Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Cryosectioning Metode for mikrodisseksjon av Murine Kolon Mucosa

doi: 10.3791/53112 Published: July 12, 2015

Introduction

Colonic epitelbelegg er en svært regenerativ vev, med bosatt stamceller påfyll av vev hver dagene en. Denne prosessen med regenerering krever opprettholdelse av en proliferativ stamcellelinjen. Over tid vil de nylig produserte dattercellene mister sin proliferative potensial og migrere mot den luminale overflate av tarmen. Sammenfallende med migrasjon, stamceller differensieres til modne barrieredannende enterocytter eller slimete produserer slimceller. Svikt i denne differensiering programmet er antatt å bidra til nedsatt epitele barrieren som er observert i inflammatorisk tarmsykdom og kreft i tykktarmen 2,3.

Detaljert studie av de ovennevnte prosessene vil kreve metoder for å isolere krypten-base og overflatecellepopulasjoner. Flere metoder eksisterer, hver med unike fordeler og ulemper. Aktuelle fremgangsmåter for isolering av intestinale epitelceller omfatter chelating midler og mekanisk dissosiasjon, noe som resulterer i isolering av hele krypter, epiteliale ark, eller enkle celler, avhengig av eksperimentelle betingelser 4,5. Dette er høyrente metoder, men endringer i intersignale har blitt rapportert under disse forholdene som kanskje ikke representerer det opprinnelige miljø 6,7. Laser fange microdissection tillater innsamling av romlig distinkt materiale, men oppnår lav molekyl utbytte 8,9. I menneskelig kolonvev, har serie horisontale cryosectioning utviklet metoder 10. Men murine slimhinnevevene er uoverkommelig liten for direkte anvendelse av denne teknikken. Hos mennesker intestinal krypten lengder (den fjernt mellom krypten-basen og overflateceller) i tykktarmen varierer mellom ~ 100-1.000 mikrometer 11. I mus, krypten lengder er mellom ~ 50-300 mikrometer (se figur 1A). Den lille størrelsen på muse krypter presenterer en utfordring til isolasjon av disse to cellepopulasjoner ved å bruke eksisterende protokoller.

Vi beskriver nå en lav kostnad, høyt utbytte metode for isolering av krypten-base og overflaten epitelial cellepopulasjonen i murine tarmvev. Tissue høstet på denne måten kan deretter bli analysert ved en rekke standard nedstrøms applikasjoner, inkludert immunfluorescens farging, RT-PCR (Real Time-Polymerase Chain Reaction), eller Western blotting.

Protocol

Eksperimenter brukte C57BL / 6 mus mellom 10 og 12 ukers alder. Alle prosedyrer ved hjelp av dyrene ble gjennomgått og godkjent av Emory University Institutional Animal Care og bruk komité og ble utført i henhold til National Institutes of Health kriterier.

1. Forsøksoppsett

  1. Sett opp Cryostat
    1. Likevekt kryostat til -20 ° C, inkludert mikrotomen bladet og chucks (utvise ekstrem forsiktighet rundt bladet!).
    2. Fylle en tom cryomold med OCT (Optimal Cutting Temperature sammensatte) og likevekt til -20 ° C (~ 30 min). Fjern den frosne oktober fra formen og fikse det på chuck med væske oktober Plasser blokk / chuck på mikrotomen armen og la OCT å sette i 10 minutter.
    3. Sett kryostat til 10 mikrometer per seksjon og barbere OCT blokken til den er flat. Sikkerhets mikrotomen armen bort fra bladet med flere centimeter. På dette punktet ikke justerer bladet eller chuck for resten av experform.
  2. Forbered barberblad: Forbered to barberblad per prøve. Ved hjelp av en metall-fil, kjedelig sharped kanten av bladene. Deretter fjerner flensen aluminium med tang.
  3. Pre-chill en Pyrex tallerken eller annet flatt underlag på tørris.
  4. Forbered en disseksjon parabolen med 10-15 disseksjon nålene. En 10 cm vevskulturskål 50% fylt med silisium vil være nok. Tilsett 5 ml Hanks buffer ved RT.

2. Disseksjon av Distal kolonvev

  1. Plasser mus i et forseglet kammer og avlive mus ved inhalering isofluran og cervikal dislokasjon, og deretter sprøyte 70% etanol på abdomen og thorax 12.
  2. Lag et lite snitt i huden på magen med saks og deretter gjøre et snitt å avsløre bukhulen. Lignende prosedyrer finnes beskrevet her 12.
  3. Skjær tykktarmen ved analåpningen og erte hverandre mesenterium til tykktarmen er gratis.
  4. Skjære en distal kolonsegment mellom 0 og 6 cm fra anus. Her er krypten dybde ~ 150 mikrometer (se figur 1B). Skjær åpne tykktarmen lengderetningen med saks og fjerne fecal innholdet.
  5. Pin vevet til disseksjon parabolen med slimhinneoverflaten vendt opp. Strekke vevet ved hjelp av disseksjon pins på en silisium rett i Hanks buffer og la den hvile i 10 min ved RT (figur 1C). Dette fjerner folder fra vevet og gjør det mulig for muskellagene til å slappe av.

3. Monter Tissue på Cryostat for Seksjonering

  1. Skyv et barberblad under ønsket del av vev og hell av Hanks buffer. Legg til en annen barberblad til toppen, noe som gjør en sandwich. Kutt vevet segmentet og fjerne pinnene. Overfør barberblad / vev sandwich å tørris. Tillat vevet å fryse (5-10 min, figur 1D).
  2. Plukk opp høvelen / vev sandwich og la den varmes litt ved å plassere en finger på toppen blade (mucosal siden opp. Dette orienterer vev slik at de basale muskellagene er seksjonert først.). Separer sandwich og kuttet rundt kantene av vevet segmentet. Skjær en vev segment ca, 0,5 cm x 1 cm. Kantområder har en tendens til å krølle seg, slik at seriesnitt for å inneholde mange vevslag. Legg merke til at over-skjæring er bedre enn under-skjæring, så feile på siden av forsiktighet.
  3. Tillat vevet oppvarmes inntil isen på toppen av vev begynner å smelte. På dette punkt raskt og trykk forsiktig vevet inn i oktober blokk i kryostaten.
  4. Fjern bladet ved å plassere en finger over prøven. Den varmeoverføring vil tillate deg å fjerne bladet uten å forstyrre vev.
  5. Smør vev med oktober og likevekt i 5 min. Skjær seksjoner på 10 mikrometer (Figur 1E, F). Inspiser seksjonene inntil krypter blir sett. Plasser delene i en 1,5 ml rør eller på lysbilder.
  6. For analyse av mRNA eller protein, sted than prøver i rør med 5 krypten-base, 5 overgangs, og fem overflate snitt per tube. For RNA samling legge 1 ml kommersiell isolasjon reagens og inkuber ved romtemperatur i 10 min. Utfør RNA rensing i henhold til produsentens instruksjoner. Bruk 5-10 mikrogram total RNA for cDNA generasjon.
  7. For protein rensing, tilsett 0,5 ml kaldt RIPA lysebuffer (pluss proteasehemmere) per 5 seksjoner. Sonikere tre ganger med en 70% syklus, på is.
    1. Legg prøver til SDS PAGE ladningsbuffer (Laemmli-buffer) og inkuberes ved 100 ° C i 10 min. Subject prøvene til SDS PAGE og overføring, vil blokken i 5% melk / PBS i 2 timer. Utføre Western blot-analyse etterfulgt av inkubasjon med KLF4 antistoffer (1: 500) O / N ved 4 ° C.

Representative Results

Colonic vevssnitt ble behandlet for histologisk vurdering og H & E flekker 13. En tradisjonell tverrsnittsriss av mukosa er vist i figur 2A. Basale områder inneholder muskularis externa, består hovedsakelig av de sirkulære muskularis. Ved å gå frem mot lumen, er tydelig ved siden av krypten-base-epitelceller mucosa muscularis, overgangs celler er i midten av vevet, og endelig, overflatecellepopulasjoner vender tarmlumen. Den serielle snitte metoden beskrevet her opprettholder en orientering slik at de langsgående og sirkulære muscularis er oppstått først (figur 2B), etterfulgt av mucosa muscularis (figur 2C). Oppmerksom på utseendet av ikke-muskel interstitielle celler i øverst til venstre i bildet. For nedstrøms analysen beskrevet nedenfor, blir muskel seksjoner kastes. De påfølgende avsnittene inneholder epitelceller og interstitiell vev (lamina propria), Starter med krypten-base celler (figur 2D). Legg merke til fraværet av et sentralt lumen i de fleste av krypter, som synes mørkere på grunn av de tett pakkede kjerner. Disse lagene inneholde proliferativ rommet. Overgangs celler vises som tettpakket kjertler med fremtredende sentrale lumen (figur 2E). Til slutt, overflatecellepopulasjoner ha en uregelmessig struktur, med områder av epitel monolag på en face (figur 2F).

Seriesnitt som beskrevet ovenfor, kan også bli behandlet for immunfluorescens merking og konfokal mikroskopi (som beskrevet her 14). Figur 2G viser isolerte krypter faste og permeabiliserte i 100% metanol og deretter farget for kjerner (blå) og celle-celle kryss-protein Zonula okkludens 1 (ZO-1, grønn). I den tradisjonelle seksjonering orientering, kan krypten og overflateceller sees samtidig (figur 2G (figur 2G). Enhanced ZO-en flekk er sett i overflatecellepopulasjoner (Figur 2I og J).

Flere differensieringsfaktorer er kjent for å bli uttrykt i en tid og rom langs- krypt-til-overflate akse. Dette omfatter transkripsjonsfaktor Kruppel-lignende faktor 4 (KLF4), som er kjent for å bli anriket i overflatecellepopulasjoner. Ved hjelp av tradisjonelle metoder snitt er KLF4 funnet i kjernen av hulrommet som vender mot overflaten cellepopulasjoner (figur 2K). Vi spekulerte derfor at KLF4 mRNA ville bli hovedsakelig uttrykt i overflatecellepopulasjoner. For å teste dette, ble seriesnitt samlet og gruppert i overflaten, overgangs, og krypten-base prøver. Subsequently, RNA ble høstet ved bruk av standard Trizol ekstraksjon, med en ytterligere rensing ved hjelp av RNeasy-kolonne og DNase-behandling. RNA ble oppsamlet fra 5 sammenslåtte påfølgende seksjoner som ga mellom 5-10 mikrogram total RNA per prøve. Disse prøver ble deretter utsatt for semi-kvantitativ sanntid PCR for både KLF4 og en referanse gen, TATA-boks bindende protein 1 (TBP-1) (figur 2 liter) 14. Som vist i Figur 2L, etter normalisering til TBP-1, ble overflateceller funnet å uttrykke opptil 8 ganger KLF4 mRNA som uttrykkes i celler Crypt. Tilsvarende ble KLF4 protein nivåer funnet å vise romlig regulering langs krypten-overflaten aksen. Seriesnitt ble slått sammen som beskrevet ovenfor, og deretter inkubert i lyseringsbuffer i 20 minutter ved 4 ° C. Dette ga mellom 200-250 mikrogram protein per prøve. Prøvene ble deretter underkastet analyse ved hjelp av SDS-PAGE (figur 2 M) 15. Som vist i figur 2 M, p KLF4rotein nivåene er dramatisk høyere i overflatecellepopulasjoner. De ovenfor angitte resultater demonstrerer evnen av denne protokollen for å isolere store mengder av overflate og Crypt epitelceller fra den murine kolon mukosa.

Figur 1
Figur 1: (A) viser skjematisk murine colonic slimhinnen og ytre muskellagene. Vår metode har som mål å samle diskrete overflateceller og krypten-base celle populasjoner av serie cryosectioning (10 mikrometer hver). De eksterne muskellagene kastes. (B) Crypt høyde varierer langs lengden av tykktarmen (avstanden mellom krypten-base og overflatelag). Datapunktene indikerer individuelle krypten målinger og symboler angir biologiske replikater (n = 4). (C) kolon segmenter samlet, delt i to, og festet på en silisium dissekere parabolen. (D) Et vev SEgment ca 3 cm fra anus presses mellom å barberblad og frosset på tørris. (E) Tissue er da montert på en pre-flatet oktober blokken. (F) frysesnitt blir fjernet og inspisert visuelt.

Figur 2
Fig. 2: Representative data (A) kolonvev farget med Hematoxylin-eosin i tverrsnitt som viser de sirkulære muscularis (cm), mucosa muscularis (mm), krypt-basisovergangs celler, celler og overflateceller. (B - C) kolonmuskellagene. (D) Crypt-basisceller. Legg merke til fraværet av et sentralt lumen. (E) Overgangs celler. (F) overflateceller. (G) Immunofluorescens farging av isolerte colonic krypter. ZO-1 (grønn), og kjerner (blå) er observert i tverrsnitt. (HI) ZO-1 og nukleær farging i overgangs og overflateceller. (J) forstørret bilde av ZO-1 farging. (K) KLF4 (grønn) er beriket i overflatecellepopulasjoner. (L) Real-time PCR vurdering av KLF4 mRNA nivåer mellom de tre delene. (M) Western blot-analyse av KLF4 proteinnivåer i disse cellepopulasjoner.

Discussion

De molekylære mekanismene som er involvert i colonic epithelial celleproliferasjon og differensiering er dårlig forstått. Dette omfatter hull i vår forståelse av den cellulære signale miljø av stamcellelinjen i bunnen av colonic epithelial krypter. Det er også en økende interesse for de prosessene som ligger til grunn enterocyte differensiering. For eksempel økt forståelse for in vivo differensiering er nødvendig som en målestokk for studier som tar sikte på å produsere in vitro primære tarmsystem 16.

Prosedyren ovenfor inneholder flere trinn som krever ekstra oppmerksomhet. For det første, fjerne kantene rundt det frosne vev segmentet (som omtalt i kapittel 3.2) er nødvendig som vevet kanter curl under disseksjon og frysing. Unnlatelse av å flytte disse kanter resultatene er en blandet befolkning av overflate og krypten basis celler. Montering av vev på en pre-kjølt, flatet oktober blokken er også avgjørende. Tsin protokollen kan tilpasses til andre deler av den distale colon ved å endre antallet av seksjoner i hver blanding. For eksempel, som vist i figur 1B, varierer mucosal krypt lengde mellom 150-300 um. Derfor, når man vil studere området mellom 4 cm-6 cm fra anus, antall seksjoner bør økes fra 15 til 30. Det blir fore denne protokollen ikke foreslått for den proksimale kolon (7 cm-9 cm) på grunn av folder ( plicae obliquae) som strekker seg inn i lumen gjør det umulig å skille overflate og krypten baserte celler ved serie snitting.

Serielle snitt teknikker har blitt brukt til å studere krypten-basen og overflate epiteliale cellepopulasjoner i mennesker. Men legger vår protokoll ytterligere skritt som er nødvendige på grunn av den lille størrelsen på murine vev. Vi foreslår at ovennevnte protokoll vil tillate for undersøkelse av krypten-base og overflate epitelial cellepopulasjonen i genetisk medgjørlig musesystemer. Faktisk sammenslåtte seksjoner yield protein av høy kvalitet og RNA egnet nedstrøms analyse. Fremtidige applikasjoner kan omfatte studier av cellesignalveier eller kromatin immunoprecipitation. Imidlertid bør det bemerkes at, som flere av de alternative metoder som er beskrevet ovenfor, de resulterende seksjoner inneholder en blanding av epithelial og interstitielle lamina propria celler. Konklusjonen er at den protokoll som er beskrevet her tilveiebringer en hurtig, høy avkastning metode for analyse av molekylære prosesser i romlig adskilte regioner av murine kolon mukosa.

Materials

Name Company Catalog Number Comments
Microtome Leica Biosystems, Nussloch Germany CM 1510-3
MyiQ real time PCR detector BioRad
LSM 510  Carl Zeiss Confocal microscope
OCT Tissue-Tek, Sakura Finetek, Torrance CA 4583
cryo-mold Tissue-Tek, Sakura Finetek, Torrance CA 4557 25mmx20mmx5mm
High profile microtome blade Leica Biosystems, Nussloch germany 818
GEM industrial blades American Safety Razor Blades 62-0314
Sylgard silicon elastomere base Dow Corning, Midland MI 3097358
27 1/2 g needle Becton-Dickinson, Franklin Lakes, NJ 305109 pins for dissection
TRizol Life Technologies 15596018
Rneasy Qiagen 74104
DNAse Qiagen 79254
Antibody ZO-1 Invitrogen  187430
Antibody KLF4 Cell Signaling 4038S
Antibody mGAPDH Sigma G8795
Antibody Secondary Alexa conjugate Invitrogen A11034 488 anti-rabbit
Antibody Secondary HRP conjugate Jackson 111/115-001-003 rabbit/mouse 
Topro-3 Invitrogen T3605
HANKs balanced salt buffer Life Technologies 14025092
RIPA lysis buffer 50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate
primer TBP 3' GGAATTGTACCGCAGCTTCAAA
primer TBP 5' GATGACTGCAGCAAATCGCTT
primer KLF4 3' TGTGACTATGCAGGCTGTGGCAAA
primer KLF4 5' ACAGTGGTAAGGTTTCTCGCCTGT

DOWNLOAD MATERIALS LIST

References

  1. Noah, T. K., Donahue, B., Shroyer, N. F. Intestinal development and differentiation. Exp Cell Res. 317, 2702-2710 (2011).
  2. Humphries, A., Wright, N. A. Colonic crypt organization and tumorigenesis. Nat Rev Cancer. 8, 415-424 (2008).
  3. Weber, C. R., Turner, J. R. Inflammatory bowel disease: is it really just another break in the wall. Gut. 56, 6-8 (2007).
  4. Bjerknes, M., Cheng, H. Methods for the isolation of intact epithelium from the mouse intestine. Anat Rec. 199, 565-574 (1981).
  5. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  6. Rand, M. D., et al. Calcium depletion dissociates and activates heterodimeric notch receptors. Mol Cell Biol. 20, 1825-1835 (2000).
  7. Gjorevski, N., Boghaert, E., Nelson, C. M. Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues. Cancer Microenviron. 5, 29-38 (2012).
  8. Lechner, S., et al. Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia. Gut. 52, 1148-1153 (2003).
  9. Reizel, Y., et al. Colon stem cell and crypt dynamics exposed by cell lineage reconstruction. PLoS Genet. 7, e1002192 (2011).
  10. Kosinski, C., et al. Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors. Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).
  11. Tamura, S., et al. Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm. J Gastroenterol. 37, 798-806 (2002).
  12. Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. Isolation and characterization of dendritic cells and macrophages from the mouse intestine. Journal of visualized experiments : JoVE. e4040 (2012).
  13. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  14. Neumann, P. A., et al. Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon. Am J Pathol. 184, 592-599 (2014).
  15. Capaldo, C. T., et al. Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins. Mol Biol Cell. 25, 2710-2719 (2014).
  16. Wells, J. M., Spence, J. R. How to make an intestine. Development. 141, 752-760 (2014).
Cryosectioning Metode for mikrodisseksjon av Murine Kolon Mucosa
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).More

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter