Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Cryosectioning שיטה לMicrodissection של Murine גס רירית

doi: 10.3791/53112 Published: July 12, 2015

Introduction

בטנת אפיתל במעי הגס היא רקמת משובי מאוד, עם תאי גזע תושב חידוש הרקמות כל כמה ימים 1. תהליך זה של התחדשות דורש התחזוקה של תא בתאי גזע שגשוג. במשך זמן, תאי בת פיק החדש יאבדו פוטנציאל השגשוג ונודדים לעבר פני השטח luminal של המעי. ביחד עם הגירה, ותאים להתמיין enterocytes יוצרי מחסום בוגר או תאי גביע ייצור ריר. כישלון של תכנית בידול זה חשב לתרום להתפשר מחסום האפיתל כגון נצפה במחלת מעי דלקתית וסרטן מעי גס 2,3.

מחקר מפורט של התהליכים לעיל דורש מתודולוגיות לבידוד אוכלוסיות קריפטה-בסיס ותאי שטח. מספר שיטות קיימות, כל אחד עם יתרונות וחסרונות ייחודיים. שיטות קיימים לבידוד של תאי אפיתל במעי כוללות פרקסוכנים, מרומם רוח וניתוק מכאני, וכתוצאה מכך הבידוד של מאורות כל, גיליונות אפיתל, או תאים בודדים, תלויים ב4,5 תנאי ניסוי. אלה הם שיטות תשואה גבוהות, אך שינויים באיתות אינטר כבר דיווחו בתנאים אלה שלא יכולים לייצג את הסביבה המקומית 6,7. microdissection ללכוד לייזר מאפשר לאיסוף חומר שונה במרחב, אבל משיג תשואת 8,9 מולקולרי נמוכה. ברקמת מעי הגס אנושית, שיטות cryosectioning אופקיים סידוריים פותחו 10. עם זאת, רקמות הריריות עכברית הן להחריד קטנות לניכוס ישיר של טכניקה זו. בבני אדם, באורכי קריפטה מעיים (הרחוקים בין הכוך-הבסיס ותאי שטח) במעי הגס נע בין 100-1,000 ~ מיקרומטר 11. בעכברים, אורכי קריפטה הם בין 50-300 ~ מיקרומטר (ראו איור 1 א). הגודל הקטן של מאורות עכברי מציב אתגר לIsolation של שתי אוכלוסיות תאים אלה תוך שימוש בפרוטוקולים קיימים.

עכשיו אנו מתארים בעלות נמוכה, שיטת תשואה גבוהה לבידוד של קריפטה-בסיס ומשטח אוכלוסיית תאי אפיתל במעי הגס רקמה עכברית. רקמה שנקטפו באופן זה עשויה אז להיות מנותח על ידי מספר היישומים במורד הזרם סטנדרטיים, כוללים מכתים immunofluorescence, RT-PCR (תגובת שרשרת זמן-פולימראז ריאל) או מערבי סופג.

Protocol

ניסויים בשימוש C57BL / 6 עכברים בין 10 ל 12 שבועות של גיל. כל נהלי שימוש בבעלי חיים היו נבדקו ואושרו על ידי ועדת אמורי האוניברסיטה המוסדית טיפול בבעלי חיים והשימוש ובוצעו על פי המכון הלאומי לבריאות בקריטריונים.

1. התקנה ניסיונית

  1. הגדרת cryostat
    1. לאזן cryostat ל -20 מעלות צלזיוס, כולל להב microtome ותרמילים (זהירות קיצונית סביב הלהב!).
    2. מלא cryomold ריק עם אוקטובר (מתחם טמפרטורה אופטימלי חיתוך) ולאזן לC -20 ° (~ 30 דקות). הסר ב- OCT הקפואה מהתבנית ולתקן אותה על צ'אק עם אוקטובר הנוזלי. מניחים את הגוש / צ'אק בזרוע microtome ולאפשר ב- OCT להגדיר במשך 10 דקות.
    3. הגדר את cryostat עד 10 מיקרומטר לכל סעיף ולגלח את בלוק אוקטובר עד שהוא שטוח. חזרה זרוע microtome מהלהב בכמה סנטימטרים. בשלב זה לא להתאים את הלהב או צ'אק לשארית experiment.
  2. הכן את סכיני גילוח: הכן 2 סכיני גילוח לדגימה. באמצעות קובץ מתכת, משעמם קצה sharped של להבים. בשלב הבא, להסיר את אוגן האלומיניום עם מלקחיים.
  3. טרום צמרמורת צלחת פיירקס או משטח שטוח אחר על קרח יבש.
  4. הכן צלחת לנתיחה עם 10-15 סיכות לנתיחה. 50% צלחת תרבית רקמת 10 סנטימטרים מלאים בסיליקון יספיקו. הוסף 5 מיליליטר של חיץ הנקס ב RT.

2. Dissection של רקמות המעי הגס דיסטלי

  1. מקום עכברים בתא אטום ועכברים להרדים משאיפת isoflurane ונקע בצוואר הרחם, ולאחר מכן לרסס אתנול 70% על 12 הבטן ובית החזה.
  2. לעשות חתך קטן בעור של הבטן עם מספריים ולאחר מכן לבצע חתך על מנת לחשוף את חלל הצפק. ניתן למצוא נהלים דומים מתואר כאן 12.
  3. חותך את המעי גס בסף האנאלי ולהפריד לפדר עד למעי הגס ללא תשלום.
  4. בלו מעי גס דיסטליקטע שבין 0 ל- 6 סנטימטר מהטבעת. כאן, עומק קריפטה הוא ~ 150 מיקרומטר (ראה איור 1). לחתוך את המעי הגס longitudinally באמצעות מספריים ולהסיר את תוכן הצואה.
  5. הצמד את הרקמה לצלחת לנתיחה עם המשטח הרירי פונה כלפי מעלה. למתוח את הסיכות לנתיחה רקמות באמצעות על צלחת סיליקון במאגר הנקס ולתת מנוחה במשך 10 דקות ב RT (איור 1 ג). זה מסיר קפלים מרקמות ומאפשר שכבות השרירים להירגע.

3. רקמות הר על cryostat עבור חתך

  1. להחליק בסכין גילוח בחלק הרצוי של רקמה ואז לשפוך את חיץ הנקס. להוסיף סכין גילוח אחר לראש, מה שהופך את כריך. חותך את קטע הרקמה ולהסיר את הסיכות. העבר את כריך סכין גילוח / רקמה לקרח יבש. לאפשר לרקמות להקפיא (5-10 דקות, 1D איור).
  2. להרים את סכין הגילוח / כריך רקמות ולאפשר לו להתחמם מעט על ידי הנחת אצבע על BL העליוןADE (צד רירית עד. זה מכוון את הרקמה, כך ששכבות שרירים בסיסיות הם מחולק ראשונה.). הפרד את הכריך ולחתוך מסביב לקצוות של מגזר הרקמה. לחתוך קטע רקמה כ, x 1 סנטימטר על 0.5 סנטימטר. יש אזורי קצה נטייה להתכרבל, גורם לחלקים הסידוריים להכיל שכבות רקמה רבות. שים לב שנגמר חיתוך טוב יותר מאשר בחיתוך, כך לטעות בצד של זהירות.
  3. לאפשר לרקמות לחמם עד הקרח על גבי הרקמה מתחיל להפשיר. בשלב זה לחץ במהירות ובזהירות את הרקמה לתוך בלוק אוקטובר בcryostat.
  4. הסר את הלהב על ידי הנחת אצבע על המדגם. העברת החום תאפשר לך להסיר את הלהב מבלי לשבש את הרקמה.
  5. מעיל הרקמה עם אוקטובר ולאזן במשך 5 דקות. חותך סעיפים 10 מיקרומטר ב( איור 1E, F). ראייה לבדוק את החלקים עד מאורות נראים. סעיפי מקום בצינורות 1.5 מיליליטר או בשקופיות.
  6. לניתוח של mRNA או חלבון, לא מקוםהוא דגימות בצינורות עם 5 קריפטה-בסיס, 5 מעבר, וסעיפי 5 לכל צינור פני השטח. לאוסף RNA להוסיף 1 מיליליטר מגיב בידוד מסחרי ולדגור על RT במשך 10 דקות. לבצע טיהור RNA על פי הוראות יצרן. השתמש 5-10 מיקרוגרם של רנ"א הכל לדור cDNA.
  7. לטיהור חלבונים, להוסיף 0.5 מיליליטר של Ripa הקר תמוגה חיץ (בתוספת מעכבי פרוטאז) לכל 5 חלקים. Sonicate 3 פעמים במחזור של 70%, על קרח.
    1. להוסיף דגימות למאגר SDS טעינת עמוד (חיץ Laemmli) ולדגור על 100 מעלות צלזיוס במשך 10 דקות. דגימות בכפוף לעמוד SDS והעברה, ואז לחסום ב5% חלב / PBS עבור שעה 2. ביצוע ניתוח מערבי כתם ואחריו דגירה עם נוגדני KLF4 (1: 500) O / N ב 4 מעלות צלזיוס.

Representative Results

קטעי רקמת מעי הגס עובדו להערכה היסטולוגית ו- H & E מכתים 13. צפה בחתך מסורתי של הרירית נראה באיור 2 א. אזורים בסל מכילים פנימית וחיצוני muscularis, מורכב בעיקר מmuscularis המעגלי. ימשיך לכיוון הלום, רירית muscularis ניכרה בסמוך לתאי האפיתל קריפטה-בסיס, תאי מעבר נמצאים באמצע של הרקמה, ובסופו אוכלוסיות תאי שטח, להתמודד לומן המעי. שיטת חתך הסידורי המתוארת כאן שומרת על נטייה כזו שmuscularis האורך והחוזר נתקל לראשונה (איור 2), ואחריו את רירית muscularis (איור 2 ג). שים לב למראה של תאי ביניים שאינם שריר בחלק השמאלי העליונה של התמונה. לניתוח במורד הזרם מתואר להלן, סעיפי שריר מבוטלים. הסעיפים הבאים מכילים תאי אפיתל ורקמת ביניים (propria lamina), החל בתאי קריפטה-הבסיס (איור 2 ד). שים לב להעדרו של לומן מרכזי ברוב מאורות, המופיעים כהה יותר בשל הגרעינים הצפופים. שכבות אלה מכילים תא השגשוג. תאי המעבר מופיעים כצפופים בלוטות עם לומן בולט מרכזי (2E איור). לבסוף, יש לי אוכלוסיות תאי שטח מבנה לא סדיר, עם אזורים של monolayer אפיתל נצפה en פנים (איור 2F).

סעיפים סידוריים כפי שתואר לעיל עשויים גם להיות מעובד לתיוג immunofluorescence ומיקרוסקופיה confocal (כפי שמתוארים כאן 14). איור 2G תערוכות מאורות מבודדים הקבועים וpermeabilized במתנול 100% ולאחר מכן מוכתמים לגרעינים (כחול) וחלבון צומת תאי תאי Zonula Occludens 1 (הסתדרות ציונית-1, ירוקה). בכיוון חתך המסורתי, תא קריפטה ומשטח ניתן לצפות בו זמנית (איור 2G (איור 2G). כתם ZO-1 משופר נראה באוכלוסיות תאי שטח (איור ט 2 וי).

גורמי בידול כמה ידועים להתבטא באופנת spatiotemporal לאורך ציר קריפטה-קרקע. זה כולל את הגורם כמו-Kruppel גורם שעתוק 4 (KLF4), אשר ידוע להיות מועשרים באוכלוסיות תאי שטח. שימוש בשיטות מסורתיות חתך, KLF4 נמצא בגרעינים של לומן מול אוכלוסיות תאי שטח (איור 2K). לפיכך, אנו מעריכים כי KLF4 mRNA יתבטא בעיקר באוכלוסיות תאי שטח. כדי לבדוק זאת, סעיפים סידוריים נאספו וקובצו לדגימות פני השטח, וכוך-בסיס מעבר. Subsequently, RNA היה לקצור באמצעות מיצוי Trizol סטנדרטי, עם טיהור נוספת על ידי טור RNeasy וטיפול DNAse. RNA נאסף מסעיפים 5 רצופים ונקווה, שהניבו בין 5-10 מיקרוגרם של RNA הכולל לדגימה. דגימות אלה אז היו נתונים בזמן אמת חצי כמותית PCR לשני KLF4 וגן התייחסות, חלבון TATA תיבה מחייבת 1 (TBP-1) (איור 2L) 14. כפי שניתן לראות באיור 2L, לאחר הנורמליזציה לTBP-1, תאי שטח נמצאו להביע עד 8 ​​פעמים mRNA KLF4 שבאו לידי ביטוי בתאי קריפטה. כמו כן, רמות חלבון KLF4 נמצאו להציג רגולציה המרחבי לאורך ציר קריפטה-פני השטח. סעיפים סידוריים היו נקווים כמתואר לעיל ולאחר מכן מודגרות במאגר תמוגה במשך 20 דקות ב 4 מעלות צלזיוס. זה הניב בין 200-250 מיקרוגרם של חלבון לכל מדגם. דוגמאות אז היו נתונים ניתוח על ידי SDS-עמוד (איור 2M) 15. כפי שניתן לראות באיור 2M, עמ 'KLF4רמות rotein הן דרמטית גבוהות יותר באוכלוסיות תאי שטח. הממצאים לעיל מדגימים את היכולת של פרוטוקול זה לבודד את הכמויות גדולות של פני השטח ותאי אפיתל קריפטה מרירית המעי עכברית.

איור 1
איור 1: (א) רירית מראה סכמטי עכברית מעי הגס ושכבות שרירים חיצוניות. השיטה שלנו שואפת לאסוף אוכלוסיות תאי תא השטח וקריפטה-בסיס דיסקרטיים על ידי cryosectioning הסידורי (10 מיקרומטר כל אחד). שכבות השרירים חיצוניות מבוטלים. גובה (B) קריפטה משתנה לאורכו של המעי הגס (מרחק בין שכבות קריפטה-בסיס ומשטח). נקודות הנתונים מצביעות על מדידות קריפטה בודדות וסימנים מצביעים על משכפל ביולוגי (n = 4). מגזרים (C) קולון נאספו, נחצה, והצמידו על צלחת סיליקון לנתח. רקמה (ד) segment כ 3 סנטימטר מהטבעת נלחץ בין לסכיני גילוח וקפוא בקרח יבש. רקמות (E) אז רכובים על בלוק אוקטובר-מפולס מראש. (F) cryosections יוסרו ובחינה חזותית.

איור 2
איור 2:. נציגי נתונים () רקמת המעי הגס מוכתמת Hematoxylin-Eosin בחתך מראה את muscularis העגול (סנטימטר), רירית muscularis (מ"מ), תאי קריפטה-בסיס, תאי מעבר, ותאי שטח. - ג) שכבות שרירים מעי הגס. (ד) תאי קריפטה-בסיס. שים לב להעדרו של לומן מרכזי. (ה) תאים מעבר. (F) תאי שטח. הכתמה (G) Immunofluorescence של מאורות מעי הגס מבודדים. ZO-1 (ירוק) וגרעינים (כחולים) הם נצפו בחתך. (HI) ZO-1 וצביעה בגרעין תאי מעבר ומשטח. תצוגה מוגדלת של מכתים ZO-1 (J). (K) KLF4 (ירוק) מועשר באוכלוסיות תאי שטח. בזמן אמת הערכת PCR של רמות KLF4 mRNA בין שלושה התאים (L). ניתוח כתם מערבי של רמות חלבון KLF4 באוכלוסיות תאים אלה (M).

Discussion

המנגנונים המולקולריים המעורבים בהפצה הגס אפיתל תאים והתמיינות הם הבינו היטב. זה כולל פערים בהבנה של סביבת האיתות התאית של התא בתאי גזע בבסיס מאורות אפיתל במעי הגס שלנו. יש גם עניין גובר בתהליכים שבבסיס בידול האנתרוציט. לדוגמא, עלה הבנה של הבידול בvivo נדרשת כאמת מידה למחקרים שמטרתם לייצר במבחנה מערכות מעיים עיקריות 16.

ההליך שלעיל כולל מספר צעדים שדורשים תשומת לב נוספת. ראשית, הסרת הקצוות סביב קטע הרקמה הקפוא (כאמור בסעיף 3.2) נדרש כקצות רקמת התלתל במהלך נתיחה והקפאה. כישלון להעביר תוצאות קצוות אלה הוא אוכלוסייה מעורבת של תאי שטח ובסיס קריפטה. ההרכבה הרקמה באוקטובר לחסום מראש צונן, מפולס היא גם חיונית. Tהפרוטוקול שלו יכול להיות מותאם לאזורים אחרים של מעי גס דיסטלי על ידי שינוי מספר הסעיפים בכל בריכה. לדוגמא, כפי שמוצג באיור 1, אורך קריפטה רירית משתנה בין 150-300 מיקרומטר. לכן, כאשר לומדים את האזור שבין 4 ס"מ 6 סנטימטר מפי הטבעת, מספר סעיפים צריך להיות מוגבר בין 15 ל 30. חשוב לציין, פרוטוקול זה לא מומלץ למעי הגס הפרוקסימלי (7 ס"מ 9 סנטימטרים) בשל קפלים ( plicae obliquae) המשתרעת לתוך הלום שהופך אותו בלתי אפשרי לתאי שטח וקריפטה-בסיס נפרדים על ידי חתך סדרתי.

טכניקות חתך סידוריים שימשו ללמוד קריפטה-בסיס ומשטח אוכלוסיות תאי אפיתל בבני אדם. עם זאת, הפרוטוקול שלנו מוסיף צעדים נוספים הנדרשים בשל גודלו הקטן של רקמה עכברית. אנו מציעים כי בפרוטוקול לעיל יאפשר לחקירת קריפטה-בסיס ואוכלוסיית תאי אפיתל פני השטח במערכות עכבר גנטי צייתנית. ואכן, חלקים נקוו yieחלבון LD באיכות גבוהה וניתוח במורד הזרם המתאים RNA. יישומים עתידיים יכולים לכלול המחקר של מסלולי איתות תא או immunoprecipitation הכרומטין. עם זאת, יש לציין כי, כמו כמה מהשיטות חלופיות שתוארו לעיל, וכתוצאה מכך החלקים מכילים תערובת של תאי אפיתל propria lamina וביניים. לסיכום, הפרוטוקול המתואר כאן מספק שיטה מהירה, תשואה גבוהה לניתוח תהליכים מולקולריים באזורים במרחב המובהקים של רירית המעי עכברית.

Materials

Name Company Catalog Number Comments
Microtome Leica Biosystems, Nussloch Germany CM 1510-3
MyiQ real time PCR detector BioRad
LSM 510  Carl Zeiss Confocal microscope
OCT Tissue-Tek, Sakura Finetek, Torrance CA 4583
cryo-mold Tissue-Tek, Sakura Finetek, Torrance CA 4557 25mmx20mmx5mm
High profile microtome blade Leica Biosystems, Nussloch germany 818
GEM industrial blades American Safety Razor Blades 62-0314
Sylgard silicon elastomere base Dow Corning, Midland MI 3097358
27 1/2 g needle Becton-Dickinson, Franklin Lakes, NJ 305109 pins for dissection
TRizol Life Technologies 15596018
Rneasy Qiagen 74104
DNAse Qiagen 79254
Antibody ZO-1 Invitrogen  187430
Antibody KLF4 Cell Signaling 4038S
Antibody mGAPDH Sigma G8795
Antibody Secondary Alexa conjugate Invitrogen A11034 488 anti-rabbit
Antibody Secondary HRP conjugate Jackson 111/115-001-003 rabbit/mouse 
Topro-3 Invitrogen T3605
HANKs balanced salt buffer Life Technologies 14025092
RIPA lysis buffer 50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate
primer TBP 3' GGAATTGTACCGCAGCTTCAAA
primer TBP 5' GATGACTGCAGCAAATCGCTT
primer KLF4 3' TGTGACTATGCAGGCTGTGGCAAA
primer KLF4 5' ACAGTGGTAAGGTTTCTCGCCTGT

DOWNLOAD MATERIALS LIST

References

  1. Noah, T. K., Donahue, B., Shroyer, N. F. Intestinal development and differentiation. Exp Cell Res. 317, 2702-2710 (2011).
  2. Humphries, A., Wright, N. A. Colonic crypt organization and tumorigenesis. Nat Rev Cancer. 8, 415-424 (2008).
  3. Weber, C. R., Turner, J. R. Inflammatory bowel disease: is it really just another break in the wall. Gut. 56, 6-8 (2007).
  4. Bjerknes, M., Cheng, H. Methods for the isolation of intact epithelium from the mouse intestine. Anat Rec. 199, 565-574 (1981).
  5. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  6. Rand, M. D., et al. Calcium depletion dissociates and activates heterodimeric notch receptors. Mol Cell Biol. 20, 1825-1835 (2000).
  7. Gjorevski, N., Boghaert, E., Nelson, C. M. Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues. Cancer Microenviron. 5, 29-38 (2012).
  8. Lechner, S., et al. Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia. Gut. 52, 1148-1153 (2003).
  9. Reizel, Y., et al. Colon stem cell and crypt dynamics exposed by cell lineage reconstruction. PLoS Genet. 7, e1002192 (2011).
  10. Kosinski, C., et al. Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors. Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).
  11. Tamura, S., et al. Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm. J Gastroenterol. 37, 798-806 (2002).
  12. Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. Isolation and characterization of dendritic cells and macrophages from the mouse intestine. Journal of visualized experiments : JoVE. e4040 (2012).
  13. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  14. Neumann, P. A., et al. Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon. Am J Pathol. 184, 592-599 (2014).
  15. Capaldo, C. T., et al. Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins. Mol Biol Cell. 25, 2710-2719 (2014).
  16. Wells, J. M., Spence, J. R. How to make an intestine. Development. 141, 752-760 (2014).
Cryosectioning שיטה לMicrodissection של Murine גס רירית
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).More

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter