Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Cryosectioning Methode voor Microdissection van Murine colonslijmvlies

doi: 10.3791/53112 Published: July 12, 2015

Introduction

De colon epitheel is een sterk regeneratief weefsel, met ingezeten stamcellen aanvullen van het weefsel om de paar dagen 1. Dit proces van regeneratie vereist het handhaven van een proliferatieve stamcelcompartiment. Na verloop van tijd, de nieuw geproduceerde dochtercellen verliezen hun proliferatieve potentie en migreren naar het luminale oppervlak van de darmen. Samenvalt met de migratie, stamcellen differentiëren in mature-barrière vormen enterocyten of slijm produceren slijmbekercellen. Niet van differentiëring programma wordt verondersteld bij te dragen aan epitheliale barrière gecompromitteerd zoals wordt waargenomen bij inflammatoire darmziekten en darmkanker 2,3.

Studie van de bovenstaande werkwijzen zal methoden voor het isoleren crypt-base en oppervlak celpopulaties vereisen. Meerdere methoden bestaan, elk met unieke voordelen en nadelen. Huidige werkwijzen voor het isoleren van darmepitheelcellen omvatten chelating middelen en mechanische dissociatie, resulterend in de isolatie van hele crypten, epitheelvellen of enkele cellen, afhankelijk van experimentele omstandigheden 4,5. Dit zijn hoge opbrengst methoden, nog veranderingen in intercellulaire signalering gerapporteerd onder deze omstandigheden die niet de eigen omgeving 6,7 kunnen vertegenwoordigen. Lasermicrodissectie zorgt voor de verzameling ruimtelijke verschillende materiaal, maar behaalt laag moleculair opbrengst 8,9. In humaan dikke darmweefsel, zijn periodieke horizontale cryosectioning werkwijzen ontwikkeld 10. Echter, muizen slijmvliezen zijn onbetaalbaar klein voor directe bestemming van deze techniek. Bij mensen intestinale crypte lengte (de afstand tussen de crypte-base en huidcellen) in de dikke darm varieert tussen 100-1000 pm ~ 11. In muizen, crypt lengten tussen ~ 50-300 micrometer (zie figuur 1A). De geringe omvang van muizen crypten vormt een uitdaging voor de isolatie van deze twee celpopulaties met behulp van bestaande protocollen.

We beschrijven nu een goedkope, hoge opbrengst methode voor het isoleren van crypte-base en oppervlakte epitheliale celpopulatie in muriene darmweefsel. Weefsel geoogst op deze wijze kunnen dan worden geanalyseerd door een aantal standaard downstreamtoepassingen, zoals immunofluorescentie kleuring, RT-PCR (Real Time-Polymerase Chain Reaction) of western blotting.

Protocol

Experimenten gebruikte C57BL / 6-muizen tussen 10 en 12 weken oud. Alle procedures met dieren werden beoordeeld en door de Emory University Institutional Animal Care en gebruik Comite goedgekeurd en werden uitgevoerd volgens de National Institutes of Health criteria.

1. Experimentele Setup

  1. Stel de cryostaat
    1. Equilibreren cryostaat tot -20 ° C, waaronder het microtoom blad en chucks (zeer voorzichtig rond het mes!).
    2. Vul een lege cryomold met oktober (optimale snijtemperatuur compound) en equilibreren tot -20 ° C (~ 30 min). Verwijder de bevroren oktober uit de mal en plaats deze op de boorkop met vloeibare oktober Plaats het blok / boorkop in de microtoom arm en laat de oktober gedurende 10 min in te stellen.
    3. Stel de cryostaat tot 10 micrometer per sectie en scheren de oktober blok totdat het plat. Terug de microtome arm weg van het blad door enkele centimeters. Op dit moment niet het mes of boorkop voor de rest van de exper passenrimentele.
  2. Bereid de scheermesjes: Bereid 2 scheermesjes per monster. Met behulp van een metalen bestand, doffe de sharped rand van de messen. Verwijder vervolgens de aluminium flens met een tang.
  3. Pre-chill een Pyrex gerecht of een ander plat oppervlak op droog ijs.
  4. Bereid een dissectie schotel met 10-15 dissectie pinnen. Een 10 cm weefselkweekplaat 50% gevuld met silicone worden volstaan. Voeg 5 ml Hanks buffer bij kamertemperatuur.

2. Dissectie van distale Colonic Tissue

  1. Plaats muizen in een afgesloten kamer en euthanaseren muizen door isofluraan inademing en cervicale dislocatie, spuit dan 70% ethanol op de buik en thorax 12.
  2. Voeg een kleine insnijding in de huid van het abdomen met een schaar en een insnijding aan de peritoneale holte bloot te leggen. Vergelijkbare procedures kunnen worden gevonden hier 12 beschreven.
  3. Snijd de dikke darm op de anus en plagen elkaar het mesenterium tot de dikke darm is gratis.
  4. Uitsnijden een distaal colonsegment tussen 0 en 6 cm vanaf de anus. Hier is de crypte diepte ~ 150 urn (zie Figuur 1B). Opengesneden de dikke darm in de lengte met een schaar en verwijder de fecale inhoud.
  5. Pin het weefsel aan de dissectie schaal met het mucosale oppervlak naar boven. Rek het weefsel via dissectie pinnen op een silicium schotel in Hanks buffer en laat even 10 minuten bij kamertemperatuur (Figuur 1C). Dit verwijdert plooien van het weefsel en kan de spierlagen te ontspannen.

3. Mount Tissue op de cryostaat voor Snijden

  1. Schuif een scheermesje onder het gewenste deel van het weefsel en giet de Hanks buffer. Voeg een scheermesje naar de top, het maken van een sandwich. Snijd het weefsel segment en verwijder de pinnen. Breng de scheermesje / weefsel sandwich droog ijs. Laat het weefsel te bevriezen (5-10 min, figuur 1D).
  2. Pick up the razor / weefsel sandwich en laat het licht opwarmen door het plaatsen van een vinger op de top blade (mucosale kant naar boven. Dit oriënteert het weefsel, zodat de basale spierlagen eerst worden doorgesneden.). Scheid de sandwich en snijd de randen van het weefsel segment. Snijd een tissue segment van ongeveer 0,5 cm x 1 cm. Randgebieden hebben de neiging te krullen, waardoor de seriële secties verschillende weefsellagen bevatten. Merk op dat over-snijden is beter dan onder-snijden, zodat het zekere voor het onzekere.
  3. Laat het weefsel tot het ijs bovenop het weefsel begint te smelten verwarmen. Op dit punt snel en zorgvuldig op het weefsel in het LGO-blok in de cryostaat.
  4. Verwijder het mes door een vinger over het monster. De warmte-overdracht zal u toelaten om het mes te verwijderen zonder verstoring van het weefsel.
  5. Coat het weefsel met oktober en evenwicht voor 5 min. Knip secties 10 urn (figuur 1E, F). Inspecteer de secties tot de crypten worden gezien. Plaats gedeelten in een 1,5 ml buizen of op objectglaasjes.
  6. Voor de analyse van mRNA of eiwit, plaats thij monsters in buizen met 5 crypte-base, 5 overgangs- en 5 oppervlak secties per buis. Voor RNA verzameling voeg 1 ml commercieel isolatie reagens en incubeer bij kamertemperatuur gedurende 10 min. Voer RNA zuivering volgens de instructies van de fabrikant. Gebruik 5-10 ug totaal RNA voor cDNA generatie.
  7. Voor eiwitzuivering, voeg 0,5 ml RIPA koude lysisbuffer (plus proteaseremmers) per 5 secties. Ultrasone trillingen 3 keer met een 70% cyclus op ijs.
    1. Samples Naar SDS-PAGE laadbuffer (Laemmli buffer) en geïncubeerd bij 100 ° C gedurende 10 min. Onder monsters aan SDS PAGE en overdracht, blokkeren vervolgens in 5% melk / PBS gedurende 2 uur. Voer western blot-analyse gevolgd door incubatie met KLF4 antilichamen (1: 500) O / N bij 4 ° C.

Representative Results

Colon weefsel secties werden verwerkt voor histologische beoordeling en H & E kleuring 13. Een traditioneel dwarsdoorsnede aanzicht van het slijmvlies wordt gezien in figuur 2A. Basale gebieden bevatten de muscularis externa, bestaat voornamelijk van de circulaire muscularis. Uitgaande naar het lumen, de muscularis mucosa blijkt naast de crypte-base epitheelcellen, overgangscellen in het midden van het weefsel, en tenslotte oppervlak celpopulaties staan ​​de darmlumen. De seriële snijden hier beschreven methode houdt een zodanige oriëntatie dat de longitudinale en circulaire muscularis eerst worden aangetroffen (figuur 2B), gevolgd door de muscularis mucosa (figuur 2C). Let op het uiterlijk van de niet-spier interstitiële cellen in de linkerbovenhoek van de afbeelding. Voor de hieronder beschreven downstream analyse worden spieren gedeelten verwijderd. De volgende paragrafen bevatten epitheliale cellen en bindweefsel (lamina propria), Uitgaande van de crypte-base cellen (Figuur 2D). Let op de afwezigheid van een centraal lumen in de meeste van de crypten, die donkerder vanwege de dicht gepakte kernen. Deze lagen bevatten het proliferatieve compartiment. De overgangsregeling cellen lijken zo dicht opeengepakte klieren met prominente centrale lumen (figuur 2E). Tenslotte oppervlak celpopulaties een onregelmatige structuur met gebieden van de epitheliale monolaag bekeken en vlak (figuur 2F).

Seriële secties zoals hierboven beschreven kunnen ook worden verwerkt voor immunofluorescentie labeling en confocale microscopie (zoals hier beschreven 14). Figuur 2G toont geïsoleerd crypten gefixeerd en permeabel gemaakt in 100% methanol en daarna gekleurd voor kernen (blauw) en de cel-cel junction eiwit Zonula occludens 1 (ZO-1, groen). In de traditionele snijden oriëntatie, kunnen crypte en het oppervlak cel tegelijkertijd bekeken worden (figuur 2G (figuur 2G). Enhanced ZO-1 kleuring wordt gezien in oppervlakte celpopulaties (figuur 2I en J).

Verschillende differentiatiefactoren is bekend dat expressie in een tijdruimtelijke wijze langs de crypte-grond as. Dit omvat de transcriptiefactor Krüppel-achtige factor 4 (KLF4), waarvan bekend is verrijkt in oppervlakte celpopulaties. Gewone snijden werkwijzen wordt KLF4 gevonden in de kernen van de holte gericht oppervlak celpopulaties (Figuur 2K). We speculeerden ook dat KLF4 mRNA voornamelijk zou worden uitgedrukt in het oppervlak cel populaties. Om dit te testen, werden seriële secties verzameld en gegroepeerd in oppervlaktewater, overgangs- en crypte-base monsters. Subsequently, RNA werd geoogst onder toepassing van standaard Trizol extractie, een extra zuivering door RNeasy kolom en DNAse behandeling. RNA werd uit 5 samengevoegd opeenvolgende secties, die opleverde tussen 5-10 ug totaal RNA per monster. Deze monsters werden daarna onderworpen aan semi-kwantitatieve real time PCR voor zowel KLF4 en een referentie-gen, TATA box bindend eiwit 1 (TBP-1) (Figuur 2L) 14. Zoals getoond in figuur 2L, in normaal op TBP-1, huidcellen bleken te drukken tot 8 maal de KLF4 mRNA dat tot expressie in cryptcellen. Ook werden KLF4 eiwit niveaus gevonden ruimtelijke regelgeving langs de crypte-oppervlak as vertonen. Seriële secties werden verzameld zoals hierboven beschreven en vervolgens geïncubeerd in lysisbuffer gedurende 20 minuten bij 4 ° C. Dit leverde tussen 200-250 ug eiwit per monster. Monsters werden vervolgens onderworpen analyse met SDS-PAGE (Figuur 2M) 15. Zoals getoond in figuur 2M, KLF4 pProtein niveaus zijn dramatisch hoger in oppervlak celpopulaties. Bovenstaande resultaten tonen het vermogen van dit protocol om grote hoeveelheden oppervlak crypte epitheelcellen isoleren van de murine colon mucosa.

Figuur 1
Figuur 1: (A) schematische weergave van murine colon mucosa en uitwendige spierlagen. Onze methode is gericht op discrete oppervlak cel en crypte-base celpopulaties verzamelen door serial cryosectioning (10 urn elk). De uitwendige spierlagen worden verwijderd. (B) Crypt hoogte varieert over de lengte van het colon (afstand tussen de crypte-base en oppervlaktelagen). Gegevenspunten geven individuele crypte metingen en symbolen biologische repliceert (n = 4). (C) Colon segmenten verzameld, doorsneden en gespeld op een silicium ontleden schotel. (D) een tissue segment ongeveer 3 cm van de anus wordt geperst tussen twee scheermesjes en bevroren op droog ijs. (E) Weefsel wordt daarna aangebracht op een vooraf verdiepingen oktober block. (F) Weefsel secties verwijderd en visueel geïnspecteerd.

Figuur 2
Figuur 2:. Representatieve gegevens (A) darmweefsel gekleurd met hematoxyline-eosine in doorsnede toont de cirkelvormige muscularis (cm), de muscularis mucosa (mm), crypt-base cellen overgangscellen en huidcellen. (B - C) colon spieren lagen. (D) Crypt-base cellen. Let op de afwezigheid van een centraal lumen. (E) Transitional cellen. (F) Oppervlakte cellen. (G) Immunofluorescentiekleuring van geïsoleerde colon crypten. ZO-1 (groen) en kernen (blauw) worden waargenomen in doorsnede. (HOI) ZO-1 en de nucleaire kleuring in overgangs- en huidcellen. (J) vergrote weergave van ZO-1 kleuring. (K) KLF4 (groen) is verrijkt in oppervlakte celpopulaties. (L) real-time PCR beoordeling van KLF4 mRNA niveaus tussen de drie compartimenten. (M) Western blot analyse van KLF4 eiwitniveaus in deze celpopulaties.

Discussion

De moleculaire mechanismen dikke epitheelcel proliferatie en differentiatie slecht begrepen. Dit omvat hiaten in ons begrip van de cellulaire signalering omgeving van het stamcelcompartiment aan de onderkant van de colon epitheliale crypten. Er is ook een toenemende belangstelling voor de processen die enterocyt differentiatie ten grondslag liggen. Bijvoorbeeld, beter begrip van in vivo differentiatie nodig is als een benchmark voor studies gericht op de productie van in vitro primaire intestinale systemen 16.

De bovenstaande procedure bevat een aantal stappen die extra aandacht nodig hebben. Ten eerste, het verwijderen van de randen rond het bevroren weefsel segment (zoals besproken in paragraaf 3.2) is vereist als het weefsel randen krullen tijdens dissectie en invriezen. Het niet deze randen resultaat bewegen een gemengde populatie van oppervlakte- en crypte base cellen. Montage van het weefsel op een pre-gekoelde, genivelleerd oktober blok is ook essentieel. TZijn protocol kan naar andere delen van het distale colon worden aangepast door het veranderen van het aantal secties in elke pool. Bijvoorbeeld, zoals getoond in figuur 1B, mucosale crypte lengte varieert tussen 150-300 pm. Daarom, bij het bestuderen van het gebied tussen 4 cm-6 cm van de anus, het aantal onderdelen moet worden verhoogd van 15 tot 30. Belangrijk is dat dit protocol niet aanbevolen aan het proximale colon (7 cm-9 cm) als gevolg van vouwen ( plicae obliquae) die zich uitstrekken in het lumen waardoor het onmogelijk aparte ondergrond en crypte-base cellen door seriële snijden.

Seriële coupes technieken gebruikt om crypt-base bestuderen en oppervlakte epitheliale celpopulaties bij de mens. Echter, ons protocol voegt extra stappen die vereist zijn vanwege de kleine omvang van murine weefsel. Wij stellen voor dat de bovenstaande protocol zal zorgen voor het onderzoek van de crypte-base en oppervlak epitheliale cel populatie in genetisch handelbaar muis systemen. Inderdaad, samengevoegd secties Yield hoogwaardige eiwitten en RNA geschikte downstream-analyse. Toekomstige toepassingen kan de studie van de cel signaalroutes of chromatine immunoprecipitatie bevatten. Er moet echter worden opgemerkt dat, evenals een aantal van de alternatieve werkwijzen die hierboven zijn beschreven, het resulterende hoofdstukken wordt een mengsel van epitheel- en interstitiële lamina propria cellen. Concluderend, de hier beschreven protocol verschaft een snelle, hoge opbrengst voor de analyse van moleculaire processen in ruimtelijk afzonderlijke gebieden van het murine colon mucosa.

Materials

Name Company Catalog Number Comments
Microtome Leica Biosystems, Nussloch Germany CM 1510-3
MyiQ real time PCR detector BioRad
LSM 510  Carl Zeiss Confocal microscope
OCT Tissue-Tek, Sakura Finetek, Torrance CA 4583
cryo-mold Tissue-Tek, Sakura Finetek, Torrance CA 4557 25mmx20mmx5mm
High profile microtome blade Leica Biosystems, Nussloch germany 818
GEM industrial blades American Safety Razor Blades 62-0314
Sylgard silicon elastomere base Dow Corning, Midland MI 3097358
27 1/2 g needle Becton-Dickinson, Franklin Lakes, NJ 305109 pins for dissection
TRizol Life Technologies 15596018
Rneasy Qiagen 74104
DNAse Qiagen 79254
Antibody ZO-1 Invitrogen  187430
Antibody KLF4 Cell Signaling 4038S
Antibody mGAPDH Sigma G8795
Antibody Secondary Alexa conjugate Invitrogen A11034 488 anti-rabbit
Antibody Secondary HRP conjugate Jackson 111/115-001-003 rabbit/mouse 
Topro-3 Invitrogen T3605
HANKs balanced salt buffer Life Technologies 14025092
RIPA lysis buffer 50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate
primer TBP 3' GGAATTGTACCGCAGCTTCAAA
primer TBP 5' GATGACTGCAGCAAATCGCTT
primer KLF4 3' TGTGACTATGCAGGCTGTGGCAAA
primer KLF4 5' ACAGTGGTAAGGTTTCTCGCCTGT

DOWNLOAD MATERIALS LIST

References

  1. Noah, T. K., Donahue, B., Shroyer, N. F. Intestinal development and differentiation. Exp Cell Res. 317, 2702-2710 (2011).
  2. Humphries, A., Wright, N. A. Colonic crypt organization and tumorigenesis. Nat Rev Cancer. 8, 415-424 (2008).
  3. Weber, C. R., Turner, J. R. Inflammatory bowel disease: is it really just another break in the wall. Gut. 56, 6-8 (2007).
  4. Bjerknes, M., Cheng, H. Methods for the isolation of intact epithelium from the mouse intestine. Anat Rec. 199, 565-574 (1981).
  5. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  6. Rand, M. D., et al. Calcium depletion dissociates and activates heterodimeric notch receptors. Mol Cell Biol. 20, 1825-1835 (2000).
  7. Gjorevski, N., Boghaert, E., Nelson, C. M. Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues. Cancer Microenviron. 5, 29-38 (2012).
  8. Lechner, S., et al. Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia. Gut. 52, 1148-1153 (2003).
  9. Reizel, Y., et al. Colon stem cell and crypt dynamics exposed by cell lineage reconstruction. PLoS Genet. 7, e1002192 (2011).
  10. Kosinski, C., et al. Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors. Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).
  11. Tamura, S., et al. Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm. J Gastroenterol. 37, 798-806 (2002).
  12. Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. Isolation and characterization of dendritic cells and macrophages from the mouse intestine. Journal of visualized experiments : JoVE. e4040 (2012).
  13. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  14. Neumann, P. A., et al. Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon. Am J Pathol. 184, 592-599 (2014).
  15. Capaldo, C. T., et al. Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins. Mol Biol Cell. 25, 2710-2719 (2014).
  16. Wells, J. M., Spence, J. R. How to make an intestine. Development. 141, 752-760 (2014).
Cryosectioning Methode voor Microdissection van Murine colonslijmvlies
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).More

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter