Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Paarweise Wachstum Wettbewerb Assay zur Bestimmung der Replication Fitness von Human Immunodeficiency Viruses

doi: 10.3791/52610 Published: May 4, 2015

Introduction

Virale Replikation Fitness ist als die Fähigkeit eines Virus der infektiösen Nachkommen in einer bestimmten Umgebung 1 produzieren definiert und ist ein wichtiger Faktor bei der Bestimmung der Prävalenz von einer Virusvariante auf Bevölkerungsebene im Laufe der Zeit 2. In vivo-Studien Fitness nicht machbar mit humanpathogenen Viren, wie HIV-1, verschiedene in vitro und ex vivo-Replikation Fitness Assays wurden entwickelt, um die Auswirkungen auf die Eignung, die aus Arzneimittelresistenz und Immun-Escape-Mutationen epistasis und der Entwicklung zu untersuchen viraler Populationen 3-6. Unter den verschiedenen Fitness Assays werden Wachstums Kompetitionstests erkannt empfindlicher und gültig Maßnahmen Kondition Unterschiede ergeben, da zwei oder mehrere virale Varianten konkurrieren um die gleiche Zellpopulation unter exakt denselben Umweltbedingungen wie in vivo 1,7,8 auftritt. Vor Beginn der Wachstums Kompetitionsexperimente mehrere variables muss bestimmt werden, einschließlich der Verwendung von verschiedenen Multiplizitäten der Infektion (MOI), virale Eingangsverhältnis, und der Zeitpunkt der Probenahme für die Analyse. Wir haben die Auswirkungen dieser Parameter auf die virale Wachstumskinetik und auf das Ergebnis der Konkurrenzexperimenten studiert und haben wichtige Faktoren für robuste Messungen von HIV-1 Fitness erforderlich in Zellkultur 9 identifiziert.

Zusätzlich zum Test Variablen gibt es eine Vielzahl von Verfahren zur Quantifizierung Virusvarianten in Wachstums Kompetitionsexperimenten. Bulk 10,11 oder 12,13 klonale Sequenzierung wurde verwendet, um das Verhältnis der konkurrierenden Viren auf der Grundlage der Nucleotid-Frequenzen an der Stelle (n) von Interesse zu bestimmen. Relative Fitness von Änderungen in diesem Verhältnis im Laufe der Zeit ab. Dieses Verfahren ist praktisch, da die DNA-Sequenzierung Dienstleistungen sind überall erhältlich. Die parallele allelspezifische Sequenzierung (PASS) Verfahren ermöglicht die Sequenzierung an mehreren Standorten und den Nachweis von Rekombinanten 14 15 oder auch Mutationen 4,16-18 als Tags, die konkurrierenden Viren durch Sequenzierung, Heteroduplex-Tracking-Tests (HTA) 4,7,17,19 unterscheiden oder reverse Transkription-quantitative Echtzeit-Polymerase-Kettenreaktion (RT-qPCR) 15,16,18,20, von denen alle für studieren konkurrierenden Stämme unabhängig von Sequenzähnlichkeit werden. Ein zusätzlicher Schritt ist erforderlich, um Tags in virale Genome einführen und die RT-qPCR-Assay erfordert auch spezifische Reagenzien und Instrumentierung. Wir haben festgestellt, daß Schütt Sanger Sequenzierung Ausbeuten 9 vergleichbare Ergebnisse.

Nach einem Wachstum Wettbewerb wird die virale Replikation Fitness als relative Fitness, oder ein Fitness-Verhältnis zwischen t vorgestelltwo Virusvarianten. Die relative Eignung eines Virus kann als der endgültige Anteil einer Virusvariante durch die ursprüngliche Anteil im Inokulum oder als die Netto-Wachstumsrate Differenz zwischen den zwei konkurrierenden Viren normalisiert definiert werden. Wir fanden, dass das letztgenannte Verfahren, mit Längsdatenpunkte nur in der exponentiellen Wachstumsphase, erzeugt die robustesten Ergebnisse 9,20.

In-vitro-Assays Fitness in erster Linie verwendet werden, um biologische Klone 6-8 und infektiöse molekulare Klone von HIV-1 zu untersuchen. Letzteres ist zugänglich Genmanipulation werden oft eingesetzt, um die Wirkung auf die Eignung von bestimmten Mutationen oder spezifische Sequenzen von Interesse 3-5,21,22 studieren. Die folgenden Protokolle beschreiben einen Workflow unter dem Aspekt der Bau neuer voller Länge infektiösen HIV-1 molekulare Klone mit HIV-1-Vektoren, die eine Sequenz-Tag, die Einführung von Mutationen von Interesse, so dass virale Bestände und zur Errichtung virale Wachstum KinetikZur Durchführung der Wachstums Kompetitionsassays und die Berechnung der relativen fitness (Abbildung 1).

Mit unserer optimierten Verfahren, wir drei rekombinanten HIV-1-Mutanten erzeugt und bestimmt ihre Replikation Fitness. Das rekombinante molekularen Klon wurde zuerst durch Ersetzen des HIV-1 gag-p24-Genregion pNL4-3, einem Plasmid, das ein Volllängen-infektiöse Genom des HIV-1-Stamm NL4-3 Labor, mit einem synthetischen COTB (Mitte-of konstruiert Baum, Subtyp B) gag-p24-Sequenz 23, um den Prototyp-Stamm zu erstellen. Einzel amino Änderungen (T186M, T242N und I256V) wurden dann eingebracht, um drei mutierten Klone erstellen. Jede Mutante wurde gegenüber dem Prototyp-Virus konkurrierten um die Fitness Auswirkungen der einzelnen Mutation im gegebenen genetischen Hintergrund zu beobachten. Die drei Mutanten demonstrierten unterschiedlichem Replikation fsitness von gering bis deutlich niedriger als der Prototyp-Virus. Die T242N Mutation wurde bereits berichtet, eine moderate fitne habenss kosten 24-26, ähnlich zu dem in dieser Untersuchung gezeigte Ergebnis. Der Fitnesskosten der anderen zwei Mutationen zuvor nicht berichtet worden.

Protocol

HINWEIS: Das Protokoll, wie unten beschrieben, enthält keine Patienten Informationen und ist daher nicht als Human Subjects Forschung von der University of Washington Institutional Review Board oder Human Subjects Abteilung.

1. Konstruktion von chimären HIV-1 NL4-3 Molecular Clones

1.1) Amplify Insert DNA Fragment

  1. Gestalten Sie chimären Primer. Die 5'-Hälften Vorwärts- und Rückwärts-Primer enthalten eine HIV-1-Vektor-Sequenz, bei dem das Fragment eingefügt. Die 3'-Hälfte des Primers muß das Ende der Insertsequenz (Figur 2) enthalten. Stellen Sie sicher, dass die chimären Primer-Sequenz behält die ursprüngliche offene Leserahmen.
    1. Verwenden Primer mindestens 20 Basen in der Länge, mit einer Schmelztemperatur größer oder gleich 60 ° C, ca. 50% GC-Gehalt und einer geringen Neigung zur Primer-Dimere, Heterodimere und / oder Haarnadelstrukturen zu bilden. Beurteilen Sie diese EigenschaftenVerwendung des OligoAnalyzer Webtool ( https://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ ).
  2. Verwenden PCR 27 und die chimären Primer an Insert-DNA (Abbildung 2) zu verstärken. Für jede PCR-Reaktion zu verwenden 1X High-Fidelity-Puffer, 0,2 mM dNTPs, 1 U der High Fidelity DNA-Polymerase, 0,5 & mgr; M von vorne chimären Primer, 0,5 & mgr; M von Reverse chimären Primer und 1 pg0 ng DNA Probentransporteinsatz Region. Hinzuzufügen dH 2 O auf ein Endvolumen von 50 ul.
  3. Eingestellt thermische Zyklusschritte wie folgt: Durchführen einer anfänglichen DNA-Denaturierungsschritt bei 98 ° C für 10 sec. Verstärken mit 30 Zyklen von Denaturierung der DNA bei 98 ° C für 10 sec und DNA Glühen bei 3 ° C über dem niedrigsten Schmelztemperatur der beiden Primer für 20 sec. Durchführen einer abschließenden Extension bei 72 ° C für 10 min. Speicher PCR-Produkte bei 4 ° C.
  4. Werden 5 & mgr; l der PCR-Produkte aus demvorherigen Schritt und führen Agarosegelelektrophorese 28.
    1. Verwenden einer 0,7% igen Agarosegel, 1x TAE-Puffer (40 mM Tris-Acetat, 1 mM EDTA), 0,5 ug / ml Ethidiumbromid (EtBr) Endkonzentration und 1 kb Leiter als DNA-Größenmarker. Set Energiequellenspannung 5 V / cm Abstand zwischen den Elektroden. Stoppen Sie die Elektrophorese, wenn der Ladepuffer wandert durch etwa 2/3 der Länge Gel. Visualisieren Sie das Gel mit einem Gel-Dokumentationssystem 28.
      HINWEIS: EtBr steht im Verdacht, krebserregend und müssen ordnungsgemäß entsorgt werden, pro Einrichtung Vorschriften. Handschuhe sollten immer beim Umgang mit Gelen, die EtBr getragen werden. Ändern Sie, um neue Handschuhe nach dem Fertig Handhabung EtBr Material und vor dem Umgang mit anderen Materialien oder Geräte, um Kreuzkontamination zu vermeiden.
  5. Wenn nur eine DNA-Bande mit einer Größe entsprechend dem gewünschten PCR-Produkt erkannt wird, zu reinigen, der Rest des PCR-Produkts unter Verwendung eines kommerziellen Kits, wie QIAquick PCR Purification Kit Einklanging Herstellerprotokolle.
    1. Wenn andere, unspezifische Banden sind ebenfalls vorhanden, verwenden Sie den Rest des PCR-Produkts zu präparative Gelelektrophorese laufen. Verwenden Sie die gleichen Parameter und Bedingungen in Schritt 1.1.4 angegeben. Sicherzustellen, daß das Gel auch groß genug, um 45 & mgr; l PCR-Produkte zu laden ~. Ausschneiden der Bande von Interesse und Extrahieren der DNA aus dem Gel mit dem QIAquick Gel Extraction Kit nach den Protokollen des Herstellers.

1.2) Führen Sie das Insert-Fragment in voller Länge Infectious HIV-1 Subtyp B Vector (pNL4-3)

  1. Verwenden gereinigten PCR-Produkte aus Schritt 1.1.5 als PCR-Primer. Verwenden pNL4-3VifA 20 als Matrizen-DNA in einer PCR-Reaktion verwendet pNL4-3VifB 20 als Matrize in der anderen Reaktion (Abbildung 2). Für jede PCR-Reaktion verwendet 1x High-Fidelity-Puffer, 0,2 mM dNTPs, 2 U High Fidelity DNA-Polymerase, 500 ng von Primer-DNA und 50 ng Matrizen-DNA in einem Endvolumenume von 50 ul. Setzen die thermischen Wechselparameter: 98 ° C für 30 sec, 35 Zyklen bei 98 ° C für 10 sec, 48 ° C für 1 min und 72 ° C für 10 min, gefolgt von 72 ° C für 10 min.
  2. Zugabe von 10 U Dpn I bis 50 & mgr; l der PCR-Reaktion und bei 37 ° C für 1 Stunde, um die Template-DNA zu verdauen. Sicherzustellen, daß die Plasmid-DNA wird aus einer Methylierung von kompetenten Bakterienstamm, zB isoliert., TOP10 chemisch kompetente Escherichia coli.
  3. Verwenden Dpn I verdaute Produkt zu kompetenten Bakterienzellen zu transformieren. Verwenden Hitzeschock-Transformation mit TOP10 chemisch kompetente E. coli, nach dem Protokoll des Herstellers. Um Bakterienzellen, die das rekombinante Plasmid auszuwählen, verwenden Luria Broth (LB) Kulturplatten, die 100 mg / l Carbenicillin.
    1. Wählen ~ 10 gut getrennte Kolonien wachsen und jeweils separat in 3 ml LB-Flüssigmedium, das 100 mg / l Carbenicillin und Inkubation bei 30 ° C in eineSchüttler O / N.
    2. Verwenden QIAprep Spin Miniprep Kit, um Plasmid-DNA aus dem Bakterienkulturflüssigkeit isoliert, entsprechend dem Protokoll des Herstellers.
  4. Verwenden Sie doppelte Restriktionsverdau 29, um festzustellen, ob die Plasmid-DNA die richtige Insert enthält. Sicherzustellen, daß eine der Restriktionsstellen nur innerhalb der Insertregion vorhanden ist, und das andere Restriktionsstelle ist nur einmal in der HIV-1-Vektor, außerhalb des Einsatzbereich.
    1. Digest mindestens 300 ng Plasmid-DNA in einer 10 ul Endreaktionsvolumen. Ausgewählte Restriktionspuffer, Inkubationstemperatur und Inkubationszeit nach dem Protokoll des Herstellers der ausgewählten Restriktionsenzyme. Nehmen 9 ul der verdauten DNA und führen Gelelektrophorese, wie in Schritt 1.1.4 beschrieben. Wählen rekombinanten Plasmide, die DNA-Bande der vorhergesagten Größen haben.
  5. Bestätigung eine Sequenzintegrität der rekombinanten Plasmide durch Sanger-Sequenzierung. Obwohl selten, unerwünschteMutation (en) kann in den PCR-Reaktionen eingeführt werden.
    1. Sequenz beide Stränge der Plasmid-DNA. Folgen Sie den Anweisungen in Schritt 1.1.1.1 zu Sequenzierprimer entwerfen. Außerdem ist sicherzustellen, dass die Vorwärts- und Rückwärts Sequenzierprimer Glühen mindestens 50 bp stromaufwärts und stromabwärts des Einsatzbereich in dem rekombinanten Plasmid verbunden.
    2. Absenden Plasmid-DNA und Sequenzierungsprimer an einen kommerziellen DNA-Sequenzierung Dienstleister. Bereiten DNA-Probe und Primer, wie die von der Behörde festgelegt.
  6. Machen Sie ein Endotoxin-Free Stock des mutierten Plasmid-DNA unter Verwendung eines Endotoxin frei Plasmid-DNA Kit gemäß Herstellerprotokoll. Vorbereitung mindestens 1 ug Endotoxin-freiem Plasmid-DNA zur Transfektion in der folgenden Stufe.

1.3) einführen Kleines Mutationen Via gerichtete Mutagenese

  1. Gestalten Sie mutagenen Primer mit überlappenden Vorwärts- und Rückwärtsprimer, die das gewünschte mutatIon (en). Stellen Sie die Basis (n) ausgewechselt werden, eingesetzt, oder in der Mitte der Primer, um 10-15 homologe Basen flankiert gelöscht. Folgen Sie den Anweisungen in Schritt 1.1.1.1.
  2. Verwenden PCR, um mutierte Plasmide zu synthetisieren. Für jede PCR-Reaktion verwendet 1x High-Fidelity-Puffer, 10 mM dNTPs, 2 U High Fidelity DNA-Polymerase, 0,5 & mgr; M Vorwärts mutagenen Primers, 0,5 & mgr; M Rückwärts mutagenen Primers und 50 ng chimären pNL4-3VifB von Schritt 1.2.6 in einem Endvolumen von 50 ul. Setzen die thermischen Wechselparameter: 98 ° C für 30 sec, 25 Zyklen bei 98 ° C für 10 sec, 48 ° C für 1 min und 72 ° C für 10 min, gefolgt von 72 ° C für 10 min.
  3. Wiederholen Sie die Schritte 1.2.2 bis 1.2.6.

2. Erzeugung von Viral Lizenz Mit Transfektion

  1. Berechnen Sie die Menge der benötigten Virusstamm gewünschten und Plasmid-DNA. Mit einem Virustiter von 10 4 IU / ml oder höher, 1,8 ml der Virusstammlösung ist ausreichend für zwei Sätze von Wachstums Wettbewerb assays, einschließlich Monoinfektionen, die jeweils dreifach durchgeführt. Für eine Transfektion in einer 6-Well-Platte durchgeführt wird etwa 1,8 ml Überstand pro Vertiefung geerntet. Ein ug Plasmid-DNA für jede Transfektion in 6-Well-Platte durchgeführt benötigt.
  2. Für jede Vertiefung einer Platte mit 6 Vertiefungen, bereiten 100 ul Transfektionsgemisch, z. B. bestehend aus 1 & mgr; l X-tremegene 9 Transfektionsreagenz (oder vergleichbares Produkt), 1 ug Plasmid-DNA und serumfreiem DMEM.
    1. Bestimmen Sie das Volumen der benötigten Plasmid-DNA unter Verwendung von 1 & mgr; g Plasmid-DNA pro Vertiefung. Sicherzustellen, dass die endgültige Konzentration der Plasmid-DNA von mindestens 50 ng / & mgr; l.
    2. Bestimmen, wie viel Serum-freiem Medium (DMEM) pro Vertiefung unter Verwendung der Formel erforderlich: Gesamtvolumen der DMEM in ul = 100 & mgr; l - DNA Volumen in ul.
  3. Werden 10 6 HEK293T-17 (ATCC) Zellen / Vertiefung in 2 ml Vermehrungsmedium (DMEM + 10% fötalem Rinderserum (FBS)) in eine Platte mit 6 Vertiefungen. Inkubieren für 1 h bei 37 ° C in einem5% CO 2 Atmosphäre. Samen machen wie viele Brunnen nach Bedarf (in Schritt 2.1 bestimmt).
  4. Um die Transfektion Mischung herzustellen, aliquotieren das entsprechende Volumen an Serum-freies DMEM, wie oben, berechnet in ein 1,8 ml-Polypropylen-Mikrozentrifugenröhrchen, und fügen Sie den Transfektionsreagenz.
    1. Pipette Reagenz direkt in den Media-Lösung, nicht an die Kunststoffoberfläche des Mikrozentrifugenröhrchen hinzuzufügen. In Plasmid-DNA letzten. Pipette nach oben und unten vorsichtig, um die Lösung zu mischen. Inkubieren für 15 Minuten bei RT (15 ° C bis 25 ° C), um die Bildung von Transfektionskomplexen ermöglichen.
    2. Fügen Sie die Mischung in einer tropfenweisen Weise auf Zellen in der Platte mit 6 Vertiefungen ausgesät. Schütteln oder schwenken die Brunnen auf gleichmäßige Verteilung der Transfektionskomplexe gewährleisten.
    3. Dichtungsplatten mit Plastikfolie.
  5. Kulturen, die bei 37 ° C inkubieren in einem 5% CO 2 -Atmosphäre für 48 Stunden.
  6. Mit einer Pipette sorgfältig zu sammeln und Überstand in ein 15-ml-Tube through einen 0,22 um Filter oben.
  7. Pipette bis 250 & mgr; l oder mehr des gefilterten Überstandes mit Gummidichtungen in den Deckel zu übertragen, um 1,8 ml Mikrozentrifugenröhrchen.
  8. Speicher gefilterten Überstände bei -80ºC bis zur Verwendung.

3. Bestimmen Sie Infektionstiter von Viral Stocks auf peripheren mononukleären Blutzellen (PBMCs)

  1. Stimulieren PBMCs mit Phytohämagglutinin (PHA). Pro Virusstamm, Samen 2 x 10 6 PBMC in komplettem Iscove modifiziertem Dulbecco-Medium (cIMDM; IMDM mit 20 U / ml humanes Interleukin-2 ergänzt (hIL-2), 10% fötales Rinderserum und 1% Penicillin / Streptomycin) ergänzt mit PHA (1,5 ug / ml). Samen PBMCs bei 2 x 10 6 Zellen / ml. PBMCs bei 37 ° C in einem 5% CO 2 -Atmosphäre für 72 h.
  2. Ernte-PHA stimulierte PBMCs. Übertragen nichthaft PHA-PBMCs zu einer 50 ml konischen Röhrchen. Zentrifugenröhrchen bei 228 g für 10 min. Überstand vorsichtig entfernen, ohne disrupting das Zellpellet. Re-suspendieren des Zellpellets in einer Endkonzentration von 2 x 10 5 PBMC / ml in cIMDM.
  3. Seed 2 x 10 4 PHA stimuliert PBMC / Vertiefung in 100 ul / Vertiefung cIMDM in einem Rundboden-96-Well-Platte.
  4. Machen Sie eine 1:10 Verdünnung der viralen Stamm. Dann, von der ersten verdünnten Lager, machen zwölf 3-fach serielle Verdünnungen in einer 96-Loch Masterplatte. Dieser Verdünnungsschema zum Nachweis viraler Titer im Bereich von 10 4 bis 10 6 infektiöse Einheit (IU) pro ml empfohlen.
    1. Fügen Sie beispielsweise 20 & mgr; l der Virusstamm zu 180 & mgr; l Medium in der 1,5-ml-Tube. Mischen Sie die Verdünnung durch Pipettieren sorgfältig. Dann Transfer 90 ul der verdünnten Brühe in 180 ul Medium der ersten gut und gut mischen durch Pipettieren.
    2. Weiter Verdünnungsreihe durch die Übertragung von 90 & mgr; l aus der aktuellen und zu 180 & mgr; l Medium in den nächsten gut elf weitere Male. Erhöht oder verringert die Anfangsverdünnung, wenn Titer von mehr als 10 6 IU / mloder niedriger ist als 10 4 IU / ml zu erwarten sind.
  5. In 40 ul der seriell verdünnten Virusstamm von der Master-Verdünnungsplatte auf die gesetzten PBMCs Platte (aus Schritt 3.3) in vierfacher Ausfertigung. Inkubation erfolgt bei 37 ° C in einem 5% CO 2 -Atmosphäre für 16-24 Std.
  6. Entfernen Sie vorsichtig 100 ul Überstand aus jeder Vertiefung, und ersetzen Sie sie durch 160 ml frisches cIMDM zu einem Gesamtvolumen von 200 ul / Vertiefung. Inkubation erfolgt bei 37 ° C mit 5% CO 2 -Atmosphäre (Tag 1).
  7. An den Tagen 4, 7, 10 und 13 Transfer 100 ul Überstand aus jeder Vertiefung 100 & mgr; l Aufschlußpuffer (2% Triton X-100 in PBS), und ersetzen mit 100 ul frisch cIMDM. Bewahren Sie die Überstände bei -20 ° C.
    1. Halten Probenahme und Zugabe von frischem cIMDM alle drei Tage, bis der Titer stabilisiert.
  8. Bestimmen Sie den 50% Gewebekulturinfektionsdosis (TCID 50) der viralen Stamm von p24-ELISA unter Verwendung der Tag, 7 und 13 Proben wie in Schritt 4 beschrieben.
    1. Wenn die TCID 50 von Tag 13 erhalten, ist deutlich höher als der Titer von Tag 7, kann das Virus Lager müssen eine längere Zeit zu erweitern. Wiederholen Sie den p24-ELISA unter Verwendung späteren Proben, bis die infektiösen Titer von zwei Abtastzeitpunkten stabil (oder Verringerung). Wählen Sie die Titel aus Proben mit den höchsten Titer.

4. ELISA (Enzyme-linked Immunabsorptions-Assay) Der Nachweis von HIV-1 p24 zur Bestimmung Viral Infektionstiter

HINWEIS: Das folgende Protokoll wurde mit p24-Antigen-Capture-Platten in unserem Labor 30 vorbereitet entwickelt. Kommerziellen HIV-1-p24-ELISA-Platte / Kits können auch verwendet werden, nach dem Protokoll des Herstellers.

  1. Vor der Arbeit mit Samples, bereiten Arbeitsvorräte an primären Antikörper (Kaninchen-Anti-HIV-1 SF2 p24-Antiserum).
    1. Thaw p24-Antiserum bei RT.
    2. Mischungs 2,5 ml Glycerin mit 2 ml 10% FBS in phosphate-gepufferter Saline (PBS).
    3. In 0,5 ml Antiserum und mischen.
    4. Speicher 1 ml Aliquots bei -20 ° C.
  2. Tau-Proben aus Schritt 3.7 in einem 37 ° C Inkubator.
  3. 5 mal mit Waschpuffer (1x PBS mit 0,05% Tween-20) Waschen Sie die p24-Capture-Platte.
  4. In 50 ul / Vertiefung Probenverdünnungsmittel (1% Rinderserumalbumin (BSA), 0,2% Tween-20 in RPMI-1640), dann fügen Sie 50 ul der Probe, um die entsprechenden Wells. Mindestens drei Vertiefungen mit Probenverdünnungsmittel nur als Mock / Negativkontrollen. Inkubieren für 2 Stunden bei 37 ° C oder O / N bei 4 ° C.
  5. Bereiten Sie den primären Antikörperlösung frisch vor Gebrauch. Machen Sie eine 1: 2000-fachen Verdünnung des primären Antikörpers Arbeits Aktien mit der primären Antikörperverdünnung (12% FBS in RPMI-1640). Sorgen für die Verwendung von 100 ul Lösung pro jeder Probe / Kontrollvertiefung in einer 96-Well-Platte genug herzustellen.
    1. Zum Beispiel, um genug Lösung für eine 96-Well-Platte zu machen, fügen Sie 5 ul des primären Antikörpers working Bestände an den primären Antikörper Verdünnungsmittel für ein Endvolumen von 10 ml.
  6. Waschen Sie Capture-Platte 5 mal mit Waschpuffer.
  7. 100 ul des primären Antikörperlösung in jede Vertiefung. Inkubation für 1 h bei 37 ° C in einem 5% CO 2 Atmosphäre.
  8. Bereiten Sie die Sekundärantikörperlösung frisch vor Gebrauch. Stellen eine 1: 14.400-fachen Verdünnung des sekundären Antikörpers (1 mg / ml Ziegen-Anti-Kaninchen-HRP) unter Verwendung der sekundären Antikörperverdünnung (7% FBS, 0,01% Tween-20 in RPMI-1640). Um Pipettierfehler zu reduzieren, führen Sie einen zweistufigen Reihenverdünnung. Sorgen für die Verwendung von 100 ul Lösung pro jeder Probe / Kontrollvertiefung in einer 96-Well-Platte genug herzustellen.
    1. Zum Beispiel, um genug Lösung für eine 96-Well-Platte zu machen, zuerst hinzufügen 1 ul des sekundären Antikörpers zu 99 & mgr; l des sekundären Antikörperverdünnung. Dann fügen 70 ul der ersten Verdünnung an den sekundären Antikörper Verdünnungsmittel für ein Endvolumen von 10 ml.
  9. Wash-Capture-Platte 5 times mit Waschpuffer.
  10. Füge 100 & mgr; l des sekundären Antikörperlösung in jede Vertiefung. Inkubation für 1 h bei 37 ° C in einem 5% CO 2 Atmosphäre.
  11. Waschplatte 5 mal mit Waschpuffer.
  12. 100 l RT TMB-Substrat. Inkubieren 30 min bei RT in einem geschlossenen Behälter vor Licht zu schützen.
  13. 100 l RT-Stop-Lösung (1 NH 2 SO 4).
  14. Lesen Sie die Absorption bei 450-650 nm in jeder Vertiefung mit Hilfe eines Mikroplatten-Reader. Verwenden Sie den Extinktionswert zu punkten jeweils auch infizierten oder nicht infizierten. Betrachten wir eine wohl infektiösen Virus enthalten, wenn der Extinktionswert mindestens dreimal höher als der Wert von Mock / negativen Kontrollvertiefungen zu lesen. Berechnen TCID 50 der viralen Stamm mit dem Reed-Meunch Verfahren 31.

5. Stellen Sie das virale Wachstum Kinetics

5.1) Monoinfektion

  1. Saatgut 3 x 10 5 PHA-stimulierte PBMC / Vertiefung in 48-Well-Plattes in einem Gesamtvolumen von 500 ul / Vertiefung. Danach wird die Kultur-Platten bei 37 ° C in einem 5% CO 2 Atmosphäre bis Inokulation.
  2. Für jedes Virus, bereiten ein Inokulum enthält 6.000 IE in 2 ml cIMDM.
  3. Inokulieren Wells in dreifacher Ausführung durch Zugabe von 500 ul des Inokulums (1500 IU) in die angesiedelten Zellen. Das endgültige Volumen der infizierten Zellkultur ist 1 ml / Vertiefung und der MOI 0,005.
  4. 200 ul Aliquot des verbliebenen Impfkultur zu jedem der zwei 96-Well-Platten für die RNA-Isolierung, von denen eines als ein Backup gespeichert.
  5. Kulturen, die bei 37 ° C inkubieren in einem 5% CO 2 -Atmosphäre für 16-24 Std.
  6. Wash Kulturen 16-24 h nach der Inokulation.
    1. Entfernen und entsorgen Sie 750 ul Kulturüberstand.
    2. In 750 ml frisches cIMDM. Wickeln Sie Platten in Plastikfolie und Spin für 10 Minuten bei 300 x g. Entfernen und entsorgen Sie 750 ul Überstand.
    3. In 750 ml frisches cIMDM. Inkubieren bei 37 ° C mit 5% CO 2 beimosphäre (Tag 1).
  7. Proben Kulturen täglich von Tag 2 bis Tag 7.
    1. Übertragen 500 ul Kulturüberstand in ein 1,8 ml-Zentrifugenröhrchen. Spin für 1 min bei 3.000 x g.
    2. Transfer 200 ul des zellfreien Überstand an den beiden 96-Loch-Probenplatten für RNA-Isolierung, wiederum spart eine Platte als Backup. Shopüberstände bei -80 ° C, bis die RNA-Isolierung.
    3. Fügen Sie 500 ul frisch cIMDM zu jeder Kultur. Inkubieren bei 37 ° C in einem 5% CO 2 Atmosphäre.
    4. Verwerfen Kulturen in Wescodyne am Ende des Experiments.
    5. Isolieren von RNA aus 200 ul Überstand (Nutzung von kommerziellen Kits wie QIAamp Viral RNA Mini Kit) nach Standardprotokoll des Herstellers. Für eine große Anzahl von Proben, verwenden Sie die Qiagen QIAxtractor.
    6. Speicher-RNA-Proben bei -80 ° C bis zur cDNA-Synthese.

5.2) cDNA-Synthese (Reverse Transkription)

  1. Für jede RNA sweise mit 1,2 nmol dNTP und 1,2 pmol des cDNA-Synthese-Primer (5'-GTTGATCCTTTAGGTATCTTTCCACAGC-3 ', HXB2 Nukleotid 7968-7995) und 10 ul der viralen RNA. Fügen Sie Wasser bis zu einem Endvolumen von 14 & mgr; l. Flick das Rohr zu mischen und Spin kurz auf Flüssigkeit am Boden des Röhrchens zu sammeln.
  2. Inkubieren Mischung für 5 min bei 65 ° C, dann bei 4 ° C zu halten, bis die Hauptmischung wird hergestellt.
  3. Vorbereitung Master Mix mit 5x Erststrang-Puffer (250 mM Tris-HCl, pH 8,3, 375 mM KCl, 15 mM MgCl 2), 5 mM DTT, 120 U SuperScriptIII und 240 U RNase-Inhibitor. Wasser In den Endvolumen von 10 & mgr; l.
  4. In 10 ul der Master-Mix, um RNA-Mischung, Flick, zu mischen und zu drehen, um zu sammeln.
  5. Inkubieren Mischung für 90 min bei 50 ° C, um die Synthese von cDNA zu ermöglichen. Proben für 15 min bei 70 ° C bis reverse Transkriptase zu inaktivieren. Halten bei 4 ° C nach Bedarf.
  6. In 2 U von RNase H, Flick zu mischen, und dann drehen, um zu sammeln.
  7. Inkubieren Sie 20 Minutenbei 37 ° C. Speicher cDNA bei -20 ° C.

5.3) cDNA Quantifizierung Mit qPCR-System

  1. Bereiten Sie eine Standardverdünnungsreihen. Do 10-fache serielle Verdünnung von 3 x 10 6 Kopien / pl bis zu 30 Kopien / pl, der pNL4-3VifA. Verwenden Sie destilliertes Wasser für Verdünnungen. Bereiten Sie die Standardverdünnungsreihen frisch vor Gebrauch oder bereiten Kleinserien und behalten bei -20 ° C. Nicht Einfrieren und Auftauen der Standards mehr als dreimal.
  2. Ein 96-Loch-qPCR Reaktionsplatte gesetzt. Sicherzustellen, dass jede Platte ein Duplikat jeder cDNA-Probe enthält mindestens ein Bohrloch von negativen Kontrollen, einer dreifachen der Standardverdünnungsreihe und wenigstens.
  3. Für jede qPCR Reaktion verwenden 12,5 ul qPCR Mastermix, 0,2 & mgr; M Sonde jeweils 0,8 uM der Vorwärts- und Rückwärts-Primer und 1 & mgr; l cDNA oder der Standardverdünnungsreihe oder Wasser / Puffer (für die Negativkontrolle). Fügen Sie Wasser bis zu einem Endvolumen von 25 ul. Der qPCR-Sonde ist leicht senempfindlichen. Halten Sie es in geschlossenen Behälter.
    1. Um cDNA aus pNL4-3VifA basierte molekulare Klon abgeleitet erfassen, verwenden Sie den Vifa Primer-Sonde: VifAB Vorwärtsprimer (GGTCTGCATACAGGAGAAAGAGACT), Vifa Rückwärts-Primer (5'-AGGGTCTACTTGTGTGCTATATCTCTTTT-3 ') und VifAB Sonde (6FAM-5'-CTCCATTCTATGGAGACTC-3 '-MGBNFQ). Für cDNA aus pNL4-3VifB basierend Klon abgeleitet, verwenden Sie die VIFB Primer-Sonde: VifAB Vorwärtsprimer, VifAB Sonde und VIFB Rückwärts-Primer (5'-CACCTGCGTGCTATACCTTTTCT-3 ').
  4. Eingestellt PCR Zyklusparameter auf 50 ° C für 2 min, 95 ° C für 10 min und 40 Zyklen von 95 ° C für 15 sec und 60 ° C für 1 min. Wenden Sie sich im Support-Dokument für den Betrieb der qPCR Maschine des Herstellers.
  5. Berechnen einer Standardkurve unter Verwendung von Daten aus der dreifachen Standardverdünnungsreihen. Vergleichen Verstärkungsdaten der cDNA-Probe mit der Standardkurve, um die Kopienzahl zu bestimmen. Wenden Sie sich im Support-Dokument des Herstellers für data Verarbeitung.

5.4) Bestimmen Sie Viral exponentiellen Wachstumsphase

  1. Plotten viralen Wachstumskinetik der Beprobungstag entlang der X-Achse und der cDNA-Kopienzahl in der Y-Achse und die Identifizierung der viralen exponentiellen Wachstumsphase, dh., Wenn die virale cDNA-Kopienzahlen in einer exponentiellen Zunahme Progression.
  2. Verwenden Sie die GRC Web-Tool ( http://indra.mullins.microbiol.washington.edu/grc/ ), virale Wachstumsrate (g) zu berechnen. In dieser Anmeldung wird der GRC Werkzeug akzeptiert cDNA-Kopienzahlen von mindestens zwei Zeitpunkte als Eingabe und gibt das Viruswachstum (g). Nur Zeitpunkt Daten innerhalb der exponentiellen Wachstumsphase (siehe Schritt 5.4.1 oben), um eine genaue Wachstumsraten zu erzielen. Für eine detaillierte Beschreibung des mathematischen Modells in der GRC Web-Tool verwendet werden, siehe 20.

6. Growth Competition Assay

  1. Saatgut 3 x 10 5 </ Sup> PHA-stimulierten PBMCs (oder 1 x 10 5 CEM × 174-Zellen) in 500 ul Gesamtvolumen pro Vertiefung einer 48-Loch-Flachbodenplatte.
  2. Halteplatte in 37 ° C in einem 5% CO 2 Atmosphäre bis Inokulation.
  3. Für jedes Virus, vorbereiten 3 ml Inokulum enthält 6.000 IE.
  4. Übertragen 1,5 ml jeder viralen Inokulum in ein steriles Röhrchen, das Doppelinfektion Inokulum zu schaffen. Gib 500 & mgr; l des Dual-Inokulum (1500 IU) bis 3 x 10 5 Zellen in einer 48-Well-Platte. Das endgültige Kulturvolumen beträgt 1 ml / Vertiefung. 200 ul Aliquot der Impfkultur auf zwei 96-Well-Platten für die RNA-Isolierung; speichern Sie eine Platte als Backup.
  5. Inokulierten Zellen bei 37 ° C mit 5% CO 2 -Atmosphäre für 16-24 Std.
  6. Wash Kulturen 16-24 h nach der Inokulation.
    1. Entfernen und entsorgen Sie 750 ul Kulturüberstand.
    2. In 750 ml frisches cIMDM. Wickeln Sie Platten in Plastikfolie und Spin für 10 Minuten bei 300 x g. Entfernen und entsorgen Sie 75081; l Überstand.
    3. In 750 ml frisches cIMDM. Inkubieren bei 37 ° C mit 5% CO 2 -Atmosphäre (Tag 1).
  7. Auswahl Abtastzeiten mindestens 3 Zeitpunkte innerhalb der in Schritt 5.4.1 beobachtet exponentiellen Wachstumsphase enthalten.
    1. Für jede Probenahme, folgen Sie Schritt 5.1.7.
  8. CDNA-Synthese durchzuführen, wie in Abschnitt 5.2 beschrieben.
  9. Bestimmen Sie die Virusvariante Verhältnis mit qPCR.
    1. Bereiten Sie einen standardmäßigen seriellen Verdünnungsreihe in dreifacher Ausfertigung, Verdünnung 10-fache in jedem Schritt von 3 x 10 6 Kopien / pl bis 30 Kopien / ul pNL4-3VifA.
    2. Ein 96-Loch-qPCR Reaktionsplatte gesetzt. Sicherzustellen, dass jede Platte mindestens eine negative Kontrolle, die Standardverdünnungsreihen in dreifacher Ausführung und Duplikate von jeder cDNA-Probe.
    3. Für jede qPCR Reaktion verwenden 12,5 ul qPCR Master Mix, 0,2 & mgr; M Sonde jeweils 0,8 uM der Vorwärts- und Rückwärtsprimer und 1 ul cDNA oder der Standard d ilution Serie oder Wasser / Puffer (für die negativen Kontrollvertiefungen). Fügen Sie Wasser bis zu einem Endvolumen von 25 ul. Der qPCR-Sonde ist lichtempfindlich, halten Sie es in geschlossenen Behälter.
      1. Verwenden die VIFA Primer-Sonde, um Signale in den Negativ-Kontrollen und der Standardverdünnungsreihe und mit einem Duplikat der cDNA-Probe zu detektieren. Verwenden Sie die VIFB Primer-Sonde mit der anderen Duplikat der cDNA-Probe.
    4. Eingestellt PCR Zyklusparameter auf 50 ° C für 2 min, dann 95 ° C für 10 min und dann 40 Zyklen von 95 ° C für 15 sec und 60 ° C für 1 min. Wenden Sie sich im Support-Dokument für den Betrieb der qPCR Maschine des Herstellers.
    5. Berechnen Sie die Standardkurve unter Verwendung Verstärkung Daten aus dem Standard-Verdünnungsreihe. Vergleichen Verstärkungsdaten der cDNA-Proben mit der Standardkurve zu Kopienzahl zu bestimmen. Wenden Sie sich im Support-Dokument für die Datenverarbeitung des Herstellers.
    6. Verwenden Sie die GRC Web-Tool (ol.washington.edu/grc/">http://indra.mullins.microbiol.washington.edu/grc/), um die relative virale Fitness (d) zu berechnen.
      ANMERKUNG: Das GRC Werkzeug akzeptiert cDNA Kopienzahl vorliegen oder Chromatogramm Peakhöhen von mindestens zwei Zeitpunkte als Eingabe und gibt die Netto-Wachstumsrate Differenz (d) zwischen den beiden Viren. Während das Werkzeug können die Netto-Wachstumsrate von zwei Zeitpunktdaten zu berechnen, ist es dringend, um Eingangsdaten von drei oder mehr Zeitpunkten empfohlen. Verwenden nur aus Zeitpunkten innerhalb der exponentiellen Wachstumsphase erhaltenen Daten (siehe Schritt 5.4), um genaue Wachstumsraten zu erhalten. Für eine detaillierte Beschreibung des mathematischen Modells in der GRC Web-Tool verwendet werden, siehe 20.
  10. Bestimmen Sie mit Hilfe viraler Verhältnisse Chromatogramm Spitzenhöhen
    1. PCR Amplifikation HIV-1 vif Fragmente, die die VifAB Sequenz-Tag mit VifFwd (5'-GAAAGAGACTGGCATTTGGGTCAGGG-3 '; HXB2 Positionen 5266 bis 5291) und VifRev Primer (5'-GTCTTCT GGGGCTTGTTCCATCTGTCC-3 '; HXB2 Positionen 5579 bis 5553).
      1. Für jede PCR-Reaktion verwendet 1 ul cDNA, 1x NH 4 Puffer, 1,5 mM MgCl 2, 0,2 mM dNTP, 2,5 U Taq-Polymerase und 0,45 & mgr; M von jedem Primer. Fügen Sie Wasser bis zu einem Endvolumen von 50 ul.
      2. Eingestellt PCR Zyklusparameter zu 3 Zyklen bei 94 ° C für 1 min, 55ºC für 1 min und 70ºC für 1 min, gefolgt von 34 Zyklen bei 94 ° C für 15 sec, 58 ° C für 30 sec, und 70 ° C für 1 min, und anschließend Halten bei 4 ° C.
    2. Reinige PCR-Produkte unter Verwendung des QIAquick PCR-Purification-Kit nach Vorschrift des Herstellers.
    3. Absenden gereinigten PCR-Produkte auf eine DNA-Sequenzierung Dienstleister für Sanger-Sequenzierung.
    4. Überprüfen Sie die durchschnittliche Lesequalitätsfaktor, der durch die Sequenzierung Service zur Verfügung gestellt werden sollen. Wenn die durchschnittliche Basis Anruf Genauigkeit von weniger als 85%, Redo-Schritt 6.10.1 bis 6.10.3
    5. Verwenden Sie das Web-Tool ChromatQuan (f="http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi">http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi ) um virale Verhältnis zu jedem Zeitpunkt zu berechnen. Das Werkzeug erfordert die Sequenz Trace-Datei (* .ab1) und die Sequenz 5 'zu der Nukleotidposition von Interesse. Das Instrument misst eine Peak-Intensität bei dem angegebenen Ort. Das Verhältnis der Peakintensität entspricht dem Verhältnis der beiden Viren (4B).
    6. Verwenden Sie die GRC Web-Tool ( http://indra.mullins.microbiol.washington.edu/grc/ ) und die aufgezeichneten Spitzenintensitäten als Eingabe für virale relativen Fitness (d) zu berechnen. 20 Siehe Schritt 6.10.6.

Representative Results

Um die Fitness Auswirkungen der einzelnen Aminosäureänderungen in HIV-1 Gag p24-Studie verwendeten wir Oligonukleotid-gerichtete Mutagenese, um Mutationen in ein pNL4-3 Plasmid, das die HIV-1-p24-Gen COTB 23,32,33 einzuführen. Virusstammlösungen wurden durch Transfektion von 293T-Zellen erzeugt, und nach 48 h geerntet. Wir schätzten die 50% Gewebekulturinfektionsdosis (TCID 50) jedes virale Stamm durch die Reed-Muench-Methode 31. Die TCID 50 des Prototyps und Mutantenviren reichten von 10. April - 10. MAI IU / ml (Abbildung 3a).

Die Wachstumskinetik der rekombinanten Viren wurden in PBMCs aus einem einzigen Spender bei einer MOI von 0,005 hergestellt. RT-qPCR wurde verwendet, um virale cDNA Kopienzahl täglich für sechs Tage zu messen. Alle Mutanten und Prototypen Viren wuchs exponentiell zwischen Tag 2 und Tag 4, wonach das virale Wachstum verlangsamt, wie durch eine verringerte Neigung der Virus-RNA-Kopienzahl erhöhen (angegeben <strong> 3B). Die Abnahme der cDNA-Kopienzahl zwischen Tag 0 (entsprechend dem Inokulum) und am Tag 2 aufgrund der Absorption von Virus an Zellen und die Entfernung von ungebundenem Virionen von Tag zu Tag 1 Wäsche (Schritt 5.1.6) ist. In der exponentiellen Wachstumsphase, hatten alle drei Mutanten eine langsamere Wachstumsrate (g) als das Prototyp-Virus (Abbildung 3c).

Alle drei Mutanten wurden gegenüber dem Prototyp-Virus in Wachstums Kompetitionsassays an insgesamt MOI von 0,005 konkurrierten. Virale Wachstumskinetik in doppelt infizierten Kulturen waren ähnlich der Monoinfektion; das virale exponentiellen Wachstumsphase wurde zwischen den Tagen 2 und 4 und das Viruswachstum ein Plateau um Tag 5 (4A).

Virale Wachstum Unterschiede wurden aus der Änderung in der viralen Verhältnis über die Zeit abgeleitet wird. Die virale Verhältnis wurde auf Basis von cDNA Kopienzahl der Referenz und den mutierten Viren unter Verwendung von RT-qPCR, und durch Vergleichen Spitzenhöhen berechnetnacheinander Chromatogramme bei Nukleotid Sites Unterscheidung der zwei Viren (4B). Die Wachstumsdifferenzen unter Verwendung des Spitzenhöhe und Virus-RNA-Kopienzahl Methoden ergab ähnliche Ergebnisse (4C). Alle drei Mutanten hatten niedrigere Replikation Fitness als die Prototypen-Viren mit dem mutierten I256V mit der niedrigsten Fitness (4C).

Abbildung 1
Abbildung 1: Flussdiagramm der Protokolle in diesem Papier Das Virus Vorbereitung Protokolle Sorge Bau von HIV-1 rekombinanten Klonen und die Erzeugung von Virusbestände.. Der Fitness-Assays Protokolle sind für die Festlegung virale Wachstum Kinetik und Bestimmung der relativen viralen Fitness. Gestrichelten Linien alternative Strömungen für die Protokolle. Zum Beispiel kann eine Mutation direkt in HIV-1 NL4-3 eingeführt werdenmolekularen Klon ohne Erzeugung eines rekombinanten Klons.

Figur 2
Abb. 2: Der Bau der HIV-1 NL4-3 COTB Gag-p24 rekombinante molekulare Klone mit Overlap-Extension-PCR (A) Gestalten Sie die chimären Primer. Die 5'-Hälften der Primer enthalten die NL4-3 Vektorsequenz und dem 3'-Hälften enthalten die Enden des Einsatzes Folge. (B) chimäre Primer werden verwendet, um die Insertfragment, COTB Gag-p24 zu verstärken. (C) Die Insert-Fragmente als Primer für eine zweite PCR verwendet, um ein neues rekombinantes Plasmid zu erzeugen.

Figur 3
Abb. 3: Viral Wachstumseigenschaften in PBMCs (A) Log 10 TCID 50 (B) Viral Wachstumskinetik in Monoinfektionen bei einer MOI = 0.005 begonnen. (C) Viral Wachstumsraten über sechs Tagen, einschließlich der exponentiellen Wachstumsphase (Tage 2-4) von der Platte (B) abgeleitet ist. Die gezeigten Werte stellen den Durchschnitt von drei Replikaten von einem Experiment. Die Fehlerbalken stellen 95% Konfidenzintervall.

Figur 4
Abbildung 4: Viral Wachstum und relative Fitness-Bestimmungen (A) das virale Wachstum in doppelt infizierten PBMC-Kulturen.. (B) Verhältnisse von T242N und Prototypen Viren bestimmt mittels RT-qPCR oder die Sequenzierung Spitzenhöhe Methode. (C) Net virale Wachstum Unterschiede (d) zwischen der Mutante und der Prototyp-Viren in doppelt infizierten Kulturen, wie in (A) gezeigt. d Werte f berechnetROM Die in (B) gezeigt, virale Verhältnisdaten. Die gezeigten Werte stellen den Durchschnitt von drei Replikaten von einem Experiment. Die Fehlerbalken stellen 95% Konfidenzintervall.

Discussion

Die vorgestellten Protokolle bestand aus zwei Hauptteilen: Konstruktion von rekombinanten HIV-1 molekularen Klonen und Wachstum Kompetitionsassays. Um zwei Viren in einer doppelt infizierten Zellkultur zu unterscheiden, ist es wichtig, dass die konkurrierenden molekulare Klone enthalten Sequenz-Tags, die durch eine RT-qPCR-Primer-Sonden-Tests oder durch die Sanger-Sequenzierung nachgewiesen werden kann. Dieses Protokoll verwendet die VIFA und VIFB Tags, welche den gleichen Bereich von HIV-1 NL4-3 vif zu besetzen und codieren die gleiche Aminosäuresequenz, unterscheiden sich jedoch von sechs auch Mutationen. Diese Mutationen zeigten keine Auswirkungen auf virale Replikation Fitness 20. Die in diesem Protokoll verwendeten PCR-basierten Klonierungsverfahren bietet mehr Flexibilität bei der Auswahl der Klonierungsstellen, im Vergleich zu basierte Klonen Restriktionsstelle. Allerdings nimmt die Effizienz der PCR-Klonierung wie die Insertgröße zunimmt. Die Stromgrenze des Einsatzes Größe ist ~ 5 kb 34. Für die PCR-basierte Klonen und die Website geleitet mutagenesis, ist die Verwendung eines High-Fidelity-DNA-Polymerase entscheidend, um die Wahrscheinlichkeit von zusätzlichen Mutationen, zu verringern. Verwendung der minimalen Anzahl von PCR-Zyklen erforderlich, um ausreichende Mengen an Produkten zu ergeben wird auch empfohlen. Nach unserer Erfahrung haben wir keine zusätzlichen Mutationen nach den hier beschriebenen PCR-basierte Klonen und ortsgerichtete Mutagenese Schritte zu erkennen. Dennoch sollte die PCR-Produkte sequenziert, um für jegliche unerwünschte Mutationen zu überprüfen. Idealerweise sollte die gesamte HIV kodierende Region erneut sequenziert werden.

Mindestens drei Abtastzeitpunkte innerhalb der exponentiellen Wachstumsphase 9 untersucht werden. Die viralen Wachstumskinetik muss zuvor mit täglichen Probenahme, um die entsprechenden Kulturdauer und Abtastzeitpunkte für das Wachstum Wettbewerb festzustellen, festgelegt werden. Ein Faktor, der die virale Wachstumskinetik beeinflusst, ist die Multiplizität der Infektion (MOI). Dieses Protokoll verwendet insgesamt MOI von 0,005 für beide Monoinfektion und Wachstum Wettbewerb, wie es dargestellt wurde, um mehr zu erhalten roBüste Ergebnisse als untere MOIs 9. Dennoch kann unteren MOIs verwendet werden, um eine längere Phase exponentiellen Wachstums falls erforderlich zu erhalten, aber auf Kosten der Folge Konsistenz. Dieses Protokoll legt eine erste Infektion Verhältnis von 50:50, unter der Annahme, dass das Fitness Unterschiede der Viren sind in der Regel nicht im voraus. Die Verwendung von ungleichen Eingangsverhältnisse sind jedoch geeignet, wenn es vorläufige Daten, die auf signifikante Unterschiede in der Kinetik der viralen Replikation. In diesen Fällen ist eine Infektion von 70:30 empfohlen, für die Erfassung eines großen Fitness Unterschied wo die weniger fit Virus im Überschuß 9 platziert ermöglichen.

Das Protokoll für die Bestimmung der TCID 50, virale Wachstumskinetik und zur Durchführung der Wachstums Kompetitionstests wurden optimiert unter Verwendung von HIV-1 Subtyp B haben NL4-3 COTB-p24 und PBMCs von einem einzelnen Spender, deren PBMC konsistent Empfindlichkeit nachgewiesen, HIV- 1-Infektion in vitro. Die Kulturzeitund Abtastzeitpunkten in diesem Protokoll dargestellt sind wahrscheinlich für das Studium von HIV-1 Gruppe M-Viren in menschlichen PBMCs sein. Verwenden von PBMCs aus einer Hand ist sehr zu empfehlen, um konsistente Ergebnisse zu erhalten, wie die Virusreplikation in verschiedenen Spenderzellen 35 variieren. Obwohl weniger wünschenswert, kann PBMCs von mehreren Spendern gebündelt eingesetzt werden als Ersatz zur Verfügung gestellt, dass der gleiche Pool ist in allen Versuchen verwendet. Eine weitere Alternative ist die Verwendung von Zelllinien. Die hier vorgestellte Protokoll wurde erfolgreich mit der T-Zelllinie CEM × 174 23,36 verwendet. Es ist jedoch wichtig, dass die Anzahl von Zellen ausgesät werden neu optimiert werden, um konsistente Zellwachstum zu erzielen. Viral Wachstumskinetik muss auch wieder hergestellt werden, da sie wahrscheinlich in verschiedenen Zelllinien variieren, um die entsprechenden Abtastzeitpunkten in den Wachstums Wettbewerb Schritte zu bestimmen.

Zwei verschiedene Methoden, um die virale Verhältnis zur Berechnung Fitness zu bestimmen sind in der Protok inbegriffenol. Die erste nutzt RT-qPCR, um virale cDNA Kopienzahl zu jedem Probenahmezeitpunkt zu messen. Virusreplikation Fitness wurde dann aus dem viralen Verhältnisses berechnet, basierend auf cDNA-Kopie-Nummer. Alternativ kann die virale Verhältnis basierend auf dem Verhältnis der Peakhöhe bei Chromatogramm der VifAB tag Sites bestimmt werden. Die beiden Verfahren ergab vergleichbare Ergebnisse (Figur 4). Das Chromatogramm-Peakhöhe Verfahren auf andere HIV-1-Stämme ohne konstruiert Sequence Tag angewendet werden. Für RT-qPCR, die Verwendung von Primern oder Sonden zu Virusvarianten unterscheiden muss zunächst sorgfältig geprüft werden (siehe 20). Dennoch bietet RT-qPCR bessere Empfindlichkeit für Proben mit einer geringen Menge an viraler RNA, wie die von dem ersten Zeitpunkt in der exponentiellen Wachstumsphase. Direkte Messung der viralen cDNA ermöglicht auch Detektions technischer Probleme, die von der RNA-Extraktion und cDNA-Synthese entstehen können. Mit molekular Klone mit Sequenz-Tags bietet eine kostengünstige Lösung to die RT-qPCR Verfahren, da nur zwei Paare von Primern und Sonden benötigt werden, um mehrere Viren zu studieren. Diese Strategie vermeidet auch das Problem der Spitzenhöhenvariation nacheinander Chromatogramme durch benachbarte Basen 37, die Sequenzierung wird an der gleichen Stelle für alle Viren in der Studie durchgeführt. Die für die RT-qPCR und Sanger-Sequenzierung hergestellt PCR-Produkte können auch Verwendung bei anderen Methoden zur viralen Verhältnis zu bestimmen, wie Schütt Sequenzierung von einzelnen Klonen 12,13 HTA 4,7,17,19 oder Oligonukleotid-Ligation-Assay (OLA) 38 .

Disclosures

Die Autoren erklären, dass sie keine konkurrierenden finanziellen Interessen. Die hier geäusserten Meinungen sind diejenigen der Autoren und sind nicht als offizielle oder repräsentieren die Ansichten des US Department of Defense oder die Abteilung der Armee aufgefasst werden.

Materials

Name Company Catalog Number Comments
Construction of recombinant clones
Chimeric primer/Mutagenic/Sequencing primers IDT Custom DNA oligos
pNL4-3VifA and pNL4-3VifB plasmid Please contact Dr. James I Mullins (jmullins@uw.edu)
High-Fidelity DNA polymerase Thermo Scientific F-549S
High-fidelity buffer Thermo Scientific F-549S
dNTP Bioline Bio-39026
Thermal cycler Life Technologies Applied Biosystems® GeneAmp® PCR System 9700
DNA loading dye Thermo Scientific R0631
1 kb Plus DNA ladder Invitrogen 10787-018
QIAquick PCR Purification Kit Qiagen 28104
QIAquick gel extraction kit Qiagen 28704
DpnI enzyme New England Biolabs R0176S
TOP10 chemically competent Escherichia coli Invitrogen C4040-10
Luria Broth base powder Invitrogen 12795-084
Carbenicillin Research Products International C46000-25.0
QIAprep Spin Miniprep kit  Qiagen 27104
EndoFree Plasmid Maxi Kit Qiagen 12362
Transfection
X-tremeGENE 9 DNA transfection reagent Roche 6365787001
HEK 293T-17 ATCC CRL-11268 http://www.atcc.org/
0.22 μm filter top tube VWR International 89220-716 
Cell culture
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 10566016
Iscove′s Modified Dulbecco′s Medium (IMDM) Life Technologies 31980-030
RPMI-1640 media Life Technologies 61870-036
Phytohemagglutinin (PHA) Thermo Scientific R30852801
Human Interleukin-2 Roche 11147528001
Fetal bovine serum JR Scientific 43640
Penicillin and Streptomycin Corning Cellgro 30-001-CI
6 well plate VWR Scientific 73520-906
48 well plate VWR Scientific 62407-338
96 well flat-bottomed plate ISC Bioexpress T-3015-4
96 well round-bottomed plate BD Falcon 353077
1.5 ml Microcentrifuge Tube Mt. Baker Bio MBD-1500
1.5 ml tubes w/ O-ring VWR Scientific 89004-290
50 ml conical tube ISC Bioexpress C-3317-6
ELISA
Triton-X 100 Sigma-Aldrich X100
Phosphate buffer saline (PBS) Invitrogen 14190-250
Fetal bovine serum (FBS) Sigma-Aldrich F0392
glycerol Sigma-Aldrich G5516
Tween 20 Sigma-Aldrich P1379
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153
Rabbit anti-HIV-1 SF2 p24 antiserum NIH AIDS Reagent Program 4250
Goat anti-rabbit HRP KPL 474-1516
TMB Microwell Peroxidase Substrate KPL 52-00-01
H2SO4 Fisher Scientific A300-500 Causes severe burns by all exposure routes. Use personal protective equipment. Use only under a chemical fume hood. Wash off immediately with plenty of water for at least 15 min.
HIV p24 standard AIDS and Cancer Virus program (NCI-Frederick) For order details please contact Julian Bess, Jr. (bessjw@mail.nih.gov); http://ncifrederick.cancer.gov/Programs/Science/Acvp/bio/Bess.aspx
Microplate reader Molecular Devices VMax Kinetic ELISA Microplate Reader
RNA isolation cDNA synthesis
QIAxtractor Qiagen http://www.qiagen.com/products/catalog/automated-solutions/sample-prep/qiaxtractor
QIAamp Viral RNA Mini Kit Qiagen 52906
dNTP Bioline Bio-39026
SuperscriptIII Invitrogen 18080-085
First-strand buffer  Invitrogen 18080-085
Dithiothreitol (DTT) Invitrogen 18080-085
Rnase inhibitor Roche 3335402001
RnaseH Invitrogen 18021-071
qPCR
Real-time qPCR machine Life Technologies Applied Biosystems 7300 Real-Time PCR 
TaqMan® Gene Expression Master Mix Life Technologies 4369016
Forward, reverse primer IDT Custom order
Probe Life Technologies Custom order
optical 96 well reaction plate Life Technologies I19N3Q216
PCR+sequencing
Taq DNA polymerase (Biolase) Bioline Bio-21043
NH4 buffer  Bioline Bio-21043
MgCl2 Bioline Bio-21043
Sequencing primer IDT Custom order
QIAxcel Qiagen http://www.qiagen.com/products/catalog/automated-solutions/detection-and-analysis/qiaxcel-advanced-system
DNA sequencing service provider http://www.htseq.org/
GRC web tool http://indra.mullins.microbiol.washington.edu/grc/
ChromatQuan web tool http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi

DOWNLOAD MATERIALS LIST

References

  1. Domingo, E., Holland, J. J. RNA virus mutations and fitness for survival. Annu Rev Microbiol. 51, 151-178 (1997).
  2. Domingo, E. Mechanisms of viral emergence. Veterinary research. 41, (6), 38 (2010).
  3. Martinez-Picado, J., Martinez, M. A. HIV-1 reverse transcriptase inhibitor resistance mutations and fitness: a view from the clinic and ex vivo. Virus Res. 134, (1-2), 104-123 (2008).
  4. Troyer, R. M. Variable fitness impact of HIV-1 escape mutations to cytotoxic T lymphocyte (CTL) response. PLoS Pathog. 5, (4), e1000365 (2009).
  5. Rolland, M. Amino-acid co-variation in HIV-1 Gag subtype C: HLA-mediated selection pressure and compensatory dynamics. PLoS One. 5, (9), e12463 (2010).
  6. Abraha, A. CCR5- and CXCR4-tropic subtype C human immunodeficiency virus type 1 isolates have a lower level of pathogenic fitness than other dominant group M subtypes: implications for the epidemic. J Virol. 83, (11), 5592-5605 (2009).
  7. Quinones-Mateu, M. E. A dual infection/competition assay shows a correlation between ex vivo human immunodeficiency virus type 1 fitness and disease progression. J Virol. 74, (19), 9222-9233 (2000).
  8. Ball, S. C. Comparing the ex vivo fitness of CCR5-tropic human immunodeficiency virus type 1 isolates of subtypes. B and C. J Virol. 77, (2), 1021-1038 (2003).
  9. Lanxon-Cookson, E. C. Factors affecting relative fitness measurements in pairwise competition assays of human immunodeficiency viruses. J Virol Methods. 194, (1-2), 7-13 (2013).
  10. Garcia-Lerma, J. G., MacInnes, H., Bennett, D., Weinstock, H., Heneine, W. Transmitted human immunodeficiency virus type 1 carrying the D67N or K219Q/E mutation evolves rapidly to zidovudine resistance in vitro and shows a high replicative fitness in the presence of zidovudine. J Virol. 78, (14), 7545-7552 (2004).
  11. Sharma, P. L., Crumpacker, C. S. Attenuated replication of human immunodeficiency virus type 1 with a didanosine-selected reverse transcriptase mutation. J Virol. 71, (11), 8846-8851 (1997).
  12. Martinez-Picado, J., Savara, A. V., Sutton, L., D'Aquila, R. T. Replicative fitness of protease inhibitor-resistant mutants of human immunodeficiency virus type 1. J Virol. 73, (5), 3744-3752 (1999).
  13. Wang, J. The HIV-1 reverse transcriptase mutants G190S and G190A, which confer resistance to non-nucleoside reverse transcriptase inhibitors, demonstrate reductions in RNase H activity and DNA synthesis from tRNA(Lys, 3) that correlate with reductions in replication efficiency. Virology. 348, (2), 462-474 (2006).
  14. Song, H. Impact of immune escape mutations on HIV-1 fitness in the context of the cognate transmitted/founder genome. Retrovirology. 9, (89), (2012).
  15. Ali, A., Yang, O. A novel small reporter gene and HIV-1 fitness assay. Journal of Virological Methods. 133, (1), 41-47 (2006).
  16. Maarseveen, N. M. A novel real-time PCR assay to determine relative replication capacity for HIV-1 protease variants and/or reverse transcriptase variants. J Virol Methods. 133, (2), 185-194 (2006).
  17. Liu, Y. Evolution of human immunodeficiency virus type 1 cytotoxic T-lymphocyte epitopes: fitness-balanced escape. J Virol. 81, (22), 12179-12188 (2007).
  18. Anastassopoulou, C. G., Ketas, T. J., Klasse, P. J., Moore, J. P. Resistance to CCR5 inhibitors caused by sequence changes in the fusion peptide of HIV-1 gp41. Proc Natl Acad Sci U S A. 106, (13), 5318-5323 (2009).
  19. Abraha, A., Troyer, R. M., Quinones-Mateu, M. E., Arts, E. J. Methods to determine HIV-1 ex vivo fitness. Methods Mol Biol. 304, 355-368 (2005).
  20. Liu, Y. A sensitive real-time PCR based assay to estimate the impact of amino acid substitutions on the competitive replication fitness of human immunodeficiency virus type 1 in cell culture. J Virol Methods. 189, (1), 157-166 (2013).
  21. Brumme, Z. L. Reduced replication capacity of NL4-3 recombinant viruses encoding reverse transcriptase-integrase sequences from HIV-1 elite controllers. J Acquir Immune Defic Syndr. 56, (2), 100-108 (2011).
  22. Nomura, S. Significant reductions in Gag-protease-mediated HIV-1 replication capacity during the course of the epidemic in. Japan. J Virol. 87, (3), 1465-1476 (2013).
  23. Rolland, M. HIV-1 conserved-element vaccines: relationship between sequence conservation and replicative capacity. J Virol. 87, (10), 5461-5467 (2013).
  24. Martinez-Picado, J. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. J Virol. 80, (7), 3617-3623 (2006).
  25. Brockman, M. A. Escape and Compensation from Early HLA-B57-Mediated Cytotoxic T-Lymphocyte Pressure on Human Immunodeficiency Virus Type 1 Gag Alter Capsid Interactions with Cyclophilin A. J Virol. 81, (22), 12608-12618 (2007).
  26. Miura, T. HLA-associated alterations in replication capacity of chimeric NL4-3 viruses carrying gag-protease from elite controllers of human immunodeficiency virus type 1. J Virol. 83, (1), 140-149 (2009).
  27. Basic Methods in Cellular and Molecular Biology, PCR: The Polymerase Chain Reaction. JoVE. Cambridge, MA. Available from: http://www.jove.com/science-education/5056/pcr-the-polymerase-chain-reaction (2014).
  28. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments : JoVE. 62, (Apr 20), (2012).
  29. Basic Methods in Cellular and Molecular Biology, Restriction Enzyme Digests. JoVE. Cambridge, MA. Available from: http://www.jove.com/science-education/5070/restriction-enzyme-digests (2014).
  30. McClure, J., van't Wout, A. B., Tran, T., Mittler, J. E. Granulocyte-monocyte colony-stimulating factor upregulates HIV-1 replication in monocyte-derived macrophages cultured at low density. J Acquir Immune Defic Syndr. 44, (3), 254-261 (2007).
  31. Reed, L. J., Muench, H. A simple method of estimatingfifty percent endpoints. Am J Hyg. 27, (3), 493-497 (1938).
  32. Nickle, D. C. Consensus and ancestral state HIV vaccines. Science. 299, (5612), 1515-1518 (2003).
  33. Rolland, M. Reconstruction and function of ancestral center-of-tree human immunodeficiency virus type 1 proteins. J Virol. 81, (16), 8507-8514 (2007).
  34. Bryksin, A. V., Matsumura, I. Overlap extension PCR cloning: a simple and reliable way to create recombinant plasmids. Biotechniques. 48, (6), 463-465 (2010).
  35. Spira, A. I., Ho, D. D. Effect of different donor cells on human immunodeficiency virus type 1 replication and selection in vitro. J. Virol. 69, (1), 422-429 (1995).
  36. Manocheewa, S., Swain, J. V., Lanxon-Cookson, E., Rolland, M., Mullins, J. I. Fitness costs of mutations at the HIV-1 capsid hexamerization interface. PLoS One. 8, (6), e66065 (2013).
  37. Zakeri, H., Amparo, G., Chen, S. M., Spurgeon, S., Kwok, P. Y. Peak height pattern in dichloro-rhodamine and energy transfer dye terminator sequencing. Biotechniques. 25, (3), 406-410 (1998).
  38. Lalonde, M. S. Sensitive oligonucleotide ligation assay for low-level detection of nevirapine resistance mutations in human immunodeficiency virus type 1 quasispecies. J Clin Microbiol. 45, (8), 2604-2615 (2007).
Paarweise Wachstum Wettbewerb Assay zur Bestimmung der Replication Fitness von Human Immunodeficiency Viruses
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Manocheewa, S., Lanxon-Cookson, E. C., Liu, Y., Swain, J. V., McClure, J., Rao, U., Maust, B., Deng, W., Sunshine, J. E., Kim, M., Rolland, M., Mullins, J. I. Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses. J. Vis. Exp. (99), e52610, doi:10.3791/52610 (2015).More

Manocheewa, S., Lanxon-Cookson, E. C., Liu, Y., Swain, J. V., McClure, J., Rao, U., Maust, B., Deng, W., Sunshine, J. E., Kim, M., Rolland, M., Mullins, J. I. Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses. J. Vis. Exp. (99), e52610, doi:10.3791/52610 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter