Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Crecimiento por parejas Ensayo de competición para determinar la aptitud de replicación de virus de inmunodeficiencia Humanos

doi: 10.3791/52610 Published: May 4, 2015

Introduction

Aptitud La replicación viral se define como la capacidad de un virus para producir progenie infecciosa en un ambiente dado 1 y es un importante factor que contribuye a determinar la prevalencia de una variante del virus en la población a través del tiempo 2. Al igual que en estudios in vivo de la aptitud no son factibles con virus patógenos humanos, como el VIH-1, varios in vitro y ex vivo ensayos de aptitud de replicación se han desarrollado para estudiar los efectos sobre la aptitud derivadas de resistencia a los medicamentos y las mutaciones de escape inmune, epistasis y la evolución de las poblaciones virales 3-6. Entre los diferentes ensayos de aptitud, ensayos de competición de crecimiento se reconocen para producir medidas más sensibles y válidos de diferencias de aptitud, como dos o más variantes virales compiten por la misma población celular bajo exactamente las mismas condiciones ambientales, como ocurre en vivo 1,7,8. Antes de comenzar los experimentos de competición de crecimiento, varios variables necesita ser determinado, incluyendo el uso de diferentes multiplicidades de infección (MOI), la relación de entrada viral, y el tiempo de muestreo para el análisis. Hemos estudiado los efectos de estos parámetros en la cinética de crecimiento virales y sobre los resultados de los experimentos de competición, y hemos identificado los factores clave necesarios para las mediciones robustas de VIH-1 de la aptitud en el cultivo celular 9.

Además de las variables de ensayo, hay una variedad de métodos para la cuantificación de variantes virales en experimentos de competición crecimiento. Bulk 10,11 o 12,13 secuenciación clonal se ha utilizado para determinar la relación de los virus que compiten sobre la base de las frecuencias de nucleótidos en el sitio (s) de interés. Aptitud relativa se deriva de cambios en esta relación con el tiempo. Este método es conveniente como servicios de secuenciación de ADN están ampliamente disponibles. El método (PASS) específica de alelo secuenciación paralela permite la secuenciación en múltiples sitios y la detección de recombinantes 14 15 o sinónimo mutaciones 4,16-18 como etiquetas para distinguir los virus que compiten por la secuenciación, análisis de seguimiento de heterodúplex (HTA) 4,7,17,19 o revertir en tiempo real de reacción en cadena de la polimerasa con transcripción cuantitativa (RT-qPCR) 15,16,18,20, todos los cuales pueden ser aplicables para estudiar cepas competir independientemente de similitud de secuencia. Se requiere un paso adicional para introducir etiquetas en los genomas virales y el ensayo de RT-qPCR también requiere reactivos e instrumentación específicos. Hemos encontrado que los rendimientos de secuenciación de Sanger a granel resultados comparables 9.

A raíz de la competencia el crecimiento, la aptitud replicación viral se presenta como la aptitud relativa, o una relación de la aptitud entre two variantes virales. La aptitud relativa de un virus se puede definir como la proporción final de una variante viral normalizado por su proporción en el inóculo inicial o como la diferencia tasa de crecimiento neto entre los dos virus en competencia. Hemos encontrado que el último método, usando puntos de datos longitudinales sólo dentro de la fase de crecimiento exponencial, produjo los resultados más robustos 9,20.

En ensayos in vitro de la aptitud se utilizan principalmente para estudiar clones biológicos 6-8 y clones moleculares infecciosos del VIH-1. Este último, al ser susceptibles de manipulación genética, se emplean a menudo para estudiar el efecto sobre la aptitud de mutaciones particulares o secuencias específicas de interés 3-5,21,22. Los siguientes protocolos describen un flujo de trabajo desde el punto de construcción de nuevo de larga duración infecciosas del VIH-1 clones moleculares usando 1-VIH vectores que contienen una etiqueta de secuencia, la introducción de mutaciones de interés, por lo que las poblaciones virales y el establecimiento de la cinética de crecimiento virales, Para realizar el ensayo de competición crecimiento y el cálculo de la aptitud relativa (Figura 1).

El uso de nuestros procedimientos optimizados, creamos tres recombinantes del VIH-1 mutantes y se determinó su estado físico replicación. El clon molecular recombinante se construyó primero mediante la sustitución del VIH-1 gag-p24 región del gen de pNL4-3, un plásmido que contiene una longitud de genoma completo infeccioso del VIH-1 NL4-3 cepa de laboratorio, con un COTB sintético (Center-cina Árbol, subtipo B) secuencia gag-p24 23 para crear la cepa prototipo. Cambios aminoácidos individuales (T186M, T242N, y I256V) se introdujeron a continuación para crear tres clones mutantes. Cada mutante se compitió contra el virus prototipo para observar el impacto de la aptitud de cada mutación en el fondo genético determinado. Los tres mutantes demostraron diferentes niveles de fsitness replicación de leve a significativamente menor que el virus prototipo. La mutación T242N se informó anteriormente para tener un fitne moderadass cuesta 24-26, similar al resultado se muestra en este estudio. El costo de la aptitud de las otras dos mutaciones no había sido informado previamente.

Protocol

NOTA: El protocolo, como se describe a continuación, no incluye ninguna información de identificación del paciente y por lo tanto no se considera Sujetos Humanos de Investigación por la Junta de Revisión Institucional de la Universidad de Washington o la División de Sujetos Humanos.

1. Construcción de quimérico VIH-1 NL4-3 clones moleculares

1.1) Amplify inserto de ADN Fragmento

  1. Diseñar cebadores quiméricos. Mitades 5 'de ambos adelante y atrás primers contienen una secuencia de VIH-1 vector, en la que se inserta el fragmento. El "medio de los cebadores 3 debe contener el final de la secuencia de inserción (Figura 2). Asegúrese de que la secuencia del cebador quimérico conserva los marcos originales de lectura abierta.
    1. Utilice cebadores al menos 20 bases de longitud, con una temperatura de fusión mayor que o igual a 60 ° C, ~ 50% de contenido de GC, y una baja tendencia a formar dímeros de cebadores, heterodímeros y / o estructuras de horquilla. Evaluar estas propiedadesutilizando la herramienta web OligoANALYZER ( https://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ ).
  2. Uso PCR 27 y los cebadores quiméricos para amplificar el ADN de inserción (Figura 2). Para cada reacción de PCR, utilice 1X tampón de alta fidelidad, dNTPs 0,2 mM, 1 U de ADN polimerasa de alta fidelidad, 0,5 M de cebador quimérico hacia delante, 0,5 M de cebador quimérico inversa y 1 PG0 ng de muestra de ADN región que lleva inserto. Añadir dH 2 O hasta un volumen final de 50 l.
  3. Conjunto pasos de ciclos térmicos como sigue: realizar un paso de desnaturalización inicial del ADN a 98 ° C durante 10 seg. Amplificar con 30 ciclos de desnaturalización del ADN a 98 ° C durante 10 seg y el ADN recocido a 3 ° C por encima de la temperatura de fusión más bajo de los dos cebadores para 20 seg. Realice una extensión final a 72 ° C durante 10 min. Guarde los productos de PCR a 4 ° C.
  4. Tome 5 l de los productos de PCR de lapaso anterior y correr la electroforesis en gel de agarosa 28.
    1. Utilice un gel de agarosa al 0,7%, tampón 1x TAE (40 mM Tris-acetato, EDTA 1 mM), 0,5 g / ml de bromuro de etidio (EtBr) concentración final y la escalera 1 kb como el marcador de tamaño de ADN. Set voltaje de la fuente de alimentación a 5 V / cm de distancia entre los electrodos. Detener la electroforesis cuando el colorante de carga migra a través de aproximadamente 2/3 de la longitud del gel. Visualizar el gel usando un sistema de documentación de gel 28.
      NOTA: EtBr es un carcinógeno y debe desecharse de forma adecuada, según los reglamentos de la institución. Guantes deben ser usados ​​siempre al manipular geles que contienen EtBr. Cambiar a guantes nuevos después EtBr manejo acabado que contiene el material y antes de manipular otros materiales o equipos para evitar la contaminación cruzada.
  5. Si se detecta una sola banda de ADN con el tamaño correspondiente al producto de PCR deseado, purificar el resto del producto de PCR utilizando un kit comercial tal como kit de purificación QIAquick PCR acuerdoing con los protocolos del fabricante.
    1. Si otras bandas, no específicos también están presentes, utilizar el resto del producto de PCR para funcionar electroforesis en gel preparativa. Utilice los mismos parámetros y condiciones que se especifican en el paso 1.1.4. Asegúrese de que el gel así es lo suficientemente grande para cargar ~ 45 l de productos de PCR. Cortar la banda de interés y extraer el ADN del gel usando el kit de extracción de gel QIAquick de acuerdo con los protocolos del fabricante.

1.2) Introducir la inserción del fragmento en integral infecciosa del VIH-1 subtipo B vectorial (pNL4-3)

  1. Use productos de PCR purificados a partir del paso 1.1.5 como cebadores de PCR. Utilice pNL4-3VifA 20 como ADN molde en una reacción de PCR y el uso de pNL4-3VifB 20 como plantilla en la otra reacción (Figura 2). Para cada reacción de PCR, utilice tampón de alta fidelidad 1x, dNTPs 0,2 mM, 2 U de ADN polimerasa de alta fidelidad, 500 ng de ADN cebador y 50 ng de ADN molde en un vol definitivaume de 50 l. Ajuste los parámetros de ciclo térmico a: 98 ° C durante 30 seg, 35 ciclos a 98 ° C durante 10 seg, 48 ° C durante 1 min y 72 ° C durante 10 min, seguido de 72 ° C durante 10 min.
  2. Añadir 10 U de Dpn I a 50 l de la reacción PCR y se incuba a 37 ° C durante 1 hora para digerir la plantilla de ADN. Asegúrese de que el ADN plasmídico se aisló de una cepa bacteriana competente metilación, por ejemplo., Escherichia coli TOP10 químicamente competente.
  3. Uso Dpn I digerido producto para transformar células bacterianas competentes. Utilice la transformación de choque térmico con TOP10 químicamente competente E. coli, de acuerdo con el protocolo del fabricante. Para seleccionar las células bacterianas que contienen el plásmido recombinante, utilice Luria Broth (LB) placas de cultivo que contienen 100 mg / L de carbenicilina.
    1. Escoja ~ 10 colonias bien separadas y crecer cada uno por separado en medio líquido LB que contenía 3 ml 100 mg / L de carbenicilina y se incuba a 30 ° C en unaagitador O / N.
    2. Utilice kit QIAprep Spin Miniprep para aislar ADN de plásmido a partir del cultivo líquido bacteriana, de acuerdo con el protocolo del fabricante.
  4. Utilice la digestión de restricción doble 29 para determinar si el ADN plásmido contiene el inserto correcto. Asegúrese de que uno de los sitios de restricción sólo existe dentro de la región de inserción y el otro sitio de restricción existe sólo una vez en el vector de VIH-1, fuera de la región de inserción.
    1. Recopilación de al menos 300 ng de ADN plásmido en un volumen final de reacción de 10 l. Seleccione buffers de restricción, temperatura de incubación y tiempo de incubación de acuerdo con el protocolo del fabricante de las enzimas de restricción seleccionadas. Tome 9 l del ADN y electroforesis en gel de ejecución digerido como se describe en el paso 1.1.4. Seleccionar plásmidos recombinantes que tienen bandas de ADN de los tamaños predichos.
  5. Confirmar secuencia de la integridad de los plásmidos recombinantes mediante secuenciación de Sanger. Aunque es poco común, no deseadosmutación (s) puede ser introducida durante las reacciones de PCR.
    1. Secuencia de ambas cadenas del ADN plasmídico. Siga las instrucciones en el paso 1.1.1.1 para diseñar cebadores de secuenciación. Además, asegurar que el avance y retroceso cebadores de secuenciación recocido al menos 50 pb aguas arriba y aguas abajo de la región de inserción en el plásmido recombinante, respectivamente.
    2. Presentar ADN plásmido y cebadores de secuenciación a un proveedor de servicios de secuenciación de ADN comercial. Preparar la muestra de ADN y los cebadores según lo especificado por el proveedor de servicios.
  6. Hacer un stock de libre de endotoxina del ADN plásmido mutado utilizando un kit de ADN de plásmido libre de endotoxinas de acuerdo con el protocolo del fabricante. Preparar al menos 1 g de ADN de plásmido libre de endotoxinas para la transfección en el siguiente paso.

1.3) Introducir pequeña escala mutaciones Via mutagénesis dirigida

  1. Diseñar cebadores mutagénicos con la superposición de cebadores directo e contienen el mutat deseada revertirion (s). Coloque la base (s) a ser sustituido, insertado o eliminado en medio de los cebadores, flanqueado por 10 a 15 bases homólogas. Siga las instrucciones en el paso 1.1.1.1.
  2. Utilice PCR para sintetizar plásmidos mutantes. Para cada reacción de PCR, utilice tampón de alta fidelidad 1x, mM dNTPs 10, 2 U de ADN polimerasa de alta fidelidad, 0,5 M de cebador mutagénico hacia delante, 0,5 M de cebador mutagénico inverso y 50 ng de pNL4-3VifB quimérico, de la etapa 1.2.6 , en un volumen final de 50 l. Ajuste los parámetros de ciclo térmico a: 98 ° C durante 30 seg, 25 ciclos a 98 ° C durante 10 seg, 48 ° C durante 1 min y 72 ° C durante 10 min, seguido de 72 ° C durante 10 min.
  3. Repita el paso 1.2.2 a 1.2.6.

2. Generación de Viral Stock Uso de transfección

  1. Calcular la cantidad de papel deseado viral y el plásmido ADN requerido. Con un título viral de 10 4 UI / ml o superior, 1,8 ml de stock viral es suficiente para dos conjuntos de ASSA competencia crecimientoys, incluyendo monoinfections, cada uno hecho por triplicado. Para una transfección hecho en una placa de 6 pocillos, sobre 1,8 ml de sobrenadante se cosecha por pocillo. Se necesita un g de ADN plásmido para cada transfección hecho en una placa de 6 pocillos.
  2. Para cada pocillo de una placa de 6 pocillos, preparar 100 l de mezcla de transfección, por ejemplo., Que consta de 1 l X-tremeGENE 9 reactivo de transfección (o comparable), 1 g de ADN plásmido y DMEM libre de suero.
    1. Determinar el volumen de plásmido de ADN necesario, usando 1 g de ADN plásmido por pocillo. Asegúrese de que la concentración final del ADN plásmido es al menos 50 ng / l.
    2. Determinar cuánto se necesita medio libre de suero (DMEM) por pocillo usando la fórmula: Volumen total de DMEM en l = 100 l - volumen ADN en l.
  3. Añadir 293T-17 (ATCC) las células HEK 10 6 / pocillo en 2 ml de medio de propagación (DMEM + suero bovino fetal al 10% (FBS)) en una placa de 6 pocillos. Incubar durante 1 hora a 37 ° C en un5% atmósfera de CO 2. Semillas tantos pozos como sea necesario (determinados en el paso 2.1).
  4. Para preparar la mezcla de transfección, alícuota del volumen apropiado de DMEM sin suero, según lo calculado anteriormente, en un tubo de microcentrífuga de 1,8 ml de polipropileno, y luego añadir el reactivo de transfección.
    1. Reactivo Pipetear directamente en la solución de los medios de comunicación, no se agregue a la superficie de plástico del tubo de microcentrífuga. Añadir ADN plásmido pasado. Pipetear hacia arriba y hacia abajo suavemente para mezclar la solución. Incubar durante 15 min a RT (15 ° C a 25 ° C) para permitir la formación de complejos de transfección.
    2. Añadir la mezcla de una manera gota a gota a las células sembradas en la placa de 6 pocillos. Sacudir o agitar los pozos para asegurar una distribución uniforme de los complejos de transfección con cuidado.
    3. Placas sello con una envoltura de plástico.
  5. Incubar los cultivos a 37 ° C en una atmósfera con 5% de CO 2 durante 48 horas.
  6. Utilice una pipeta para recoger y transferir el sobrenadante a un tubo de 15 ml throu cuidadogh una tapa de 0,22 micras filtro.
  7. Utilice pipeta para transferir 250 l o más de los sobrenadante filtrado a 1,8 ml tubos de microcentrífuga con juntas de goma en las tapas.
  8. Tienda filtró sobrenadantes a -80 ° C hasta su uso.

3. Determinar infecciosa Titer de las poblaciones virales en células mononucleares de sangre periférica (CMSP)

  1. Estimular PBMCs con fitohemaglutinina (PHA). Por una acción viral, semilla de 2 x 10 6 PBMCs en medio de Dulbecco modificado completa de Iscove (cIMDM; IMDM suplementado con 20 U / ml de interleucina humana 2 (hIL-2), 10% de suero bovino fetal y 1% de penicilina / estreptomicina) suplementado con PHA (1,5 g / ml). PBMCs de SEED en 2 x 10 6 células / ml. Incubar PBMCs a 37 ° C en una atmósfera de CO2 al 5% durante 72 horas.
  2. Cosecha de PBMCs estimuladas con PHA. Transferencia no adherente PHA-PBMCs a un tubo cónico de 50 ml. Girar tubo a 228 xg durante 10 min. Retire con cuidado el sobrenadante sin disrupting del sedimento celular. Vuelva a suspender el sedimento celular a una concentración final de 2 x 10 5 PBMC / ml en cIMDM.
  3. Seed 2 x 10 4 PBMCs estimuladas con PHA / pocillo en 100 l / pocillo cIMDM en una placa de 96 pocillos de fondo redondo.
  4. Hacer una dilución 1:10 de la población viral. Luego, desde la primera acción diluida, que doce diluciones seriadas de 3 veces en una placa maestra de 96 pocillos. Se recomienda este esquema de dilución para la detección de los títulos virales en el intervalo de 04 10-6 10 unidad infecciosa (UI) por ml.
    1. Por ejemplo, añadir 20 l de stock de virus a 180 l medios de comunicación en el tubo de 1,5 ml. Mezclar la dilución pipeteando cuidadosamente. A continuación, traslado de 90 l de la acción diluida en 180 l de medios del primer pozo y mezclar bien con la pipeta.
    2. Continuar serie de diluciones mediante la transferencia de 90 l del pozo actual a 180 l de medios en el siguiente pozo once veces más. Aumentar o disminuir la dilución inicial si los títulos superiores a 10 6 UI / mlo se espera inferior a 10 4 UI / ml, respectivamente.
  5. Añadir 40 l de la cepa vírica diluido en serie de la placa de dilución principal a la placa PBMCs cabeza de serie (del paso 3.3) por cuadruplicado. Incubar las placas a 37 ° C en una atmósfera de 5% de CO2 durante 16 a 24 horas.
  6. Retire con cuidado 100 l de sobrenadante de cada pocillo, y reemplazar con 160 l de cIMDM fresco a un volumen total de 200 l / pocillo. Incubar las placas a 37 ° C con 5% de CO 2 atmósfera (día 1).
  7. En los días 4, 7, 10 y 13 de transferencia de 100 l de sobrenadante de cada pocillo a 100 l buffer de interrupción (2% Triton X-100 en PBS), y reemplazar con 100 l de cIMDM fresco. Almacene los sobrenadantes a -20 ° C.
    1. Mantenga el muestreo y añadiendo cIMDM fresca cada tres días hasta que el título se estabiliza.
  8. Determinar la dosis infecciosa de cultivo de tejidos 50% (TCID 50) de la población viral p24 por ELISA usando el día 7 y 13 muestras como se describe en el paso 4.
    1. Si el DICT50 obtenido de día 13 es claramente superior a la titulación del día 7, el stock de virus puede necesitar más tiempo para ampliar. Repetir el p24 ELISA utilizando muestras posteriores hasta que los títulos infecciosos a partir de dos puntos de tiempo de muestreo se vuelven estable (o disminución). Selecciona las poblaciones de las muestras con los títulos más altos.

4. ELISA (Enzyme-linked inmunoabsorbente Assay) Detección de VIH-1 p24 para determinar viral infecciosa Titer

NOTA: El siguiente protocolo fue desarrollado utilizando placas de captura de antígeno p24 preparadas en nuestro laboratorio 30. Comercial VIH-1 p24 placa de ELISA / kits también se puede utilizar, siguiendo el protocolo del fabricante.

  1. Antes de trabajar con muestras, preparar stocks de trabajo de anticuerpo primario (de conejo anti-HIV-1 p24 SF2 antisuero).
    1. Antisuero p24 Descongelar a temperatura ambiente.
    2. Mezclar 2,5 ml de glicerol con 2 ml de 10% de FBS en Phosphatsolución salina tampón E (PBS).
    3. Añadir 0,5 ml de antisuero y mezcle.
    4. Tienda 1 ml de alícuotas a -20 ° C.
  2. Descongele las muestras del paso 3.7 en una incubadora a 37 °.
  3. Lave la placa de captura de p24 5 veces con tampón de lavado (1x PBS con 0,05% de Tween-20).
  4. Añadir 50 l / pocillo de diluyente de muestra (1% de albúmina de suero bovino (BSA), 0,2% de Tween-20 en medio RPMI-1640), a continuación, añadir 50 l de muestra a los pocillos apropiados. Incluya al menos tres pozos con diluyente de muestra sólo como controles simulados / negativos. Incubar durante 2 horas a 37 ° C o O / N a 4 ° C.
  5. Prepare la solución de anticuerpo primario fresca antes de su uso. Hacer una dilución 1: 2.000 veces del anticuerpo primario stocks de trabajo utilizando el diluyente de anticuerpo primario (12% de SFB en medio RPMI-1640). Asegurar para preparar suficiente para el uso de solución de 100 l por cada muestra / control de pocillo en una placa de 96 pocillos.
    1. Por ejemplo, para producir suficiente solución para una placa de 96 pocillos, añadir 5 l de la worki anticuerpo primariong de stocks al diluyente de anticuerpo primario para un volumen final de 10 ml.
  6. Lave la placa de captura de 5 veces con tampón de lavado.
  7. Añadir 100 l de la solución de anticuerpo primario a cada pocillo. Incubar durante 1 hora a 37 ° C en una atmósfera de 5% de CO 2.
  8. Prepare la solución de anticuerpo secundario fresca antes de su uso. Hacer una dilución 1: 14.400 veces del anticuerpo secundario (1 mg / ml de cabra anti-conejo HRP) utilizando el diluyente de anticuerpo secundario (7% de FBS, 0,01% de Tween-20 en medio RPMI-1640). Para reducir los errores de pipeteo, realizar una dilución en serie de dos pasos. Asegurar para preparar suficiente para el uso de solución de 100 l por cada muestra / control de pocillo en una placa de 96 pocillos.
    1. Por ejemplo, para producir suficiente solución para una placa de 96 pocillos, agregar primero 1 l de anticuerpo secundario a 99 l de diluyente de anticuerpo secundario. A continuación, añadir 70 l de primera dilución al diluyente de anticuerpo secundario para un volumen final de 10 ml.
  9. Placa de captura Wash 5 times con tampón de lavado.
  10. Añadir 100 l de la solución de anticuerpo secundario a cada pocillo. Incubar durante 1 hora a 37 ° C en una atmósfera de 5% de CO 2.
  11. Lave la placa 5 veces con tampón de lavado.
  12. Añadir 100 l de sustrato TMB RT. Incubar 30 minutos a temperatura ambiente en un recipiente cerrado para protegerlo de la luz.
  13. Añadir 100 l de solución de parada RT (1 NH 2 SO 4).
  14. Leer la absorbancia a 450-650 nm en cada pocillo utilizando un lector de microplacas. Utilice el valor de absorbancia para anotar cada uno así como infectado o no infectado. Considere un pozo para contener virus infeccioso si el valor de la absorbancia es al menos tres veces más alto que el valor leído de los pocillos de control simulacros / negativo. Calcula TCID 50 de la cepa vírica utilizando el método de Reed-Meunch 31.

5. Establecer la cinética de crecimiento viral

5.1) monoinfección

  1. Semilla 3 x 10 5 PHA-estimulado PBMC / pocillo en placas de 48 pocilloss en un volumen total de 500 l / pocillo. Mantenga las placas de cultivo a 37 ° C en una atmósfera de CO2 al 5% hasta que la inoculación.
  2. Para cada virus, preparar un inóculo que contiene 6.000 UI en 2 ml de cIMDM.
  3. Inocular pozos en triplicado mediante la adición de 500 l de inóculo (1500 IU) a las células sembradas. El volumen final del cultivo celular infectado es 1 ml / pocillo y se la MOI es 0.005.
  4. Alícuota 200 l de inóculo restante para cada uno de dos placas de 96 pocillos para el aislamiento de ARN, una de las cuales se guarda como una copia de seguridad.
  5. Incubar los cultivos a 37 ° C en una atmósfera con 5% de CO2 durante 16 a 24 horas.
  6. Culturas Lave 16-24 h después de la inoculación.
    1. Retire y deseche 750 l de sobrenadante de cultivo.
    2. Añadir 750 l de cIMDM fresco. Envuelva las placas en papel plástico y centrifugado durante 10 minutos a 300 x g. Retire y deseche 750 l sobrenadante.
    3. Añadir 750 l de cIMDM fresco. Se incuba a 37 ° C con un 5% de CO2 amósfera (día 1).
  7. Culturas muestras diarias del día 2 al día 7.
    1. Transferir 500 l de sobrenadante de cultivo a un tubo de 1,8 ml de centrífuga. Centrifugado durante 1 min a 3000 x g.
    2. Transferencia de 200 l del sobrenadante libre de células a las dos placas de muestra de 96 pocillos para el aislamiento de ARN, de nuevo ahorro de una placa como copia de seguridad. Sobrenadantes Almacenar a -80 ° C hasta que el aislamiento de ARN.
    3. Añadir cIMDM 500 l fresco a cada cultura. Incubar a 37 ° C en una atmósfera de 5% de CO 2.
    4. Desechar culturas en Wescodyne al final del experimento.
    5. Aislar ARN a partir de 200 l de sobrenadante (utilizar kits comerciales, como QIAamp Viral RNA Mini Kit) siguiendo el protocolo estándar del fabricante. Para un gran número de muestras, utilice el Qiagen QIAxtractor.
    6. RNA de muestras Conservar a -80 ° C hasta que la síntesis de ADNc.

5.2) Síntesis de ADNc (transcripción reversa)

  1. Para cada RNA samplio, añadir 1,2 nmol de dNTP y 1,2 pmol de cebador de síntesis de ADNc, (5'-GTTGATCCTTTAGGTATCTTTCCACAGC-3 ', nucleótidos HXB2 desde 7.968 hasta 7.995) a 10 l de RNA viral. Añadir agua hasta un volumen final de 14 l. Flick el tubo para mezclar y centrifugar brevemente para recoger líquido en la parte inferior del tubo.
  2. Incubar la mezcla durante 5 minutos a 65 ° C, a continuación, mantenga a 4 ° C hasta que se prepara la mezcla maestra.
  3. Preparar mezcla maestra usando 5x primer capítulo de amortiguación (250 mM Tris-HCl, pH 8,3, 375 mM KCl, 15 mM MgCl 2), DTT 5 mM, 120 U de SuperScriptIII y 240 U de RNasa inhibidor. Añadir agua hasta volumen final de 10 l.
  4. Añadir 10 l de mezcla maestra a la mezcla de ARN, película de mezclar y girar a recoger.
  5. Incubar la mezcla durante 90 min a 50 ° C para permitir la síntesis de cDNA. Incubar durante 15 min a 70 ° C para inactivar la transcriptasa inversa. Mantenga a 4 ° C, según sea necesario.
  6. Añadir 2 U de RNasa H, película para mezclar, y luego girar a recoger.
  7. Incubar 20 mina 37 ° C. ADNc tienda a -20 ° C.

5.3) La cuantificación de cDNA mediante el Sistema de qPCR

  1. Preparar una serie de diluciones estándar. Haz 10 veces dilución en serie, de 3 x 10 6 copias / l hasta 30 copias / l, de pNL4-3VifA. Use agua destilada para diluciones. Preparar la serie de dilución estándar fresca antes de usar o preparar pequeños lotes y mantener a -20 ° C. No congelar-descongelar los estándares más de tres veces.
  2. Configurar una placa de reacción de 96 pocillos qPCR. Asegúrese de que cada placa contiene al menos un pocillo de controles negativos, un triplicado de la serie de dilución estándar, y al menos un duplicado de cada muestra de ADNc.
  3. Para cada reacción de qPCR, utilizar 12,5 l de mezcla maestra qPCR, 0,2 M de sonda, 0,8 mu M cada uno de los cebadores directo e inverso y 1 l de cDNA o la serie de dilución estándar o agua / tampón (para el pocillo de control negativo). Añadir agua hasta un volumen final de 25 l. La sonda qPCR es luz sensitive. Guárdelo en un recipiente cerrado.
    1. Para detectar ADNc derivado de clon molecular basado pNL4-3VifA, utilice el Vifa cebador-sonda: VifAB cebador directo (GGTCTGCATACAGGAGAAAGAGACT), Vifa cebador inverso (5'-AGGGTCTACTTGTGTGCTATATCTCTTTT-3 ') y la sonda VifAB (6FAM-5'-3-CTCCATTCTATGGAGACTC '-MGBNFQ). Para ADNc derivado de clon basado pNL4-3VifB, utilice el VifB cebador-sonda: cebador directo VifAB, sonda VifAB y VifB cebador inverso (5'-CACCTGCGTGCTATACCTTTTCT-3 ').
  4. Ajustar los parámetros de los ciclos de PCR a 50 ° C durante 2 min, 95 ° C durante 10 min, y 40 ciclos de 95 ° C durante 15 segundos y 60 ° C durante 1 min. Consulte el documento de soporte del fabricante para el funcionamiento de la máquina qPCR.
  5. Calcular una curva estándar utilizando los datos de la serie de dilución estándar triplicado. Comparar los datos de amplificación de la muestra de ADNc para la curva estándar para determinar el número de copias. Consulte el documento de soporte del fabricante de daprocesamiento ta.

5.4) Determinar Viral fase de crecimiento exponencial

  1. Trazar la cinética de crecimiento viral con el día de muestreo a lo largo del eje X y el número de copias de ADNc a lo largo del eje Y e identificar la fase de crecimiento exponencial viral, es decir., Cuando ADNc virales número de copias de aumento en una progresión exponencial.
  2. Utilice la herramienta web GRC ( http://indra.mullins.microbiol.washington.edu/grc/ ) para calcular la tasa de crecimiento viral (g). En esta aplicación, la herramienta GRC acepta cDNA número de copias de al menos dos puntos de tiempo como entrada, y da salida a la tasa de crecimiento viral (g). Utilice sólo los datos de puntos de tiempo dentro de la fase de crecimiento exponencial (véase el paso 5.4.1 anterior) para obtener tasas de crecimiento precisos. Para una descripción detallada del modelo matemático utilizado en la herramienta web GRC, ver 20.

Ensayo de Competencia 6. Crecimiento

  1. Semilla 3 x 10 5 </ Sup> PBMCs estimuladas con PHA (o 1 x 10 5 células CEMx174) en 500 l volumen total por pocillo en una placa de pocillos de fondo plano 48.
  2. Mantenga plato en 37 ° C en una atmósfera con 5% de CO 2 hasta que la inoculación.
  3. Para cada virus, preparar 3 ml de inóculo que contiene 6.000 UI.
  4. Transferir 1,5 ml de cada inóculo viral a un tubo estéril para crear el dual inóculo infección. Añadir 500 l de la doble inóculo (1500 IU) a 3 x 10 5 células en una placa de 48 pocillos. El volumen de cultivo final es 1 ml / pocillo. Alícuota de 200 l de inóculo a dos placas de 96 pocillos para el aislamiento de ARN; salvar una placa como respaldo.
  5. Se incuban las células inoculadas a 37 ° C con una atmósfera de CO2 al 5% durante 16 a 24 horas.
  6. Culturas Lave 16-24 h después de la inoculación.
    1. Retire y deseche 750 l de sobrenadante de cultivo.
    2. Añadir 750 l de cIMDM fresco. Envuelva las placas en papel plástico y centrifugado durante 10 minutos a 300 x g. Retire y deseche 75081; l sobrenadante.
    3. Añadir 750 l de cIMDM fresco. Se incuba a 37 ° C con una atmósfera de CO2 al 5% (día 1).
  7. Seleccione tiempos de muestreo para incluir al menos 3 puntos de tiempo dentro de la fase de crecimiento exponencial observada en el paso 5.4.1.
    1. Para cada toma de muestras, siga el paso 5.1.7.
  8. Realizar la síntesis de ADNc como se describe en el apartado 5.2.
  9. Determine la relación variante viral usando qPCR.
    1. Preparar una serie de diluciones en serie estándar por triplicado, diluyendo 10 veces en cada paso de 3 x 10 6 copias / l a 30 copias / l de pNL4-3VifA.
    2. Configurar una placa de reacción de 96 pocillos qPCR. Asegúrese de que cada placa contiene al menos un control negativo, la serie de dilución estándar por triplicado, y los duplicados de cada muestra de ADNc.
    3. Para cada reacción qPCR, utilizar 12,5 l de qPCR Master Mix, 0,2 M de la sonda, 0,8 mu M cada uno de los cebadores directo e inverso y 1 l de cDNA o la d estándar serie ilution o agua / tampón (para los pozos de control negativo). Añadir agua hasta un volumen final de 25 l. La sonda qPCR es sensible a la luz, guárdelo en recipiente cerrado.
      1. Utilice la sonda-primer Vifa para detectar señales de los de la serie de dilución estándar de controles negativos y con uno y dos ejemplares de la muestra de ADNc. Utilice el cebador-sonda VifB con el otro duplicado de la muestra de ADNc.
    4. Ajustar los parámetros de los ciclos de PCR a 50 ° C durante 2 min, luego 95 ° C durante 10 min, y luego 40 ciclos de 95 ° C durante 15 seg y 60 ° C durante 1 min. Consulte el documento de soporte del fabricante para el funcionamiento de la máquina qPCR.
    5. Calcular la curva estándar utilizando los datos de amplificación de la serie de dilución estándar. Comparar los datos de amplificación de las muestras de cDNA a la curva estándar para determinar el número de copias. Consulte el documento de soporte del fabricante para el procesamiento de datos.
    6. Utilice la herramienta web GRC (ol.washington.edu/grc/">http://indra.mullins.microbiol.washington.edu/grc/) para calcular la aptitud viral relativa (d).
      NOTA: La herramienta GRC acepta cDNA número de copias o alturas de los picos del cromatograma de al menos dos puntos de tiempo como la entrada, y da salida a la diferencia de tasa de crecimiento neto (d) entre los dos virus. Mientras que la herramienta puede calcular la tasa de crecimiento neto a partir de dos datos de puntos de tiempo, se recomienda encarecidamente a los datos de entrada a partir de tres o más puntos de tiempo. Usar sólo los datos obtenidos a partir de los puntos de tiempo dentro de la fase de crecimiento exponencial (véase el paso 5.4) para obtener tasas de crecimiento precisos. Para una descripción detallada del modelo matemático utilizado en la herramienta web GRC, ver 20.
  10. Determinar proporciones virales usando cromatograma pico-heights
    1. PCR amplificar VIH-1 vif fragmentos que contienen la etiqueta de secuencia usando VifAB VifFwd (5'-GAAAGAGACTGGCATTTGGGTCAGGG-3 '; HXB2 posiciona 5266 hasta 5291) y cebadores VifRev (5'-GTCTTCT GGGGCTTGTTCCATCTGTCC-3 '; HXB2 posiciones 5.579-5.553).
      1. Para cada reacción de PCR, utilizar 1 l de ADNc, 1x tampón de NH 4, 1,5 mM de MgCl 2, 0,2 mM dNTP, 2,5 U de Taq polimerasa, y 0,45 M de cada cebador. Añadir agua hasta un volumen final de 50 l.
      2. Ajustar los parámetros de los ciclos de PCR a 3 ciclos a 94 ° C durante 1 min, 55 ° C durante 1 min, y 70 ° C durante 1 min, seguido de 34 ciclos a 94 ° C durante 15 seg, 58 ° C durante 30 seg, y 70 ° C durante 1 minuto, y luego mantenga a 4 ° C.
    2. Purificar los productos de PCR utilizando el kit de purificación QIAquick PCR de acuerdo con el protocolo del fabricante.
    3. Presentar productos de PCR purificados a un proveedor de servicios de secuenciación de ADN para la secuenciación de Sanger.
    4. Compruebe la puntuación media de la calidad de lectura, que debe ser proporcionada por el servicio de secuenciación. Si la precisión media de las llamadas de base es inferior al 85%, vuelva a realizar el paso 6.10.1 a 6.10.3
    5. Utilice la herramienta web ChromatQuan (f="http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi">http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi ) para calcular la razón viral en cada punto de tiempo. La herramienta requiere el archivo de secuencia de trace (* .ab1) y la secuencia 5 'del sitio de nucleótidos de interés. La herramienta mide la intensidad máxima en el lugar especificado. La relación de la intensidad pico corresponde a la ración de los dos virus (Figura 4B).
    6. Utilice la herramienta GRC web ( http://indra.mullins.microbiol.washington.edu/grc/ ) y las intensidades de los picos registrados como entrada para calcular la aptitud relativa viral (d). Vea el paso 6.10.6. 20

Representative Results

Para estudiar el impacto de la aptitud de los cambios de aminoácidos individuales en el VIH-1 Gag-p24, utilizamos oligonucleótido mutagénesis dirigida para introducir mutaciones en un plásmido pNL4-3 contiene el VIH-1 COTB-p24 gen 23,32,33. Stocks virales se generaron mediante transfección de células 293T y se recogieron después de 48 hr. Estimamos el cultivo de tejidos dosis infecciosa 50% (DICT50) de cada acción viral por el método de Reed-Muench 31. La TCID 50 del prototipo y los virus mutantes variaron de 04 10 hasta 5 10 UI / ml (Figura 3A).

La cinética de crecimiento de los virus recombinantes se establecieron en PBMCs de un solo donante a una MOI de 0,005. RT-qPCR se utilizó para medir el número de copias de ADNc viral al día durante seis días. Todos los virus mutantes y de prototipo crecieron de manera exponencial entre el día 2 y día 4, después de lo cual se redujo el crecimiento viral, tal como se indica por una disminución de la pendiente del número de copias de ARN viral aumento (<strong> Figura 3B). La disminución en el número de copias de cDNA entre el día 0 (correspondiente al inóculo) y día 2 se debe a la absorción de virus a las células y la eliminación de los viriones no unidas por el día 1 de lavado (etapa 5.1.6). En la fase de crecimiento exponencial, los tres mutantes tenían una tasa de crecimiento más lento (g) que el virus prototipo (Figura 3C).

Los tres mutantes fueron compitieron contra el virus prototipo en ensayos de competición crecimiento a una MOI total de 0.005. Cinética de crecimiento viral en cultivos doblemente infectadas fueron similares a la de monoinfección; la fase de crecimiento exponencial viral fue entre los días 2 y 4, y el crecimiento viral llegó a una meseta alrededor del día 5 (Figura 4A).

Las diferencias de crecimiento viral se derivaron del cambio en la relación viral con el tiempo. La relación viral se calculó basándose en el número de copias de ADNc de la referencia y los virus mutantes utilizando RT-qPCR, y al comparar alturas de los picosen secuencia cromatogramas en los sitios de nucleótidos que distinguen los dos virus (Figura 4B). Las diferencias de crecimiento determinado usando el pico de altura y métodos virales número de copias de ARN arrojado resultados similares (Figura 4C). Los tres mutantes tenían menor aptitud de replicación de los virus prototipo con el I256V mutante que tiene la aptitud más baja (Figura 4C).

Figura 1
Figura 1: Diagrama de flujo de los protocolos presentados en este documento La protocolos de preparación de la preocupación de la construcción del virus del VIH-1 clones recombinantes y la generación de las reservas virales.. Los protocolos de la aptitud para el establecimiento de ensayos son cinética de crecimiento viral y la determinación de la aptitud viral relativa. Las líneas discontinuas representan los flujos alternativos para los protocolos. Por ejemplo, una mutación puede introducirse directamente en el VIH-1 NL4-3clon molecular sin generar un clon recombinante.

Figura 2
Figura 2:. Construcción de VIH-1 NL4-3 COTB Gag-p24 clones moleculares recombinantes usando PCR de extensión por solapamiento (A) Diseño de los cebadores quiméricos. El 5 'mitades de los cebadores contienen la secuencia del vector NL4-3 y el 3' mitades contienen los extremos de la secuencia de inserción. (B) cebadores quiméricos se utilizan para amplificar el fragmento de inserción, COTB Gag-p24. (C) Los fragmentos de inserción se utilizan como cebadores para una segunda PCR para generar un nuevo plásmido recombinante.

Figura 3
Figura 3:. Características de crecimiento virales en PBMC (A) Log 10 DICT 50 (B) la cinética de crecimiento viral en monoinfections comenzado en una MOI = 0,005. (C) las tasas de crecimiento viral de más de seis días, incluyendo la fase exponencial de crecimiento (días 2-4) derivado de panel (B). Los valores mostrados representan la media de tres repeticiones de un experimento. Las barras de error representan intervalos de confianza del 95%.

Figura 4
Figura 4: crecimiento viral y de la aptitud relativa determinaciones (A) el crecimiento viral en cultivos de PBMC doblemente infectados.. (B) Las relaciones de los virus T242N y prototipos determinaron utilizando RT-qPCR o el método de secuenciación de pico de altura. Diferencias netas virales tasa de crecimiento (D) entre el mutante y los virus prototipo en cultivos doblemente infectadas (C), como se muestra en (A). Se calcularon los valores d fesde los datos de relación virales que se muestran en (B). Los valores mostrados representan la media de tres repeticiones de un experimento. Las barras de error representan intervalos de confianza del 95%.

Discussion

Los protocolos presentados consistían en dos partes principales: la construcción del VIH-1 clones moleculares recombinantes y ensayos de competición crecimiento. A fin de distinguir dos virus en un cultivo celular doblemente infectada, es importante que los clones moleculares que compiten contienen etiquetas de secuencias, que pueden ser detectados por un ensayo de cebador-sonda RT-qPCR o por secuenciación de Sanger. Este protocolo hace uso de las etiquetas Vifa y VifB, que ocupan la misma región del VIH-1 NL4-3 vif y codifican la misma secuencia de aminoácidos pero que difieren por seis mutaciones sinónimas. Estas mutaciones se muestran no afectar gimnasio replicación viral 20. El método de clonación basada en PCR utilizada en este protocolo proporciona una mayor flexibilidad en la selección de sitios de clonación, en comparación con la clonación basada sitio de restricción. Sin embargo, la eficiencia de la clonación PCR disminuye a medida que aumenta el tamaño de inserción. El límite actual del tamaño de inserto es de ~ 5 kb 34. Para la clonación basada en PCR y sitios dirigida mutagenesis, el uso de una ADN polimerasa de alta fidelidad es crucial para reducir la probabilidad de mutaciones adicionales. También se recomienda el uso del número mínimo de ciclos de PCR necesarios para producir cantidades adecuadas de productos. En nuestra experiencia, no detectamos ningún mutaciones adicionales después de los pasos de clonación y mutagénesis dirigida al sitio basados ​​en PCR que aquí se describen. Sin embargo, los productos de PCR deben ser secuenciados para comprobar que no existen mutaciones indeseadas. Idealmente, toda la región de codificación de VIH debe ser resequenced.

Por lo menos tres puntos de tiempo de muestreo deben ser examinados dentro de la fase de crecimiento exponencial 9. La cinética de crecimiento viral primero deben establecerse mediante muestreo diario para determinar el período de la cultura y el tiempo de muestreo apropiadas puntos para el concurso de crecimiento. Un factor que afecta a la cinética de crecimiento viral es la multiplicidad de infección (MOI). Este protocolo utiliza un total de 0,005 MOI tanto para monoinfección y la competencia de crecimiento, como se demostró para producir más roresultados busto que baja MOI 9. No obstante, las MOI inferiores se pueden utilizar para obtener una fase de crecimiento exponencial ya si es necesario, pero a expensas de la consistencia resultado. Este protocolo sugiere una relación de la infección inicial de 50:50, suponiendo que las diferencias de aptitud de los virus son generalmente desconocido de antemano. Sin embargo, el uso de relaciones desiguales de entrada son apropiadas cuando hay datos preliminares que sugieren diferencias significativas en la cinética de la replicación viral. En estos casos, se recomienda una proporción de infección de 70:30 a permitir la detección de una diferencia grande de la aptitud donde el virus menos aptos se coloca en exceso 9.

El protocolo para la determinación de la TCID 50, la cinética de crecimiento viral, y para llevar a cabo el crecimiento ensayos de competición se optimizaron usando el VIH-1 subtipo B, NL4-3 COTB-p24, y PBMCs de un único donante cuya PBMC han demostrado susceptibilidad consistente para el VIH 1 infección in vitro. El período de cultivoy los puntos de tiempo de muestreo presentados en este protocolo es probable que sean adecuados para el estudio de VIH-1 grupo M virus en PBMC humanas. El uso de PBMCs de una sola fuente es muy recomendable para obtener resultados consistentes como la replicación viral puede variar en diferentes células del donante 35. Aunque menos deseable, PBMCs agrupados a partir de múltiples donantes se pueden utilizar como una sustitución, siempre que la misma agrupación se utiliza en todos los experimentos. Otra alternativa es el uso de líneas celulares. El protocolo que aquí se presenta se utilizó con éxito con la línea de células T CEMx174 23,36. Sin embargo, es importante que el número de células sembradas son re-optimizados para lograr un crecimiento celular consistente. Cinética de crecimiento viral también deben ser restablecidos, ya que es probable que varíe en diferentes líneas celulares, para determinar los puntos de tiempo de muestreo apropiados en los pasos de competencia crecimiento.

Dos métodos diferentes para determinar la relación viral para el cálculo de fitness están incluidas en el protocol. El primero utiliza RT-qPCR para medir el número de copias de ADNc viral en cada punto de tiempo de muestreo. A continuación, la aptitud replicación viral se calcula a partir de la relación viral, basado en el número de copias de ADNc. Alternativamente, la relación viral puede ser determinado basado en la relación de altura del pico del cromatograma en los sitios de la etiqueta VifAB. Los dos métodos dieron resultados comparables (Figura 4). El método de la altura del pico del cromatograma se puede aplicar a otras cepas del VIH-1 sin una etiqueta de secuencia de ingeniería. Para RT-qPCR, el uso de cebadores o sondas para distinguir variantes virales primero debe ser evaluado cuidadosamente (ver 20). Sin embargo, RT-qPCR proporciona una mejor sensibilidad para muestras con una pequeña cantidad de ARN viral, tales como los que desde el primer punto de tiempo dentro de la fase de crecimiento exponencial. La medición directa de ADNc viral también permite la detección de los problemas técnicos que puedan surgir de la extracción de RNA y la síntesis de ADNc. Usando clones moleculares con etiquetas de secuencias proporciona una solución rentable to los métodos de RT-qPCR, como sólo se necesitan dos pares de cebadores y sondas para estudiar múltiples virus. Esta estrategia también evita el problema de la variación de altura de pico en la secuencia de cromatogramas debido a bases vecinos 37, como la secuenciación se realiza en el mismo sitio a través de todos los virus en el estudio. Los productos de PCR producidos por RT-qPCR y secuenciación Sanger también pueden estar en uso con otros métodos para determinar la relación viral como la secuenciación mayor parte de clones individuales 12,13, HTA 4,7,17,19, o ensayo de ligación de oligonucleótidos (OLA) 38 .

Disclosures

Los autores declaran que no tienen intereses financieros en competencia. Las opiniones expresadas aquí son las de los autores y no deben interpretarse como oficial o que representa los puntos de vista del Departamento de Defensa de Estados Unidos o del Departamento del Ejército.

Materials

Name Company Catalog Number Comments
Construction of recombinant clones
Chimeric primer/Mutagenic/Sequencing primers IDT Custom DNA oligos
pNL4-3VifA and pNL4-3VifB plasmid Please contact Dr. James I Mullins (jmullins@uw.edu)
High-Fidelity DNA polymerase Thermo Scientific F-549S
High-fidelity buffer Thermo Scientific F-549S
dNTP Bioline Bio-39026
Thermal cycler Life Technologies Applied Biosystems® GeneAmp® PCR System 9700
DNA loading dye Thermo Scientific R0631
1 kb Plus DNA ladder Invitrogen 10787-018
QIAquick PCR Purification Kit Qiagen 28104
QIAquick gel extraction kit Qiagen 28704
DpnI enzyme New England Biolabs R0176S
TOP10 chemically competent Escherichia coli Invitrogen C4040-10
Luria Broth base powder Invitrogen 12795-084
Carbenicillin Research Products International C46000-25.0
QIAprep Spin Miniprep kit  Qiagen 27104
EndoFree Plasmid Maxi Kit Qiagen 12362
Transfection
X-tremeGENE 9 DNA transfection reagent Roche 6365787001
HEK 293T-17 ATCC CRL-11268 http://www.atcc.org/
0.22 μm filter top tube VWR International 89220-716 
Cell culture
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 10566016
Iscove′s Modified Dulbecco′s Medium (IMDM) Life Technologies 31980-030
RPMI-1640 media Life Technologies 61870-036
Phytohemagglutinin (PHA) Thermo Scientific R30852801
Human Interleukin-2 Roche 11147528001
Fetal bovine serum JR Scientific 43640
Penicillin and Streptomycin Corning Cellgro 30-001-CI
6 well plate VWR Scientific 73520-906
48 well plate VWR Scientific 62407-338
96 well flat-bottomed plate ISC Bioexpress T-3015-4
96 well round-bottomed plate BD Falcon 353077
1.5 ml Microcentrifuge Tube Mt. Baker Bio MBD-1500
1.5 ml tubes w/ O-ring VWR Scientific 89004-290
50 ml conical tube ISC Bioexpress C-3317-6
ELISA
Triton-X 100 Sigma-Aldrich X100
Phosphate buffer saline (PBS) Invitrogen 14190-250
Fetal bovine serum (FBS) Sigma-Aldrich F0392
glycerol Sigma-Aldrich G5516
Tween 20 Sigma-Aldrich P1379
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153
Rabbit anti-HIV-1 SF2 p24 antiserum NIH AIDS Reagent Program 4250
Goat anti-rabbit HRP KPL 474-1516
TMB Microwell Peroxidase Substrate KPL 52-00-01
H2SO4 Fisher Scientific A300-500 Causes severe burns by all exposure routes. Use personal protective equipment. Use only under a chemical fume hood. Wash off immediately with plenty of water for at least 15 min.
HIV p24 standard AIDS and Cancer Virus program (NCI-Frederick) For order details please contact Julian Bess, Jr. (bessjw@mail.nih.gov); http://ncifrederick.cancer.gov/Programs/Science/Acvp/bio/Bess.aspx
Microplate reader Molecular Devices VMax Kinetic ELISA Microplate Reader
RNA isolation cDNA synthesis
QIAxtractor Qiagen http://www.qiagen.com/products/catalog/automated-solutions/sample-prep/qiaxtractor
QIAamp Viral RNA Mini Kit Qiagen 52906
dNTP Bioline Bio-39026
SuperscriptIII Invitrogen 18080-085
First-strand buffer  Invitrogen 18080-085
Dithiothreitol (DTT) Invitrogen 18080-085
Rnase inhibitor Roche 3335402001
RnaseH Invitrogen 18021-071
qPCR
Real-time qPCR machine Life Technologies Applied Biosystems 7300 Real-Time PCR 
TaqMan® Gene Expression Master Mix Life Technologies 4369016
Forward, reverse primer IDT Custom order
Probe Life Technologies Custom order
optical 96 well reaction plate Life Technologies I19N3Q216
PCR+sequencing
Taq DNA polymerase (Biolase) Bioline Bio-21043
NH4 buffer  Bioline Bio-21043
MgCl2 Bioline Bio-21043
Sequencing primer IDT Custom order
QIAxcel Qiagen http://www.qiagen.com/products/catalog/automated-solutions/detection-and-analysis/qiaxcel-advanced-system
DNA sequencing service provider http://www.htseq.org/
GRC web tool http://indra.mullins.microbiol.washington.edu/grc/
ChromatQuan web tool http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi

DOWNLOAD MATERIALS LIST

References

  1. Domingo, E., Holland, J. J. RNA virus mutations and fitness for survival. Annu Rev Microbiol. 51, 151-178 (1997).
  2. Domingo, E. Mechanisms of viral emergence. Veterinary research. 41, (6), 38 (2010).
  3. Martinez-Picado, J., Martinez, M. A. HIV-1 reverse transcriptase inhibitor resistance mutations and fitness: a view from the clinic and ex vivo. Virus Res. 134, (1-2), 104-123 (2008).
  4. Troyer, R. M. Variable fitness impact of HIV-1 escape mutations to cytotoxic T lymphocyte (CTL) response. PLoS Pathog. 5, (4), e1000365 (2009).
  5. Rolland, M. Amino-acid co-variation in HIV-1 Gag subtype C: HLA-mediated selection pressure and compensatory dynamics. PLoS One. 5, (9), e12463 (2010).
  6. Abraha, A. CCR5- and CXCR4-tropic subtype C human immunodeficiency virus type 1 isolates have a lower level of pathogenic fitness than other dominant group M subtypes: implications for the epidemic. J Virol. 83, (11), 5592-5605 (2009).
  7. Quinones-Mateu, M. E. A dual infection/competition assay shows a correlation between ex vivo human immunodeficiency virus type 1 fitness and disease progression. J Virol. 74, (19), 9222-9233 (2000).
  8. Ball, S. C. Comparing the ex vivo fitness of CCR5-tropic human immunodeficiency virus type 1 isolates of subtypes. B and C. J Virol. 77, (2), 1021-1038 (2003).
  9. Lanxon-Cookson, E. C. Factors affecting relative fitness measurements in pairwise competition assays of human immunodeficiency viruses. J Virol Methods. 194, (1-2), 7-13 (2013).
  10. Garcia-Lerma, J. G., MacInnes, H., Bennett, D., Weinstock, H., Heneine, W. Transmitted human immunodeficiency virus type 1 carrying the D67N or K219Q/E mutation evolves rapidly to zidovudine resistance in vitro and shows a high replicative fitness in the presence of zidovudine. J Virol. 78, (14), 7545-7552 (2004).
  11. Sharma, P. L., Crumpacker, C. S. Attenuated replication of human immunodeficiency virus type 1 with a didanosine-selected reverse transcriptase mutation. J Virol. 71, (11), 8846-8851 (1997).
  12. Martinez-Picado, J., Savara, A. V., Sutton, L., D'Aquila, R. T. Replicative fitness of protease inhibitor-resistant mutants of human immunodeficiency virus type 1. J Virol. 73, (5), 3744-3752 (1999).
  13. Wang, J. The HIV-1 reverse transcriptase mutants G190S and G190A, which confer resistance to non-nucleoside reverse transcriptase inhibitors, demonstrate reductions in RNase H activity and DNA synthesis from tRNA(Lys, 3) that correlate with reductions in replication efficiency. Virology. 348, (2), 462-474 (2006).
  14. Song, H. Impact of immune escape mutations on HIV-1 fitness in the context of the cognate transmitted/founder genome. Retrovirology. 9, (89), (2012).
  15. Ali, A., Yang, O. A novel small reporter gene and HIV-1 fitness assay. Journal of Virological Methods. 133, (1), 41-47 (2006).
  16. Maarseveen, N. M. A novel real-time PCR assay to determine relative replication capacity for HIV-1 protease variants and/or reverse transcriptase variants. J Virol Methods. 133, (2), 185-194 (2006).
  17. Liu, Y. Evolution of human immunodeficiency virus type 1 cytotoxic T-lymphocyte epitopes: fitness-balanced escape. J Virol. 81, (22), 12179-12188 (2007).
  18. Anastassopoulou, C. G., Ketas, T. J., Klasse, P. J., Moore, J. P. Resistance to CCR5 inhibitors caused by sequence changes in the fusion peptide of HIV-1 gp41. Proc Natl Acad Sci U S A. 106, (13), 5318-5323 (2009).
  19. Abraha, A., Troyer, R. M., Quinones-Mateu, M. E., Arts, E. J. Methods to determine HIV-1 ex vivo fitness. Methods Mol Biol. 304, 355-368 (2005).
  20. Liu, Y. A sensitive real-time PCR based assay to estimate the impact of amino acid substitutions on the competitive replication fitness of human immunodeficiency virus type 1 in cell culture. J Virol Methods. 189, (1), 157-166 (2013).
  21. Brumme, Z. L. Reduced replication capacity of NL4-3 recombinant viruses encoding reverse transcriptase-integrase sequences from HIV-1 elite controllers. J Acquir Immune Defic Syndr. 56, (2), 100-108 (2011).
  22. Nomura, S. Significant reductions in Gag-protease-mediated HIV-1 replication capacity during the course of the epidemic in. Japan. J Virol. 87, (3), 1465-1476 (2013).
  23. Rolland, M. HIV-1 conserved-element vaccines: relationship between sequence conservation and replicative capacity. J Virol. 87, (10), 5461-5467 (2013).
  24. Martinez-Picado, J. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. J Virol. 80, (7), 3617-3623 (2006).
  25. Brockman, M. A. Escape and Compensation from Early HLA-B57-Mediated Cytotoxic T-Lymphocyte Pressure on Human Immunodeficiency Virus Type 1 Gag Alter Capsid Interactions with Cyclophilin A. J Virol. 81, (22), 12608-12618 (2007).
  26. Miura, T. HLA-associated alterations in replication capacity of chimeric NL4-3 viruses carrying gag-protease from elite controllers of human immunodeficiency virus type 1. J Virol. 83, (1), 140-149 (2009).
  27. Basic Methods in Cellular and Molecular Biology, PCR: The Polymerase Chain Reaction. JoVE. Cambridge, MA. Available from: http://www.jove.com/science-education/5056/pcr-the-polymerase-chain-reaction (2014).
  28. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments : JoVE. 62, (Apr 20), (2012).
  29. Basic Methods in Cellular and Molecular Biology, Restriction Enzyme Digests. JoVE. Cambridge, MA. Available from: http://www.jove.com/science-education/5070/restriction-enzyme-digests (2014).
  30. McClure, J., van't Wout, A. B., Tran, T., Mittler, J. E. Granulocyte-monocyte colony-stimulating factor upregulates HIV-1 replication in monocyte-derived macrophages cultured at low density. J Acquir Immune Defic Syndr. 44, (3), 254-261 (2007).
  31. Reed, L. J., Muench, H. A simple method of estimatingfifty percent endpoints. Am J Hyg. 27, (3), 493-497 (1938).
  32. Nickle, D. C. Consensus and ancestral state HIV vaccines. Science. 299, (5612), 1515-1518 (2003).
  33. Rolland, M. Reconstruction and function of ancestral center-of-tree human immunodeficiency virus type 1 proteins. J Virol. 81, (16), 8507-8514 (2007).
  34. Bryksin, A. V., Matsumura, I. Overlap extension PCR cloning: a simple and reliable way to create recombinant plasmids. Biotechniques. 48, (6), 463-465 (2010).
  35. Spira, A. I., Ho, D. D. Effect of different donor cells on human immunodeficiency virus type 1 replication and selection in vitro. J. Virol. 69, (1), 422-429 (1995).
  36. Manocheewa, S., Swain, J. V., Lanxon-Cookson, E., Rolland, M., Mullins, J. I. Fitness costs of mutations at the HIV-1 capsid hexamerization interface. PLoS One. 8, (6), e66065 (2013).
  37. Zakeri, H., Amparo, G., Chen, S. M., Spurgeon, S., Kwok, P. Y. Peak height pattern in dichloro-rhodamine and energy transfer dye terminator sequencing. Biotechniques. 25, (3), 406-410 (1998).
  38. Lalonde, M. S. Sensitive oligonucleotide ligation assay for low-level detection of nevirapine resistance mutations in human immunodeficiency virus type 1 quasispecies. J Clin Microbiol. 45, (8), 2604-2615 (2007).
Crecimiento por parejas Ensayo de competición para determinar la aptitud de replicación de virus de inmunodeficiencia Humanos
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Manocheewa, S., Lanxon-Cookson, E. C., Liu, Y., Swain, J. V., McClure, J., Rao, U., Maust, B., Deng, W., Sunshine, J. E., Kim, M., Rolland, M., Mullins, J. I. Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses. J. Vis. Exp. (99), e52610, doi:10.3791/52610 (2015).More

Manocheewa, S., Lanxon-Cookson, E. C., Liu, Y., Swain, J. V., McClure, J., Rao, U., Maust, B., Deng, W., Sunshine, J. E., Kim, M., Rolland, M., Mullins, J. I. Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses. J. Vis. Exp. (99), e52610, doi:10.3791/52610 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter