Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Método cryosectioning para Microdissection de Murino Colonic Mucosa

doi: 10.3791/53112 Published: July 12, 2015

Introduction

O revestimento epitelial do cólon é um tecido altamente regenerativa, com as células estaminais residentes reabastecer o tecido a cada poucos dias 1. Este processo de regeneração requer a manutenção de um compartimento de células estaminais proliferativa. Ao longo do tempo, as células filhas recentemente produzidos perdem o seu potencial proliferativo e migram para a superfície luminal do intestino. Coincidente com a migração, as células progenitoras diferenciam-se em enterócitos de formação de barreira maduras ou células caliciformes produtoras de muco. A falha deste programa de diferenciação é pensado para contribuir para barreira epitelial comprometida tal como é observada na doença inflamatória do intestino e o cancro do cólon 2,3.

Estudo detalhado dos processos acima exigirá metodologias para isolar populações cripta-base e celulares de superfície. Existem vários métodos, cada um com suas vantagens e desvantagens. Os métodos actuais para o isolamento de células epiteliais intestinais incluem chagentes elating e dissociação mecânica, resultando no isolamento de criptas epiteliais, folhas inteiras, ou de células individuais, dependentes das condições experimentais 4,5. Estes são os métodos de alto rendimento, ainda mudanças na sinalização intercelular foram relatados nestas condições que podem não representar o ambiente nativo 6,7. Captura Laser microdissection permite a coleta de material distinto espacial, mas alcança 8,9 baixo rendimento molecular. No tecido do cólon humano, métodos cryosectioning horizontais em série foram desenvolvidos 10. No entanto, os tecidos da mucosa murino são proibitivamente pequeno para apropriação direta desta técnica. Nos seres humanos, os comprimentos das criptas intestinais (a distantes entre a base de cripta e células superficiais) no cólon varia entre 100-1.000 uM ~ 11. Em ratinhos, os comprimentos das criptas são entre 50-300 ~ ^ M (ver Figura 1A). O tamanho pequeno das criptas murino apresenta um desafio para o isolação destas duas populações celulares utilizando protocolos existentes.

Vamos agora descrever um baixo custo, o método de alto rendimento para o isolamento de cripta-base e superfície população de células epiteliais no tecido do cólon de murino. Tecido colhida desta maneira pode, então, ser analisado por um certo número de aplicações a jusante padrão, incluindo coloração por imunofluorescência, por RT-PCR (Real Time-Polymerase Chain Reaction) ou transferência de western.

Protocol

Experiências utilizados ratinhos C57BL / 6 entre 10 e 12 semanas de idade. Todos os procedimentos que utilizam animais foram revistos e aprovados pelo Comitê de Emory University Animal Care Institucional e Use e foram realizadas de acordo com Institutos Nacionais de Saúde critérios.

1. Setup Experimental

  1. Configurar o Criostato
    1. Equilibrar criostato a -20 ° C, incluindo a lâmina micrótomo e mandris (ter muito cuidado em torno da lâmina!).
    2. Encha uma cryomold vazio com outubro (Optimal composto de corte de temperatura) e equilibrar a -20 ° C (~ 30 min). Remova a outubro congelado do molde e corrigi-lo no mandril com líquido outubro Coloque o bloco / mandril no braço micrótomo e permitir que o OCT para definir durante 10 min.
    3. Defina o criostato a 10 um por seção e raspar o bloco de outubro até que seja plana. Apoiar o braço microtome longe da lâmina por vários centímetros. Neste ponto não se ajustar a lâmina ou mandril para o restante da experiment.
  2. Preparar as lâminas de barbear: Prepare duas lâminas de barbear por amostra. Usando um arquivo de metal, maçante a borda sharped de lâminas. Em seguida, retire a flange de alumínio com uma pinça.
  3. Pré-descontrair um pirex ou outra superfície plana em gelo seco.
  4. Prepare um prato de dissecação com 15/10 pinos de dissecação. De 10 cm cultura de tecidos de 50% cheio com silicone será suficiente. Adicionar 5 ml de tampão de Hanks à temperatura ambiente.

2. Dissecção da Distal Colonic Tissue

  1. Camundongos lugar em uma câmara selada e euthanize ratos por inalação de isoflurano e deslocamento cervical, em seguida, pulverizar etanol a 70% para o abdômen e tórax 12.
  2. Faça uma pequena incisão na pele do abdómen com uma tesoura e, em seguida, fazer uma incisão para expor a cavidade peritoneal. Procedimentos semelhantes podem ser encontradas aqui descrita 12.
  3. Cortar o intestino grosso à beira anal e provocar uma separação do mesentério até que o cólon é gratuito.
  4. Extirpar um cólon distalsegmento entre 0 e 6 cm do ânus. Aqui, a profundidade das criptas é ~ 150 uM (ver Figura 1B). Corte aberto do cólon longitudinalmente com uma tesoura e remova o conteúdo fecal.
  5. Pin o tecido para o prato de dissecação com a superfície da mucosa voltada para cima. Esticar o tecido utilizando pinos de dissecação sobre um prato de silício em tampão de Hanks e deixar em repouso durante 10 min à temperatura ambiente (Figura 1C). Isto remove dobras do tecido e permite que as camadas de músculos para relaxar.

3. Monte Tissue na Criostato para Seccionamento

  1. Deslize uma lâmina de barbear sob a seção desejada do tecido e, em seguida, despeje o tampão Hanks. Adicionar outra lâmina de barbear para o topo, tornando uma sanduíche. Corte o segmento de tecidos e remover os pinos. Transferir o sanduíche de lâminas de barbear / tecido para gelo seco. Permitir que o tecido para congelar (5-10 min, A Figura 1D).
  2. Pegar a navalha / sanduíche de tecido e deixe-o aquecer ligeiramente, colocando um dedo no topo blade (lado da mucosa para cima. Este orienta o tecido de modo que as camadas basais musculares são seccionados em primeiro lugar.). Separa-se a sanduíche de corte e em volta das extremidades do segmento de tecido. Cortar um segmento de tecido de aproximadamente, 0,5 centímetros x 1 cm. Áreas de ponta têm uma tendência a enrolar, fazendo com que os cortes seriados para conter muitas camadas de tecido. Note-se que o excesso de corte é melhor do que under-corte, assim errar do lado da cautela.
  3. Permitir que o tecido se aquecer até que o gelo no topo do tecido começa a derreter. Neste ponto, de forma rápida e cuidadosamente pressionar o tecido para dentro do bloco de outubro no criostato.
  4. Remova a lâmina, colocando um dedo sobre a amostra. A transferência de calor vai permitir que você remover a lâmina, sem perturbar o tecido.
  5. Brasão do tecido com outubro e equilibrar durante 5 min. Cortar em secções de 10 um (Figura 1E, F). Inspecione visualmente as seções até que as criptas são vistos. Seções lugar em um tubos de 1,5 ml ou em slides.
  6. Para a análise de mRNA ou proteína, lugar tele amostras em tubos com 5 cripta-base, 5 de transição, e 5 secções de superfície por tubo. Para recolha de RNA adicionar 1 ml de reagente de isolamento comercial e incubar à TA durante 10 min. Realizar a purificação de ARN de acordo com as instruções do fabricante. Use 5-10 ug de ARN total para a produção de ADNc.
  7. Para a purificação de proteínas, adicionar 0,5 ml de tampão de lise RIPA frio (mais inibidores de protease) por cinco secções. Sonicar três vezes a um ciclo de 70%, em gelo.
    1. Adicionar tampão de amostras de SDS PAGE de carregamento (tampão de Laemmli) e incuba-se a 100 ° C durante 10 min. Amostras sujeitas a SDS PAGE e transferência, em seguida, bloquear em 5% de leite / PBS durante 2 horas. Realizar a análise Western blot, seguido por incubação com anticorpos Klf4 (1: 500) O / N a 4 ° C.

Representative Results

Seções de tecido do cólon foram processados ​​para avaliação histológica e H & E coloração 13. Uma vista em secção transversal tradicional da mucosa é visto na Figura 2A. Áreas basais conter o muscular externa, composta principalmente dos muscularis circulares. Prosseguindo para o lúmen, a mucosa muscularis é evidente adjacente para as células epiteliais de cripta-base, as células são transitórias no meio do tecido, e finalmente, as populações de células de superfície da face do lúmen do intestino. O método descrito aqui cortes seriados mantém uma orientação tal que os muscularis longitudinais e circulares são encontrados primeira (Figura 2B), seguido pela mucosa muscular (Figura 2C). Observe a aparência das células intersticiais não-musculares no canto superior esquerdo da imagem. Para a análise a jusante descrito abaixo, as secções de músculo são descartados. As seções posteriores contêm células epiteliais e tecido intersticial (lâmina própria), Começando com as células de cripta-base (Figura 2D). Note-se a ausência de um lúmen central, na maioria das criptas, que aparecem mais escuras devido aos núcleos estreitamente empacotadas. Estas camadas contêm o compartimento proliferativa. As células de transição aparecem como bem embalado glândulas com lumens centrais proeminentes (Figura 2E). Por último, as populações de células da superfície tem uma estrutura irregular, com áreas de monocamada epitelial viram en face (Figura 2F).

Cortes seriados como descritos acima podem também ser tratados para a rotulagem de imunofluorescência e microscopia confocal (como descrito aqui 14). Figura 2G mostra criptas isoladas fixas e permeabilizadas em 100% de metanol e, posteriormente coradas para núcleos (azul) e da proteína de junção célula-célula zonula occludens 1 (ZO-1, verde). Na orientação de corte tradicional, células da cripta e da superfície pode ser visto simultaneamente (Figura 2G (Figura 2G). Aprimorado ZO-1 mancha é visto em populações de células de superfície (Figura 2I e J).

Vários factores de diferenciação são conhecidos a ser expresso de uma forma espaço-temporal ao longo do eixo cripta-a-superfície. Isto inclui o factor de transcrição-Kruppel como factor de 4 (KLF4), que é conhecido por ser enriquecido em populações de células de superfície. Usando métodos tradicionais de seccionamento, KLF4 é encontrada nos núcleos de lúmen populações de células de superfície (Figura 2K) enfrentando. Nós portanto especulado que KLF4 ARNm poderia ser predominantemente expresso em populações de células de superfície. Para testar isso, cortes seriados foram coletadas e agrupadas em amostras de superfície, de transição, de criptas e-base. Subsequently, o ARN foi colhido utilizando Trizol extracção padrão, com uma purificação adicional por coluna RNeasy e tratamento com DNAse. RNA foi coletado de cinco secções consecutivas em pool, que renderam entre 5-10 mg de RNA total por amostra. Estas amostras foram então submetidas a tempo de semi-quantitativo PCR real tanto para KLF4 e um gene de referência, a ligação da proteína caixa TATÁ 1 (TBP-1) (Figura 2L) 14. Como mostrado na Figura 2L, após normalização para a TBP-1, células de superfície foram encontrados para expressar até 8 vezes o ARNm KLF4 que é expresso em células da cripta. Do mesmo modo, os níveis de proteína KLF4 foram encontrados para expor regulação espacial ao longo do eixo cripta-superfície. As secções em série foram recolhidas como descrito acima e, em seguida, incubadas em tampão de lise durante 20 min a 4 ° C. Isto produziu entre 200-250 mg de proteína por amostra. As amostras foram então sujeitas a análise por SDS-PAGE (Figura 2M) 15. Como mostrado na Figura 2 M, p KLF4níveis rotein são dramaticamente mais elevada em populações de células de superfície. Os resultados acima demonstram a capacidade deste protocolo para isolar grandes quantidades de células epiteliais superficiais e das criptas da mucosa do cólon murino.

Figura 1
Figura 1: (A) mostrando esquemática da mucosa do cólon de murino e as camadas musculares externos. Nosso método tem como objectivo recolher populações de células discretas de células superficiais e cripta-base por cryosectioning serial (10 m cada). As camadas musculares externos são descartados. Altura (B) Crypt varia ao longo do comprimento do cólon (a distância entre as camadas de base e de cripta-superficiais). Os pontos de dados individuais indicam as medições das criptas e símbolos indicam réplicas biológicas (n = 4). (C) segmentos de cólon recolhido, dividido, e preso em um silício dissecar prato. (D) Um tecido segment aproximadamente 3 cm do ânus é prensada entre a lâminas de barbear e os congelados em gelo seco. (E) O tecido é, em seguida, montado sobre um pré-nivelado bloco PTU. (F) Cortes congelados são removidos e inspeccionados visualmente.

Figura 2
Figura 2:. Os dados representativos (A) de tecido do cólon corado com Hematoxilina-Eosina, em corte transversal, que mostra a muscular circular (em cm), a mucosa muscularis (mm), as células de cripta-base, células de transição, e de células de superfície. (B - C) camadas musculares do cólon. (D) As células da cripta de base. Note-se a ausência de um lúmen central. (E) células transitórias. (F), as células de superfície. (G) Imunofluorescência coloração das criptas colônicas isoladas. ZO-1 (verde) e núcleos (azul) são observadas em corte transversal. (HI) ZO-1 e coloração nuclear em células de transição e de superfície. (J) visão ampliada de ZO-1 coloração. (K) KLF4 (verde) está enriquecido nas populações de células de superfície. (G) em tempo real os níveis de avaliação de PCR de ARNm KLF4 entre os três compartimentos. (M) análise de Western blot de KLF4 níveis de proteína nestas populações de células.

Discussion

Os mecanismos moleculares envolvidos na proliferação de células epiteliais do cólon e diferenciação são mal compreendidos. Isto inclui lacunas na nossa compreensão do ambiente de sinalização celular do compartimento de células estaminais na base das criptas epiteliais do cólon. Há também um crescente interesse nos processos que subjazem diferenciação enterócitos. Por exemplo, o aumento da compreensão dos in vivo diferenciação é necessária como um ponto de referência para estudos voltados para a produção in vitro de sistemas intestinais primárias 16.

O procedimento acima contém várias etapas que requerem atenção extra. Em primeiro lugar, a remoção das bordas ao redor do segmento de tecidos congelados (como discutido na seção 3.2) é necessária como as bordas do tecido onda durante a dissecção e congelamento. A falha para mover estes bordos resultados é uma população mista de células de superfície e de base cripta. Montando o tecido em um bloco de pré-refrigerados, nivelado outubro também é essencial. To protocolo pode ser adaptado para outras áreas do cólon distai através da alteração do número de secções, em cada pool. Por exemplo, como mostrado na Figura 1B, comprimento das criptas mucosa varia entre 150-300 um. Portanto, quando se estuda a região entre 4 cm-a 6 cm do ânus, o número de secções deve ser aumentado de 15 para 30. Importante, este procedimento não é recomendado para o cólon proximal (7 cm @ 9 cm), devido a dobras ( plicas obliquae) que se estendem para dentro do lúmen fazendo com que seja impossível para as células cripta e de superfície de base separados por cortes seriados.

Técnicas de seccionamento em série têm sido usados ​​para estudar cripta-base e superfície de populações de células epiteliais em humanos. No entanto, o nosso protocolo adiciona passos adicionais que são necessários devido ao tamanho pequeno de tecido murino. Propomos que o protocolo acima permitirá a investigação de cripta-base e população de células epiteliais da superfície em sistemas geneticamente tratáveis ​​do mouse. Na verdade, seções reunidas yield proteína de alta qualidade e análise do RNA a jusante adequados. As aplicações futuras podem incluir o estudo de vias de sinalização celular ou cromatina imunoprecipitação. No entanto, deve notar-se que, tal como muitos dos métodos alternativos descritos acima, as secções resultantes contêm uma mistura de células epiteliais e da lâmina própria intersticiais. Em conclusão, o protocolo aqui descrito proporciona um método rápido de rendimento, elevada para a análise de processos moleculares em regiões espacialmente distintas da mucosa do cólon de murino.

Materials

Name Company Catalog Number Comments
Microtome Leica Biosystems, Nussloch Germany CM 1510-3
MyiQ real time PCR detector BioRad
LSM 510  Carl Zeiss Confocal microscope
OCT Tissue-Tek, Sakura Finetek, Torrance CA 4583
cryo-mold Tissue-Tek, Sakura Finetek, Torrance CA 4557 25mmx20mmx5mm
High profile microtome blade Leica Biosystems, Nussloch germany 818
GEM industrial blades American Safety Razor Blades 62-0314
Sylgard silicon elastomere base Dow Corning, Midland MI 3097358
27 1/2 g needle Becton-Dickinson, Franklin Lakes, NJ 305109 pins for dissection
TRizol Life Technologies 15596018
Rneasy Qiagen 74104
DNAse Qiagen 79254
Antibody ZO-1 Invitrogen  187430
Antibody KLF4 Cell Signaling 4038S
Antibody mGAPDH Sigma G8795
Antibody Secondary Alexa conjugate Invitrogen A11034 488 anti-rabbit
Antibody Secondary HRP conjugate Jackson 111/115-001-003 rabbit/mouse 
Topro-3 Invitrogen T3605
HANKs balanced salt buffer Life Technologies 14025092
RIPA lysis buffer 50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate
primer TBP 3' GGAATTGTACCGCAGCTTCAAA
primer TBP 5' GATGACTGCAGCAAATCGCTT
primer KLF4 3' TGTGACTATGCAGGCTGTGGCAAA
primer KLF4 5' ACAGTGGTAAGGTTTCTCGCCTGT

DOWNLOAD MATERIALS LIST

References

  1. Noah, T. K., Donahue, B., Shroyer, N. F. Intestinal development and differentiation. Exp Cell Res. 317, 2702-2710 (2011).
  2. Humphries, A., Wright, N. A. Colonic crypt organization and tumorigenesis. Nat Rev Cancer. 8, 415-424 (2008).
  3. Weber, C. R., Turner, J. R. Inflammatory bowel disease: is it really just another break in the wall. Gut. 56, 6-8 (2007).
  4. Bjerknes, M., Cheng, H. Methods for the isolation of intact epithelium from the mouse intestine. Anat Rec. 199, 565-574 (1981).
  5. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  6. Rand, M. D., et al. Calcium depletion dissociates and activates heterodimeric notch receptors. Mol Cell Biol. 20, 1825-1835 (2000).
  7. Gjorevski, N., Boghaert, E., Nelson, C. M. Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues. Cancer Microenviron. 5, 29-38 (2012).
  8. Lechner, S., et al. Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia. Gut. 52, 1148-1153 (2003).
  9. Reizel, Y., et al. Colon stem cell and crypt dynamics exposed by cell lineage reconstruction. PLoS Genet. 7, e1002192 (2011).
  10. Kosinski, C., et al. Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors. Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).
  11. Tamura, S., et al. Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm. J Gastroenterol. 37, 798-806 (2002).
  12. Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. Isolation and characterization of dendritic cells and macrophages from the mouse intestine. Journal of visualized experiments : JoVE. e4040 (2012).
  13. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  14. Neumann, P. A., et al. Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon. Am J Pathol. 184, 592-599 (2014).
  15. Capaldo, C. T., et al. Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins. Mol Biol Cell. 25, 2710-2719 (2014).
  16. Wells, J. M., Spence, J. R. How to make an intestine. Development. 141, 752-760 (2014).
Método cryosectioning para Microdissection de Murino Colonic Mucosa
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).More

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter