix til RNA-blanding, svirp til at blande og spin at indsamle.
  5. Inkuber blandingen i 90 minutter ved 50 ° C for at tillade syntese af cDNA. Der inkuberes i 15 minutter ved 70 ° C for at inaktivere revers transkriptase. Hold ved 4 ° C efter behov.
  6. Tilsæt 2 U RNase H, svirp til at blande, og derefter dreje til at indsamle.
  7. Inkuber 20 minved 37 ° C. Store cDNA ved -20 ° C.

5.3) cDNA Kvantificering Brug af qPCR System

  1. Forbered en standardfortyndingsrækker. Do 10 gange seriel fortynding fra 3 x 10 6 kopier / pl ned til 30 kopier / pi, af pNL4-3VifA. Bruge destilleret vand til fortyndinger. Forbered standardfortyndingsrækker frisk før brug eller forberede små partier og holde ved -20 ° C. Ikke fryse-tø standarderne mere end tre gange.
  2. Opsæt en 96-brønd qPCR reaktion plade. Sikre, at hver plade indeholder mindst en brønd af negative kontroller, en tre eksemplarer af standardfortyndingsrækker, og mindst en kopi af hver cDNA prøve.
  3. For hver qPCR reaktion, bruge 12,5 pi qPCR Master mix, 0,2 pM probe, 0,8 uM hver af de fremadrettede og reverse primere og 1 pi af cDNA eller standardfortyndingsrækker eller vand / buffer (for den negative kontrol brønd). Tilsæt vand til et slutvolumen på 25 pi. QPCR proben er lys sensomt. Hold det i lukket beholder.
    1. For at detektere cDNA afledt fra pNL4-3VifA baseret molekylær klon, bruge VIFA primer-probe: ViFAB fremadrettet primer (GGTCTGCATACAGGAGAAAGAGACT), VIFA reverse primer (5'-AGGGTCTACTTGTGTGCTATATCTCTTTT-3 ') og ViFAB probe (6FAM-5'-CTCCATTCTATGGAGACTC-3 »-MGBNFQ). Til cDNA afledt fra pNL4-3VifB baseret klon, bruge VifB primer-probe: ViFAB fremadrettet primer, ViFAB probe og VifB revers primer (5'-CACCTGCGTGCTATACCTTTTCT-3 ').
  4. Indstille PCR cykliseringsparametre til 50 ° C i 2 minutter, 95 ° C i 10 min, og 40 cykler af 95 ° C i 15 sek og 60 ° C i 1 min. Rådfør producentens support dokument til betjening af qPCR maskine.
  5. Beregn en standardkurve ved hjælp af data fra tre eksemplarer standardfortyndingsrækker. Sammenlign amplifikationsprodukter data for cDNA prøven til standardkurven til at bestemme kopitallet. Rådfør producentens support dokument til data forarbejdning.

5.4) Bestem Viral eksponentielle vækstfase

  1. Plot virale vækstkinetik med prøvetagning dag langs X-aksen, og cDNA kopiantal langs Y-aksen og identificere virale eksponentielle vækstfase, dvs.., Når virale cDNA kopiere numre stigning i en eksponentiel progression.
  2. Brug GRC webværktøjet ( http://indra.mullins.microbiol.washington.edu/grc/ ) for at beregne viral vækstrate (g). Ved denne anvendelse GRC værktøjet, accepterer cDNA kopiere numre fra mindst to tidspunkter som input, og udlæser den virale vækst (g). Brug kun tid punktdata inden den eksponentielle vækstfase (se trin 5.4.1 ovenfor) for at opnå nøjagtige vækstrater. For en nærmere beskrivelse af den matematiske model, der anvendes i GRC web-værktøj, se 20.

6. Vækst Konkurrence Assay

  1. Seed 3 x 10 5 </ Sup> PHA-stimulerede PBMC'er (eller 1 x 10 5 CEMx174 celler) i 500 pi totalvolumen per brønd i en 48 brønd fladbundet plade.
  2. Holde pladen i 37 ° C i en 5% CO2-atmosfære indtil inokulering.
  3. For hver virus, forberede 3 ml inokulum indeholdende 6.000 IE.
  4. Overfør 1,5 ml af hver viral inokulum til et sterilt rør til at skabe den dobbelte infektion inokulum. Tilsættes 500 pi af den dobbelte inokulum (1.500 IE) til 3 x 10 5 celler i en 48-brønds plade. Det endelige dyrkningsvolumen er 1 ml / brønd. Alikvot 200 pi af inoculum til to plader med 96 brønde for RNA-isolering; spare en plade som en back up.
  5. Inkuber inokulerede celler ved 37 ° C med en 5% CO2-atmosfære i 16-24 timer.
  6. Vask kulturer 16-24 timer efter inokulering.
    1. Fjern og kassér 750 pi kultursupernatant.
    2. Med 750 pi frisk cIMDM. Wrap plader i plast wrap og centrifugering i 10 min ved 300 x g. Fjern og kassér 75081 l supernatant.
    3. Med 750 pi frisk cIMDM. Der inkuberes ved 37 ° C med en 5% CO2-atmosfære (dag 1).
  7. Vælg prøvetagningstidspunkter omfatte mindst 3 tidspunkter i den eksponentielle vækstfase observeret i trin 5.4.1.
    1. For hver enkelt prøveudtagning, skal du følge trin 5.1.7.
  8. Udfør cDNA syntese som beskrevet i afsnit 5.2.
  9. Bestem den virale variant forholdet hjælp qPCR.
    1. Forbered en standard seriel fortyndingsrække i tre eksemplarer, fortynding 10 gange i hvert trin fra 3 x 10 6 kopier / pi til 30 kopier / pi pNL4-3VifA.
    2. Opsæt en 96-brønd qPCR reaktion plade. Sikre, at hver plade indeholder mindst én negativ kontrol, standardfortyndingsrækker i tre eksemplarer, og kopier af hver cDNA prøve.
    3. For hver qPCR reaktion, bruge 12,5 pi qPCR Master Mix, 0,2 pM probe, 0,8 pM hver af den forreste og reverse primere og 1 pi cDNA eller standard d ilution serie eller vand / buffer (for de negative kontrolbrønde). Tilsæt vand til et slutvolumen på 25 pi. Den qPCR sonden er lysfølsomt, holde det i lukket beholder.
      1. Brug VIFA primer-probe til påvisning af signaler i de negative kontroller og standardfortyndingsrækker og med en kopi af cDNA prøven. Brug VifB primer-probe med den anden kopi af cDNA prøven.
    4. Indstille PCR cykliseringsparametre til 50 ° C i 2 minutter, derefter 95 ° C i 10 min, og derefter 40 cykler ved 95 ° C i 15 sek og 60 ° C i 1 min. Rådfør producentens support dokument til betjening af qPCR maskine.
    5. Beregn standardkurven hjælp forstærkning data fra standardfortyndingsrækker. Sammenlign amplifikationsprodukter data for cDNA prøver med standardkurven til at bestemme kopital. Rådfør producentens support dokument til databehandling.
    6. Brug GRC web-værktøj (ol.washington.edu/grc/">http://indra.mullins.microbiol.washington.edu/grc/) for at beregne relative viral fitness (d).
      BEMÆRK: GRC Værktøjet accepterer cDNA kopi numre eller kromatogram tophøjder fra mindst to tidspunkter som input, og udlæser netto vækstrate forskel (d) mellem de to vira. Mens værktøjet kan beregne netto vækstrate fra to tidspunkter punktdata, anbefales det stærkt at indtaste data fra tre eller flere tidspunkter. Brug kun data fra tidspunkter inden den eksponentielle vækstfase (se trin 5.4) for at opnå nøjagtige vækstrater. For en nærmere beskrivelse af den matematiske model, der anvendes i GRC web-værktøj, se 20.
  10. Bestem virale nøgletal hjælp chromatogramprofiler peak-højder
    1. PCR amplificere HIV-1 vif fragmenter indeholdende ViFAB sekvensmærke hjælp VifFwd (5'-GAAAGAGACTGGCATTTGGGTCAGGG-3 '; HXB2 positionerer 5266-5291) og VifRev primere (5'-GTCTTCT GGGGCTTGTTCCATCTGTCC-3 '; HXB2 positioner 5579-5553).
      1. For hver PCR-reaktion, bruger 1 pi cDNA, 1x NH4-buffer, 1,5 mM MgCl2, 0,2 mM dNTP, 2,5 U Taq-polymerase og 0,45 uM af hver primer. Tilsæt vand til et slutvolumen på 50 pi.
      2. Indstille PCR cykliseringsparametre til 3 cyklusser ved 94 ° C i 1 min, 55 ° C i 1 min og 70 ° C i 1 minut, efterfulgt af 34 cyklusser ved 94 ° C i 15 sek, 58 ° C i 30 sekunder, og 70 ° C i 1 minut, og derefter holde ved 4 ° C.
    2. Oprense PCR-produkter under anvendelse af QIAquick PCR oprensningskit ifølge producentens protokol.
    3. Indsend oprensede PCR-produkter til en DNA-sekventering tjenesteudbyder for Sanger sekventering.
    4. Tjek den gennemsnitlige læse kvalitet score, som skal leveres af sekventering service. Hvis den gennemsnitlige basen call nøjagtighed er mindre end 85%, redo trin 6.10.1 til 6.10.3
    5. Brug ChromatQuan web-værktøj (f="http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi">http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi ) at beregne viral forhold ved hvert tidspunkt. Værktøjet kræver sekvensen sporingsfilen (* .ab1) og sekvensen 5 'for nukleotid sted af interesse. Værktøjet måler den maksimale intensitet ved det angivne sted. Forholdet mellem den maksimale intensitet svarer til ration af de to virus (figur 4B).
    6. Brug GRC webværktøjet ( http://indra.mullins.microbiol.washington.edu/grc/ ), og de ​​indspillede topintensiteter som input til at beregne viral relative fitness (d). Se trin 6.10.6. 20

Representative Results

For at undersøge fitness virkningen af enkelte aminosyreændringer i HIV-1 Gag-p24, vi anvendte oligonukleotid dirigeret mutagenese til at introducere mutationer i et pNL4-3 plasmid indeholdende HIV-1 COTB-p24-gen 23,32,33. Virale stamopløsninger blev genereret ved transfektion af 293T-celler og høstet efter 48 timer. Vi anslået vævskultur infektiøs dosis 50% (TCID50) af hvert virusstamme af Reed-Muench-metoden 31. Den TCID50 af prototypen og mutant vira varierede fra april 10 - maj 10 IU / ml (figur 3A).

Kinetikken af ​​de rekombinante vira vækst blev etableret i PBMC'er fra en enkelt donor ved en MOI på 0,005. RT-qPCR blev anvendt til måling viral cDNA kopiantal dagligt i seks dage. Alle mutante og prototype virus voksede eksponentielt mellem dag 2 og dag 4, hvorefter virusvækst aftog, som indikeret ved en nedsat hældning af det virale RNA kopiantal forøgelse (<strong> Figur 3B). Faldet i cDNA kopiantal mellem dag 0 (svarende til inokulum) og dag 2 skyldes absorption af virus til celler og fjernelse af ubundne virioner ved dag 1 vask (trin 5.1.6). I den eksponentielle vækstfase, alle tre mutanter havde en langsommere væksthastighed (g) end prototype virus (figur 3C).

Alle tre mutanter blev konkurrerede mod prototype virus i vækst kompetitive assays til en samlet MOI på 0,005. Virale vækstkinetik i duelt inficerede kulturer var ligner monoinfection; den virale eksponentielle vækstfase var mellem dag 2 og 4, og viral vækst nåede et plateau omkring dag 5 (figur 4A).

Virale vækstrate forskelle blev afledt fra ændringen i den virale forhold over tid. Den virale-forholdet blev beregnet på grundlag af cDNA kopi antal referencen og mutant virus ved hjælp af RT-qPCR, og ved at sammenligne tophøjderi rækkefølge kromatogrammer i nukleotidposition sites skelnes mellem de to virus (figur 4B). Forskellene vækstrate bestemmes ved hjælp af peak-højde og virale RNA kopi nummer metoder gav lignende resultater (figur 4C). Alle tre mutanter havde lavere replikation fitness end prototype virus med mutanten I256V har den laveste fitness (figur 4C).

Figur 1
Figur 1: Flow diagram af de protokoller, der præsenteres i dette papir Virus Forberedelse protokoller vedrører opførelsen af HIV-1 rekombinante kloner og generering af virale bestande.. Fitness-assays protokoller er for at etablere virale vækstkinetik og bestemmelse af relativ viral fitness. Stiplede linjer repræsenterer alternative strømme for protokollerne. For eksempel kan en mutation indføres direkte i HIV-1 NL4-3molekylær klon uden at generere en rekombinant klon.

Figur 2
Figur 2:. Konstruktion af HIV-1 NL4-3 COTB Gag-p24 rekombinante molekylære kloner bruger overlap PCR (A) Design de kimære primere. 5'halvdele af primerne indeholder NL4-3 vektor sekvensen og 3'halvdele indeholder enderne af insertet sekvens. (B) Kimære primere anvendes til at amplificere insertet fragment, COTB Gag-p24. (C) De insert-fragmenter anvendes som primere for en anden PCR til at generere et nyt rekombinant plasmid.

Figur 3
Figur 3:. Virale vækstkarakteristika i PBMC'er (A) Log 10 TCID50 (B) Viral vækstkinetik i monoinfections indledt ved en MOI = 0,005. (C) Viral vækstrater over seks dage, inklusive de eksponentielle vækstfase (dage 2-4) afledt af panelet (B). De viste værdier repræsenterer gennemsnittet af tre replikater fra et eksperiment. Fejlsøjlerne repræsenterer 95% konfidensintervaller.

Figur 4
Figur 4: Viral vækst og relativ fitness bestemmelser (A) Viral vækst i duelt inficerede PBMC kulturer.. (B) Forhold mellem T242N og prototype virus bestemt under anvendelse af RT-qPCR eller sekventering peak-højde-metoden. (C) Net virale vækstrate forskelle (d) mellem mutanten og prototype virus i duelt inficerede kulturer, som vist i (A). d-værdier blev beregnet from de virale forholdet data vist i (B). De viste værdier repræsenterer gennemsnittet af tre replikater fra et eksperiment. Fejlsøjlerne repræsenterer 95% konfidensintervaller.

Discussion

Protokollerne fremlagte bestod af to hoveddele: konstruktionen af ​​rekombinante HIV-1 molekylære kloner og vækst kompetitive assays. For at skelne to vira i en duelt inficeret cellekultur, er det vigtigt, at de konkurrerende molekylære kloner indeholder sekvens-tags, som kan påvises ved en RT-qPCR primer-probe-assay eller ved Sanger-sekventering. Denne protokol gør brug af de VIFA og VifB tags, som bor på samme region af HIV-1 NL4-3 vif og koder for den samme aminosyresekvens, men afviger med seks synonyme mutationer. Disse mutationer blev vist ikke at påvirke viral replikation fitness 20. PCR-baserede kloning metode anvendes i denne protokol giver mere fleksibilitet i valg af kloningssites, sammenlignet med restriktionssted baseret kloning. Men effektiviteten af ​​PCR-kloning falder som insert størrelse stiger. Den nuværende grænse for indsatsen størrelse er ~ 5 kb 34. For PCR-baseret kloning og site rettet mutagenesis, er afgørende at anvende en high-fidelity DNA-polymerase til at reducere sandsynligheden for ekstra mutationer. Anvendelse af det minimale antal PCR-cykler, der er nødvendige til opnåelse af tilstrækkelige mængder af produkter er også anbefales. Det er vores erfaring, vi ikke registrere nogen ekstra mutationer efter de PCR-baserede kloning og site-directed mutagenese trin beskrevet her. Alligevel PCR produkterne bør sekventeret for at kontrollere for eventuelle uønskede mutationer. Ideelt set skal hele HIV kodende region blive resequenced.

Mindst tre prøveudtagningssteder tidspunkter bør undersøges inden for den eksponentielle vækstfase 9. De virale vækstkinetik skal først etableres ved hjælp af daglige stikprøver for at bestemme de passende kultur periode og prøvetagning tidspunkter til konkurrencen vækst. En faktor, der påvirker virale vækstkinetik er mangfoldigheden af ​​infektion (MOI). Denne protokol anvendes i alt MOI på 0,005 for både monoinfection og vækst konkurrence, da det blev vist, hvilket gav flere robust resultater end lavere MOI 9. Ikke desto mindre kan lavere MOI anvendes til at opnå en længere eksponentielle vækstfase om nødvendigt, men på bekostning af resultatet konsistens. Denne protokol antyder en indledende infektion forhold på 50:50, forudsat at fitness forskelle i vira er generelt ukendt på forhånd. Men brugen af ​​ulige input forhold er passende, når der er foreløbige data tyder signifikante forskelle i virusreplikation kinetik. I disse tilfælde er en infektion på 70:30 anbefales at give mulighed for detektion af et stort fitness forskel, hvor den mindre egnet virus anbringes i overskud 9.

Protokollen til bestemmelse af TCID50, virale vækst kinetik, og til at udføre væksten kompetitive assays blev optimeret under anvendelse af HIV-1 subtype B, har NL4-3 COTB-p24, og PBMC'er fra en enkelt donor, hvis PBMC demonstrerede konsekvent modtagelighed for HIV- 1-infektion in vitro. Dyrkningsperiodenog prøvetagning tidspunkter præsenteres i denne protokol vil sandsynligvis være egnet til at studere HIV-1 gruppe M virus i humane PBMC'er. Ved hjælp af PBMC'er fra en enkelt kilde er stærkt anbefales for at opnå ensartede resultater som den virale replikation kan variere i forskellige donorceller 35. Selv mindre ønskeligt, kan PBMC'er poolet fra flere donorer anvendes som en udskiftning, forudsat at den samme pulje bruges på tværs af alle forsøg. Et andet alternativ er anvendelsen af ​​cellelinjer. Protokollen præsenteres her blev brugt med succes med T-celle linie CEMx174 23,36. Det er imidlertid vigtigt, at antallet af celler podet er re-optimeret til at opnå en ensartet cellevækst. Virale vækstkinetik skal også genetableres, da det er sandsynligt at variere i forskellige cellelinjer, for at bestemme de passende prøvetagning tidspunkter i væksten konkurrence- trin.

To forskellige metoder til fastlæggelse af virale ratio for beregning fitness er inkluderet i protocol. I første fase anvendes RT-qPCR at måle viral cDNA kopiantal ved hvert tidspunkt for prøvetagning. Viral replikation fitness blev derefter beregnet fra den virale forhold, baseret på cDNA kopiantal. Alternativt kan den virale forholdet bestemmes på grundlag af forholdet mellem kromatogram tophøjde på ViFAB tag sites. De to metoder gav sammenlignelige resultater (figur 4). Kromatogrammet tophøjde metode kan anvendes på andre HIV-1 stammer uden et konstrueret sekvens tag. For RT-qPCR, anvendelse af primere eller prober til at skelne virusvarianter først skal evalueres omhyggeligt (se 20). Alligevel RT-qPCR giver bedre følsomhed for prøver med en lille mængde af viralt RNA, såsom dem fra det første tidspunkt i den eksponentielle vækstfase. Direkte måling af viral cDNA tillader også påvisning af tekniske problemer, der kan opstå i forbindelse med RNA ekstraktion og cDNA-syntese. Ved hjælp af molekylære kloner med sekvensmærker giver en omkostningseffektiv løsning to RT-qPCR metoder, da kun to par primere og prober er nødvendig for at studere flere vira. Denne strategi undgår også problemet med peak-højde variation i sekvens chromatogrammerne skyldes tilstødende baser 37, som sekventering sker på det samme sted på tværs af alle vira i undersøgelsen. PCR-produkterne produceret til RT-qPCR og Sanger-sekventering kan også være brug med andre metoder til at bestemme viral forhold såsom bulk-sekventering af individuelle kloner 12,13, MTV 4,7,17,19 eller oligonukleotid ligeringsassayet (OLA) 38 .

Disclosures

Forfatterne erklærer, at de ikke har nogen konkurrerende finansielle interesser. Holdningerne heri er dem af forfatterne, og skal ikke opfattes som officiel eller repræsenterer de synspunkter, som amerikanske forsvarsministerium eller Institut for hæren.

Materials

Name Company Catalog Number Comments
Construction of recombinant clones
Chimeric primer/Mutagenic/Sequencing primers IDT Custom DNA oligos
pNL4-3VifA and pNL4-3VifB plasmid Please contact Dr. James I Mullins (jmullins@uw.edu)
High-Fidelity DNA polymerase Thermo Scientific F-549S
High-fidelity buffer Thermo Scientific F-549S
dNTP Bioline Bio-39026
Thermal cycler Life Technologies Applied Biosystems® GeneAmp® PCR System 9700
DNA loading dye Thermo Scientific R0631
1 kb Plus DNA ladder Invitrogen 10787-018
QIAquick PCR Purification Kit Qiagen 28104
QIAquick gel extraction kit Qiagen 28704
DpnI enzyme New England Biolabs R0176S
TOP10 chemically competent Escherichia coli Invitrogen C4040-10
Luria Broth base powder Invitrogen 12795-084
Carbenicillin Research Products International C46000-25.0
QIAprep Spin Miniprep kit  Qiagen 27104
EndoFree Plasmid Maxi Kit Qiagen 12362
Transfection
X-tremeGENE 9 DNA transfection reagent Roche 6365787001
HEK 293T-17 ATCC CRL-11268 http://www.atcc.org/
0.22 μm filter top tube VWR International 89220-716 
Cell culture
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 10566016
Iscove′s Modified Dulbecco′s Medium (IMDM) Life Technologies 31980-030
RPMI-1640 media Life Technologies 61870-036
Phytohemagglutinin (PHA) Thermo Scientific R30852801
Human Interleukin-2 Roche 11147528001
Fetal bovine serum JR Scientific 43640
Penicillin and Streptomycin Corning Cellgro 30-001-CI
6 well plate VWR Scientific 73520-906
48 well plate VWR Scientific 62407-338
96 well flat-bottomed plate ISC Bioexpress T-3015-4
96 well round-bottomed plate BD Falcon 353077
1.5 ml Microcentrifuge Tube Mt. Baker Bio MBD-1500
1.5 ml tubes w/ O-ring VWR Scientific 89004-290
50 ml conical tube ISC Bioexpress C-3317-6
ELISA
Triton-X 100 Sigma-Aldrich X100
Phosphate buffer saline (PBS) Invitrogen 14190-250
Fetal bovine serum (FBS) Sigma-Aldrich F0392
glycerol Sigma-Aldrich G5516
Tween 20 Sigma-Aldrich P1379
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153
Rabbit anti-HIV-1 SF2 p24 antiserum NIH AIDS Reagent Program 4250
Goat anti-rabbit HRP KPL 474-1516
TMB Microwell Peroxidase Substrate KPL 52-00-01
H2SO4 Fisher Scientific A300-500 Causes severe burns by all exposure routes. Use personal protective equipment. Use only under a chemical fume hood. Wash off immediately with plenty of water for at least 15 min.
HIV p24 standard AIDS and Cancer Virus program (NCI-Frederick) For order details please contact Julian Bess, Jr. (bessjw@mail.nih.gov); http://ncifrederick.cancer.gov/Programs/Science/Acvp/bio/Bess.aspx
Microplate reader Molecular Devices VMax Kinetic ELISA Microplate Reader
RNA isolation cDNA synthesis
QIAxtractor Qiagen http://www.qiagen.com/products/catalog/automated-solutions/sample-prep/qiaxtractor
QIAamp Viral RNA Mini Kit Qiagen 52906
dNTP Bioline Bio-39026
SuperscriptIII Invitrogen 18080-085
First-strand buffer  Invitrogen 18080-085
Dithiothreitol (DTT) Invitrogen 18080-085
Rnase inhibitor Roche 3335402001
RnaseH Invitrogen 18021-071
qPCR
Real-time qPCR machine Life Technologies Applied Biosystems 7300 Real-Time PCR 
TaqMan® Gene Expression Master Mix Life Technologies 4369016
Forward, reverse primer IDT Custom order
Probe Life Technologies Custom order
optical 96 well reaction plate Life Technologies I19N3Q216
PCR+sequencing
Taq DNA polymerase (Biolase) Bioline Bio-21043
NH4 buffer  Bioline Bio-21043
MgCl2 Bioline Bio-21043
Sequencing primer IDT Custom order
QIAxcel Qiagen http://www.qiagen.com/products/catalog/automated-solutions/detection-and-analysis/qiaxcel-advanced-system
DNA sequencing service provider http://www.htseq.org/
GRC web tool http://indra.mullins.microbiol.washington.edu/grc/
ChromatQuan web tool http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi

DOWNLOAD MATERIALS LIST

References

  1. Domingo, E., Holland, J. J. RNA virus mutations and fitness for survival. Annu Rev Microbiol. 51, 151-178 (1997).
  2. Domingo, E. Mechanisms of viral emergence. Veterinary research. 41, (6), 38 (2010).
  3. Martinez-Picado, J., Martinez, M. A. HIV-1 reverse transcriptase inhibitor resistance mutations and fitness: a view from the clinic and ex vivo. Virus Res. 134, (1-2), 104-123 (2008).
  4. Troyer, R. M. Variable fitness impact of HIV-1 escape mutations to cytotoxic T lymphocyte (CTL) response. PLoS Pathog. 5, (4), e1000365 (2009).
  5. Rolland, M. Amino-acid co-variation in HIV-1 Gag subtype C: HLA-mediated selection pressure and compensatory dynamics. PLoS One. 5, (9), e12463 (2010).
  6. Abraha, A. CCR5- and CXCR4-tropic subtype C human immunodeficiency virus type 1 isolates have a lower level of pathogenic fitness than other dominant group M subtypes: implications for the epidemic. J Virol. 83, (11), 5592-5605 (2009).
  7. Quinones-Mateu, M. E. A dual infection/competition assay shows a correlation between ex vivo human immunodeficiency virus type 1 fitness and disease progression. J Virol. 74, (19), 9222-9233 (2000).
  8. Ball, S. C. Comparing the ex vivo fitness of CCR5-tropic human immunodeficiency virus type 1 isolates of subtypes. B and C. J Virol. 77, (2), 1021-1038 (2003).
  9. Lanxon-Cookson, E. C. Factors affecting relative fitness measurements in pairwise competition assays of human immunodeficiency viruses. J Virol Methods. 194, (1-2), 7-13 (2013).
  10. Garcia-Lerma, J. G., MacInnes, H., Bennett, D., Weinstock, H., Heneine, W. Transmitted human immunodeficiency virus type 1 carrying the D67N or K219Q/E mutation evolves rapidly to zidovudine resistance in vitro and shows a high replicative fitness in the presence of zidovudine. J Virol. 78, (14), 7545-7552 (2004).
  11. Sharma, P. L., Crumpacker, C. S. Attenuated replication of human immunodeficiency virus type 1 with a didanosine-selected reverse transcriptase mutation. J Virol. 71, (11), 8846-8851 (1997).
  12. Martinez-Picado, J., Savara, A. V., Sutton, L., D'Aquila, R. T. Replicative fitness of protease inhibitor-resistant mutants of human immunodeficiency virus type 1. J Virol. 73, (5), 3744-3752 (1999).
  13. Wang, J. The HIV-1 reverse transcriptase mutants G190S and G190A, which confer resistance to non-nucleoside reverse transcriptase inhibitors, demonstrate reductions in RNase H activity and DNA synthesis from tRNA(Lys, 3) that correlate with reductions in replication efficiency. Virology. 348, (2), 462-474 (2006).
  14. Song, H. Impact of immune escape mutations on HIV-1 fitness in the context of the cognate transmitted/founder genome. Retrovirology. 9, (89), (2012).
  15. Ali, A., Yang, O. A novel small reporter gene and HIV-1 fitness assay. Journal of Virological Methods. 133, (1), 41-47 (2006).
  16. Maarseveen, N. M. A novel real-time PCR assay to determine relative replication capacity for HIV-1 protease variants and/or reverse transcriptase variants. J Virol Methods. 133, (2), 185-194 (2006).
  17. Liu, Y. Evolution of human immunodeficiency virus type 1 cytotoxic T-lymphocyte epitopes: fitness-balanced escape. J Virol. 81, (22), 12179-12188 (2007).
  18. Anastassopoulou, C. G., Ketas, T. J., Klasse, P. J., Moore, J. P. Resistance to CCR5 inhibitors caused by sequence changes in the fusion peptide of HIV-1 gp41. Proc Natl Acad Sci U S A. 106, (13), 5318-5323 (2009).
  19. Abraha, A., Troyer, R. M., Quinones-Mateu, M. E., Arts, E. J. Methods to determine HIV-1 ex vivo fitness. Methods Mol Biol. 304, 355-368 (2005).
  20. Liu, Y. A sensitive real-time PCR based assay to estimate the impact of amino acid substitutions on the competitive replication fitness of human immunodeficiency virus type 1 in cell culture. J Virol Methods. 189, (1), 157-166 (2013).
  21. Brumme, Z. L. Reduced replication capacity of NL4-3 recombinant viruses encoding reverse transcriptase-integrase sequences from HIV-1 elite controllers. J Acquir Immune Defic Syndr. 56, (2), 100-108 (2011).
  22. Nomura, S. Significant reductions in Gag-protease-mediated HIV-1 replication capacity during the course of the epidemic in. Japan. J Virol. 87, (3), 1465-1476 (2013).
  23. Rolland, M. HIV-1 conserved-element vaccines: relationship between sequence conservation and replicative capacity. J Virol. 87, (10), 5461-5467 (2013).
  24. Martinez-Picado, J. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. J Virol. 80, (7), 3617-3623 (2006).
  25. Brockman, M. A. Escape and Compensation from Early HLA-B57-Mediated Cytotoxic T-Lymphocyte Pressure on Human Immunodeficiency Virus Type 1 Gag Alter Capsid Interactions with Cyclophilin A. J Virol. 81, (22), 12608-12618 (2007).
  26. Miura, T. HLA-associated alterations in replication capacity of chimeric NL4-3 viruses carrying gag-protease from elite controllers of human immunodeficiency virus type 1. J Virol. 83, (1), 140-149 (2009).
  27. Basic Methods in Cellular and Molecular Biology, PCR: The Polymerase Chain Reaction. JoVE. Cambridge, MA. Available from: http://www.jove.com/science-education/5056/pcr-the-polymerase-chain-reaction (2014).
  28. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments : JoVE. 62, (Apr 20), (2012).
  29. Basic Methods in Cellular and Molecular Biology, Restriction Enzyme Digests. JoVE. Cambridge, MA. Available from: http://www.jove.com/science-education/5070/restriction-enzyme-digests (2014).
  30. McClure, J., van't Wout, A. B., Tran, T., Mittler, J. E. Granulocyte-monocyte colony-stimulating factor upregulates HIV-1 replication in monocyte-derived macrophages cultured at low density. J Acquir Immune Defic Syndr. 44, (3), 254-261 (2007).
  31. Reed, L. J., Muench, H. A simple method of estimatingfifty percent endpoints. Am J Hyg. 27, (3), 493-497 (1938).
  32. Nickle, D. C. Consensus and ancestral state HIV vaccines. Science. 299, (5612), 1515-1518 (2003).
  33. Rolland, M. Reconstruction and function of ancestral center-of-tree human immunodeficiency virus type 1 proteins. J Virol. 81, (16), 8507-8514 (2007).
  34. Bryksin, A. V., Matsumura, I. Overlap extension PCR cloning: a simple and reliable way to create recombinant plasmids. Biotechniques. 48, (6), 463-465 (2010).
  35. Spira, A. I., Ho, D. D. Effect of different donor cells on human immunodeficiency virus type 1 replication and selection in vitro. J. Virol. 69, (1), 422-429 (1995).
  36. Manocheewa, S., Swain, J. V., Lanxon-Cookson, E., Rolland, M., Mullins, J. I. Fitness costs of mutations at the HIV-1 capsid hexamerization interface. PLoS One. 8, (6), e66065 (2013).
  37. Zakeri, H., Amparo, G., Chen, S. M., Spurgeon, S., Kwok, P. Y. Peak height pattern in dichloro-rhodamine and energy transfer dye terminator sequencing. Biotechniques. 25, (3), 406-410 (1998).
  38. Lalonde, M. S. Sensitive oligonucleotide ligation assay for low-level detection of nevirapine resistance mutations in human immunodeficiency virus type 1 quasispecies. J Clin Microbiol. 45, (8), 2604-2615 (2007).
Parvis Growth Konkurrence Assay til Bestemmelse af Replication Fitness af Human Immunodeficiency Virus
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Manocheewa, S., Lanxon-Cookson, E. C., Liu, Y., Swain, J. V., McClure, J., Rao, U., Maust, B., Deng, W., Sunshine, J. E., Kim, M., Rolland, M., Mullins, J. I. Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses. J. Vis. Exp. (99), e52610, doi:10.3791/52610 (2015).More

Manocheewa, S., Lanxon-Cookson, E. C., Liu, Y., Swain, J. V., McClure, J., Rao, U., Maust, B., Deng, W., Sunshine, J. E., Kim, M., Rolland, M., Mullins, J. I. Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses. J. Vis. Exp. (99), e52610, doi:10.3791/52610 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter