Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

العزلة الفيروسية النسخ المتماثل حجرة التخصيب النووي الكسور الفرعية من اتش المصابة الخلايا الطبيعية الإنسان

doi: 10.3791/53296 Published: November 12, 2015


or Start trial to access full content. Learn more about your institution’s access to JoVE content here

الغدية تحتوي على جينوم الحمض النووي المزدوج تقطعت بهم السبل أن يعيد في نواة الخلية المصابة. عندما يدخل الحمض النووي الفيروسي النواة، فإنه يموضع المجاور للهيئات النووية PML 1. بعد الفيروسي التعبير الجيني المبكر، وإعادة تنظيم الهيكل النووية بشكل كبير، الأمر الذي أدى تشكيل microenvironments الفيروسية، ووصف المقصورات تكاثر الفيروس (RC) 2. منذ اتش (الإعلان) RC من المواقع حيث تكرار الجينوم الفيروسي والتعبير عن الجينات الفيروسية أواخر تأخذ مكان، لأنها توفر بيئة ملائمة لتوظيف جميع العوامل الفيروسية والخلوية اللازمة التي تشارك في هذه العمليات. ومن المثير للاهتمام، ومجموعة متنوعة من البروتينات الخلوية المسؤولة عن الاستجابة المضادة للفيروسات الخلوية، مثل استجابة الحمض النووي من التلف، والاستجابة المناعية الفطرية وقمع الورم هي تحييدهم لهذه المواقع الفيروسية 2. وبالتالي، يمكن اعتبار الإعلان RC المحاور التنظيمية التي تعزز تكاثر الفيروس الفعال في حين تنظم بالتزامن فياستجابة المضادة للفيروسات الخلوية، مشيرا إلى أن هذه الهياكل هي المفتاح لفهم الفيروس في استضافة التفاعلات الخلية. ومع ذلك، فإن الآليات الجزيئية لتشكيل RC، وغير مفهومة تكوينها والأنشطة المرتبطة بها.

الفيروسة الغدانية RC، وكذلك RC من الفيروسات DNA الأخرى التي تحاكي في النواة لا ترتبط إلى الأغشية، وعلى النقيض من RC حشوية 3. وعلاوة على ذلك، من المرجح أن تكون مؤلفة بالكامل من البروتينات والأحماض النووية هذه الهياكل التي يسببها الفيروس. RC تشكلت في الخلايا المصابة بفيروسات RNA (عادة ما تسمى المصانع الفيروسية) تم عزلها، والاستفادة من توطين حشوية ومركزهم بغشاء، والتي سهلت الصرفية الخاصة بهم تفصيلا، وظيفية والكيمياء الحيوية توصيف 4.

على حد علمنا، الفيروسي RC النووي لم يتم عزلها، وربما يرجع ذلك إلى تعقيد الهندسة المعمارية النووية وغياب متر داخل النواةembranes التي من شأنها تسهيل عزلتهم. وقد اعتمدت الدراسة بدلا من ذلك على الفحص المجهري المناعي، FISH وانتقال المجهر الإلكتروني. ومع ذلك، على الرغم من التعقيدات الملازمة لعزل المنشآت النووية الدقيقة المجالات النووية الأخرى مثل نويات والهيئات كاجال تم عزلها قبل 5،6. منذ الأنوية وRC كلاهما يتألف من البروتينات والأحماض النووية، ويكون قطرها بين 0،5-5 ميكرون، ونحن افترضنا أن RC ينبغي أيضا أن تكون قابلة للعزل. ولذلك، من أجل توصيف أكثر دقة التركيب الجزيئي وظائف المرتبطة RC، أنشأنا طريقة جديدة لعزل كسور النووية الدقيقة المخصب مع RC. تحقيقا لهذه الغاية، ونحن على استعداد الكسور شبه النووي باستخدام تدرجات السرعة وسائد السكروز مماثلة إلى الإجراءات المستخدمة لعزل نويات 7 أو المجالات النووية الأخرى وأنشأ نظام خالية من الخلايا التي تسمح للدراسة التركيب الجزيئي والأنشطة المرتبطة بهاRC. ولذلك ينبغي أن هذه التقنية تقدم فهم الفيروس في استضافة التفاعلات الخلية ويمثل أداة قوية التي ينبغي أيضا تسهيل تحليل مفصل لRC من الفيروسات الأخرى التي تحاكي في النواة ولحث على تشكيل حجرات تكرار أبعاد مماثلة لتلك التي تشكلت في adenovirus- الخلايا المصابة، مثل فيروس الهربس، الورم الحلمي أو polyomaviruses.

Subscription Required. Please recommend JoVE to your librarian.


or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. HFF خلية الثقافة والإعلان العدوى

  1. نشر فيروس Ad5 WT في الطبقات الوحيدة من HEK-293 الخلايا وعيار وحدات تشكيل الفلورسنت (FFU) على خلايا HFF كما هو موضح سابقا 8.
  2. تنمو الخلايا الليفية القلفة الإنسان (HFF) في 10 مل من DMEM / 10٪ مصل بقري جنيني (FBS) في الثقافة العقيمة 100 ملم أطباق في 37 درجة مئوية و 5٪ CO 2 في حاضنة مرطب. تحديد عدد الخلايا باستخدام غرفة نويباور عن طريق عد الخلايا في أربع مجموعات 16 مربعا. يتم الحصول على عدد الخلايا لكل مل عن طريق حساب متوسط ​​عدد الخلايا في أربع مجموعات 16 مربع، وضرب هذا الرقم بنسبة 10 4. في كل مرة بعد الإصابة المدرجة في الخطوة 1.3، استخدم 1 × 10 7 خلايا HFF.
  3. همية تصيب أو تصيب خلايا HFF مع نوع اتش 5 (Ad5) من النوع البري (WT) (H5pg4100 8) في 100 ملم أطباق زراعة الأنسجة باستخدام 1 مل من Ad5 في DMEM لكل طبق في وزارة الداخلية من 30 التركيز تشكيل وحدة، أو FFU ، لكل خلية. احتضان لمدة 2 ساعة في آهumidified حاضنة الثقافة خلية على 37 درجة مئوية و 5٪ CO هزاز بعناية الأطباق كل 15 دقيقة لضمان التوزيع المتجانس لقيحة الفيروس على الخلايا. بعد هذا الوقت، وإزالة المتوسطة وإضافة DMEM جديدة تستكمل مع 10٪ FBS واحتضان لمدة 16 أو 24 أو 36 ساعة في ترطيب حاضنة الثقافة خلية في 37 º C و 5٪ CO 2. انتقل إلى الخطوة 2.1.

2. إعداد الكسور النووي الفرعية المخصب مع اتش RC

  1. حصاد Ad5 المصابة أو الخلايا المصابة وهمية HFF مع المزيل الخلية وجمع الخلايا في أنابيب الطرد المركزي معقمة. تحديد عدد الخلايا كما في الخطوة 1.2. استخدام 1 × 10 7 خلايا في كل مرة بعد الإصابة المحدد في الخطوة 1.3.
  2. الطرد المركزي الخلايا في 220 x ج، 4 درجة مئوية لمدة 5 دقائق.
  3. resuspend الكرية خلية في برنامج تلفزيوني الجليد الباردة (137 ملي كلوريد الصوديوم، و 2.7 ملي بوكل، 10 ملي نا 2 هبو 4 و 1.8 ملي KH 2 PO 4). غسل بيليه الخليةالصورة 3 مرات باستخدام 5 مل من PBS الجليد الباردة في غسل. لهذا الغرض، الطرد المركزي الخلايا في 220 x ج، 4 درجة مئوية لمدة 5 دقائق، صب وتجاهل طاف (SN)، و resuspend بيليه الخلية من قبل pipetting لطيف.
  4. لتعطيل غشاء البلازما، resuspend الكرية الخلية في 700 ميكرون لتر من العازلة الجليد الباردة ناقص التوتر (10 ملي HEPES الرقم الهيدروجيني 7.9، 10 ملي بوكل، 1.5 ملي MgCl 0.5 ملي DTT، 20 μ غ / مل phenylmethylsulfonyl الفلورايد (PMSF) ، وهي مزيج من السيستين، سيرين، مثبطات الأنزيم البروتيني ثريونين وaspartyl بما في ذلك 10 μ غ / مل البقري البنكرياس مثبط التربسين، 10 μ غ / مل pepstatin A و 10 μ غ / مل N -acetyl-L-لوسيل-L-لوسيل-L -argininal)، والسماح للخلايا تنتفخ على الجليد لمدة 3 ساعات.
  5. ليز الخلايا باستخدام الخالط مع فضفاضة-A مدقة نوع تفلون. أداء 80 dounce السكتات الدماغية ورصد عينات كل 20 السكتات الدماغية التي كتبها مشرق المجهري الميدان لضمان أن جميع الخلايا هي lysed تم، ولكن هذا نواة لديها نبعد التمديد تضررت أو تمزق.
  6. أجهزة الطرد المركزي لجناسة الخلية في 300 x ج، 4 درجة مئوية لمدة 5 دقائق. تخزين SN كما الكسر حشوية في -20 درجة مئوية في أنبوب الطرد المركزي.
  7. لإزالة الحطام الخلوي من نوى، resuspend الكرية في 750 μ لتر من محلول 1 (S1) (0.25 M السكروز، 10 ملي MgCl 2 20 μ غ / مل PMSF، وهي مزيج من السيستين، سيرين، مثبطات ثريونين وaspartyl البروتيني بما في ذلك 10 μ غ / مل البقري مثبط التربسين البنكرياس، 10 μ غ / مل pepstatin A و 10 μ غ / مل N -acetyl-L-لوسيل-L-لوسيل-L-argininal) وطبقة فوق حجم مساو من حل 2 (S2) (0.35 M السكروز، 0.5 ملي MgCl 20 μ غ / مل PMSF، وهي مزيج من السيستين، سيرين، مثبطات ثريونين وaspartyl البروتيني بما في ذلك 10 μ غ / مل البقري البنكرياس مثبط التربسين، 10 μ غ / مل pepstatin A و 10 μ ز / مل N -acetyl-L-لوسيل-L-لوسيل-L-argininal). CENTRifuge في 1400 x ج، 4 درجة مئوية لمدة 5 دقائق.
  8. تجاهل SN باستخدام micropipette. تجنب إزعاج بيليه.
  9. resuspend الكرية التي تحتوي على نواة معزولة في 750 μ لتر من S2.
  10. عزل كسور النووية الدقيقة المخصب مع اتش RC (التعاون الإقليمي)، يصوتن معلق نوى مع حمام بالموجات فوق الصوتية، وذلك باستخدام اثنين من 5 دقائق البقول، أو حتى هي lysed كل نوى كما لاحظ مشرق المجهري الميدان. استخدام الثلج في حمام بالموجات فوق الصوتية حسب الحاجة للحفاظ على العينات عند أو أقل من 4 درجات مئوية.
  11. طبقة نوى sonicated على حجم مساو من حل 3 (S3) (0.88 M السكروز، 0.5 ملي MgCl 2) وأجهزة الطرد المركزي في 3000 x ج، 4 درجة مئوية لمدة 10 دقيقة. تخزين طاف 1.5 مل باعتبارها جزء النواة إلى الهيولى (القروض المتعثرة) في -70 درجة مئوية. Resuspend وبيليه في 700 μ لتر من S2 والمخزن كما التعاون الإقليمي في -70 درجة مئوية.

3. التحليلات الغربية وصمة عار في إطار التعاون الإقليمي

ملاحظة: للحصول على تحليل البقعة الغربية من القروض المتعثرة والتعاون الإقليمي الكسور الصورةوآخرون جانبا 640 ميكرون لتر بالنسبة القروض المتعثرة و 300 μ لتر لإطار التعاون الإقليمي من إجمالي حجم حصلت عليه في الخطوة 2.11.

  1. مزيج 15 μ لتر من كل جزء النووية الدقيقة في 2X العازلة Laemmli (4٪ SDS، 20٪ الجلسرين، و 10٪ 2-المركابتويثانول، 0.004٪ برموفينول الأزرق، 0.125 M تريس حمض الهيدروكلوريك درجة الحموضة 6.8)، ويغلي عند 95 درجة مئوية لمدة 5 دقائق. تحميل العينات في 10٪ من الصوديوم دوديسيل كبريتات بولي أكريلاميد الكهربائي للهلام (SDS-PAGE) تغيير طبيعة جل والبروتينات منفصلة عن 1.5 ساعة، في 20 مل أمبير (مللي أمبير).
  2. نقل البروتينات التي electroblotting مقابل 1.5 ساعة عند 400 مللي أمبير على البولي difluoride (PVDF) الأغشية.
  3. منع الغشاء لمدة 2 ساعة على RT باستخدام 3٪ غير دهن الحليب الجاف في برنامج تلفزيوني.
  4. احتضان O / N عند 4 درجات مئوية مع الأجسام المضادة الأولية ضد فيروسي E2A بروتين ملزمة الحمض النووي (B6-8 9) في 1: 500 التخفيف في برنامج تلفزيوني / 0.3٪ غير دهن الحليب الجاف.
  5. غسل غشاء 3 مرات مع PBS / 0.1٪ توين 20 لمدة 10 دقيقة.
  6. احتضان الغشاء مع الماوس المضادة مفتش والثانويtibody يقترن إلى الغلوثانيون الحصان الفجل (HRP) في 1: 10000 التخفيف في برنامج تلفزيوني لمدة 2 ساعة على RT.
  7. غسل غشاء 3 مرات مع PBS / 0.1٪ توين 20 لمدة 10 دقيقة.
  8. تطوير الغشاء باستخدام تعزيز التوهج وأفلام الأشعة السينية.

4. الفيروسية الكشف عن الحمض النووي في إطار التعاون الإقليمي

ملاحظة: للحصول على عزل الحمض النووي من كل القروض المتعثرة والتعاون الإقليمي الكسور، استخدم 210 μ لتر لالقروض المتعثرة و 100 μ لتر لإطار التعاون الإقليمي من إجمالي حجم حصلت عليه في الخطوة 2.11.

  1. احتضان الكسور الفرعية النووية لمدة 1 ساعة على 55 درجة مئوية مع 1 ملغ / مل من بروتين K وتوين 20 بنسبة 0.5٪.
  2. تعطيل بروتين K التي يحتضنها العينات لمدة 10 دقيقة في درجة حرارة 95 درجة مئوية.
  3. الطرد المركزي العينات في 20000 x ج، في RT لمدة 2 دقيقة.
  4. جمع SN. ترسيب الحمض النووي مع 1/10 حجم 3M خلات الصوديوم ومجلد واحد من الأيزوبروبانول، O / N عند 4 درجات مئوية.
  5. الطرد المركزي العينات في 20000 x ج، في RT لمدة 10 دقيقة.
  6. تجاهل ش SNالغناء micropipette. غسل بيليه مع الايثانول 70٪ والطرد المركزي في 20000 x ج، 4 درجة مئوية لمدة 5 دقائق.
  7. Resuspend والحمض النووي في 10 μ ل 10 ملي تريس، حمض الهيدروكلوريك 7.4 درجة الحموضة
  8. تحديد الحمض النووي باستخدام مقياس الطيف الضوئي عن طريق قياس الكثافة الضوئية (OD) في 260 نانومتر.
  9. لتضخيم الحمض النووي الفيروسي، استخدم 100 نانوغرام من الحمض النووي من كل جزء النووية الدقيقة في تفاعل PCR قياسي باستخدام طق بوليميريز الحمض النووي في 25 μ لتر من حجم رد الفعل مع الاشعال التي تسمح التضخيم من منطقة داخل اللواء وحدة النسخ في وقت متأخر من النوكليوتيدات 7273 ل النوكليوتيدات 7353 (81 بي بي) (FW: GAGCGAGGTGTGGGTGAGC؛ رف: GGATGCGACGACACTGACTTCA). استخدام الشروط دورة التالية: تمسخ الأولي لمدة 3 دقائق في 95 درجة مئوية، تليها 20 دورات من التضخيم (1 دقيقة في 95 درجة مئوية، الصلب لمدة 1 دقيقة في 62 درجة مئوية والإرشاد لمدة 30 ثانية في 72 درجة مئوية) وخطوة التمديد النهائي ل 3 دقيقة عند 72 درجة مئوية.
  10. تشغيل المنتج PCR في 2٪ الاغاروز المواد الهلامية، في 90 V. وصمة عار مع إيثيديومبروميد عند 0.5 μ غ / مل تركيز النهائي وتصور DNA لإثبات تخصيب الحمض النووي الفيروسي في إطار التعاون الإقليمي. التعامل مع بروميد إيثيديوم بحذر شديد، ودائما تأكد من ارتداء قفازات، وهذا المركب هو المغير قوية. التخلص من بروميد إيثيديوم وفقا للمبادئ التوجيهية المؤسسية.

5. وقت متأخر الفيروسية الكشف مرنا في إطار التعاون الإقليمي

ملاحظة: للحصول على عزل الحمض النووي الريبي من كل القروض المتعثرة والتعاون الإقليمي الكسور، استخدم 640 μ لتر لالقروض المتعثرة و 300 μ لتر لإطار التعاون الإقليمي من إجمالي حجم حصلت عليه في الخطوة 2.11.

  1. عزل الحمض النووي الريبي من كسور النووية الدقيقة باستخدام Trizol وفقا لتعليمات الشركة الصانعة. Resuspend والحمض النووي الريبي في 50 μ لتر من DEPC (diethilpyrocarbonate) المياه المعالجة بالإثير.
  2. قياس الحمض النووي الريبي باستخدام معمل لقياس OD في 260 نانومتر (ويتم الحصول على حوالي 3 μ ز). تخزين الحمض النووي الريبي في 50 نانوغرام / ميكرون قسامات لتر في -70 درجة مئوية.
  3. تحقق RNA المنقىلعدم وجود تلوث DNA عن طريق إجراء مراقبة PCR رد الفعل في حالة عدم وجود الناسخ العكسي (RT)، وذلك باستخدام 5 نانوغرام من الحمض النووي الريبي مجموع والشروط دورة هو موضح في الخطوة 4.9.
    1. إذا تلوث DNA غائب يجب أن تنتج أي amplicon. إذا تلوث DNA هو الحاضر، احتضان عينات مع 10 U الدناز I، 10 U من ريبونوكلياز المانع، 0.1 M تريس، حمض الهيدروكلوريك درجة الحموضة 8.3، 0.5 M بوكل و 15 ملي MgCl 2 لمدة 30 دقيقة عند 37 درجة مئوية. الشروع في إعادة عزل-RNA كما في الخطوة 5.1.
  4. لتحليل مرنا الفيروسي يرتبط إلى التعاون الإقليمي، تضخيم 100 نانوغرام من الحمض النووي الريبي من كل جزء النووية الدقيقة التي RT-PCR باستخدام بادئات تهدف إلى الكشف عن مرنا الفيروسة الغدانية المتأخر من الأسر الجينات المختلفة (الجدول 1).
    1. لالنسخ العكسي (RT)، استخدم 100 نانوغرام من الحمض النووي الريبي، من كل جزء النووية الدقيقة في رد فعل RT قياسي باستخدام M-MuLV RT انزيم في 20 μ لتر من حجم رد الفعل لمدة 1 ساعة على 42 درجة مئوية و 10 دقيقة في 70 درجة مئوية.
    2. لتضخيم، استخدم 1μ لتر من كدنا] في تفاعلات PCR، كما في الخطوة 4.9. استخدام الشروط التالية دورة: تمسخ الأولي لمدة 3 دقائق في 95 درجة مئوية، تليها 25 دورات من التضخيم (1 دقيقة في 95 درجة مئوية، الصلب لمدة 1 دقيقة في درجة الحرارة المحددة في الجدول 1 والإرشاد لمدة 30 ثانية في 72 درجة مئوية) و خطوة التمديد النهائي لمدة 3 دقائق في 72 درجة مئوية.
  5. تشغيل المنتجات RT-PCR في 2٪ الاغاروز المواد الهلامية، في 90 الهلام V. وصمة عار مع بروميد إيثيديوم عند 0.5 μ غ / مل تركيز النهائي ووضع تصور لإثبات جمعية أواخر مرنا الفيروسية لإطار التعاون الإقليمي. التعامل مع بروميد إيثيديوم كما هو مبين في خطوة 4.10.

6. المناعي التصور إطار التعاون الإقليمي

ملاحظة:-إجراء هذا الإجراء في إطار مجلس الوزراء تدفق الصفحي لتجنب تلوث العينات مع أي جزيئات الغبار، وتصفية كل الحلول قبل الاستخدام.

  1. بقعة 5 ميكرون لتر من الكسر إطار التعاون الإقليمي حصلت عليه في الخطوة 2.10 المزريةctly على شريحة المغلفة سيلاني.
  2. السماح للبقعة جافة لمدة 5 دقائق على RT.
  3. إعادة هيدرات التي ببطء وبشكل غير مباشر pipetting لμ 500 لتر من PBS في قطرة بجانب بقعة إطار التعاون الإقليمي والسماح لها التدفق عن طريق إمالة الشريحة. استنزاف قبالة PBS الزائدة من الجانب.
  4. كتلة من خلال تغطية العينة مع 500 μ لتر من PBS / 5٪ ألبومين المصل البقري (BSA) لمدة 2 ساعة على RT.
  5. غسل الشريحة 3 مرات بلطف وبشكل غير مباشر pipetting ل500 لتر ميكرون من PBS على العينة. إمالة الشريحة لاستنزاف قبالة PBS الزائدة.
  6. احتضان العينة مع الأجسام المضادة الأولية ضد E2A الفيروسي بروتين ملزمة الحمض النووي (B6-8 9) في 1: 500 التخفيف في برنامج تلفزيوني لمدة 2 ساعة على RT. تغطية العينة رصدت مع 20 μ لتر من محلول الأجسام المضادة واحتضان في غرفة رطبة لتجنب الجفاف.
  7. غسل العينة 3 مرات مع PBS / 0.02٪ توين 20 بواسطة بلطف وبشكل غير مباشر pipetting لμ 500 لتر من PBS على العينة. إمالة الشريحة لتصريف السابقينسيس محلول الغسيل.
  8. احتضان هذه العينات مع الماوس المضادة مفتش الأجسام المضادة الثانوية بالإضافة إلى fluorophore التي هو متحمس في 488 نانومتر في 1: التخفيف 2000 في برنامج تلفزيوني، لمدة 1 ساعة عند 4 درجات مئوية. تغطية العينة رصدت مع 20 μ لتر من محلول الأجسام المضادة واحتضان في غرفة رطبة لتجنب الجفاف.
  9. غسل العينة 3 مرات مع PBS / 0.02٪ توين 20 بواسطة بلطف وبشكل غير مباشر pipetting لμ 500 لتر من PBS على العينة. إمالة الشريحة لتصريف الحل غسل الزائد.
  10. تغطية العينة رصدت على الشريحة مع ساترة باستخدام 2 μ ل PBS / 10٪ الجلسرين كما تصاعد المتوسط. ختم بطلاء الأظافر واضحة ومحل درجة مئوية -20.
  11. تحليل العينات باستخدام مجهر مضان، مع هدف 63X وفتحة 1.4 الرقمية (NA) في الطول الموجي من 488 نانومتر.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

منذ مقصورات تكاثر الفيروس (RC) هي هياكل الفيروسية التي يسببها النووية الدقيقة تتكون من البروتينات والأحماض النووية، على غرار المجالات النووية الأخرى، فإنها تبين أن تكون قابلة للعزل من قبل تدرجات السرعة على أساس الخصائص الكيميائية الحيوية. ويوضح الخطوات الحاسمة في البروتوكول تجزئة في الشكل 1. في كل خطوة تحتاج العينات التي سيتم رصدها من قبل مشرق المجهري الميدان لضمان سلامة الكسور شبه الخلوية المختلفة. على سبيل المثال، عندما تورم الخلايا، وفترة حضانة في المنطقة العازلة منخفض التوتر يحتاج إلى أن تكون موحدة من أجل تنتفخ السيتوبلازم تجنب الأضرار التي لحقت النوى. بعد التجانس الخلية، نواة سليمة، خالية من مكونات حشوية بما في ذلك أغشية الشبكة الإندوبلازمية، تحتاج إلى الحصول عليها. أيضا، الوقت صوتنة يجب أن تكون موحدة من أجل تمزق الغشاء النووي من جميع الخلايا دون تعطيل RC.

بعد الحصول على الكسور شبه النووي، مفتاحتحتاج الضوابط التي ستدرج لتحديد تكوين الجمعيات وإثراء علامات النية RC النية في إطار التعاون الإقليمي. وتصور الفيروسة الغدانية RC عادة في الخلايا المصابة المناعي باستخدام أجسام مضادة ضد بروتين E2A-72K الفيروسي (DBP). DBP هو بروتين فيروسي تشارك مباشرة في النسخ المتماثل الجينوم الفيروسي. وبالتالي، فإن وجود DBP في الجسيمات المخصب في إطار التعاون الإقليمي يدل على ارتباط مباشر من هذا البروتين الفيروسي مع جزيئات معزولة، كما هو مبين في الشكل 1. وعلاوة على ذلك، كشف DBP في إطار التعاون الإقليمي عن طريق ويسترن صمة عار يؤكد ارتباط هذا البروتين إلى عزلة RC. في الشكل 2 يظهر أنه بحلول الأوقات المتأخرة بعد الإصابة (36 HPI)، غير المخصب DBP في إطار التعاون الإقليمي مقارنة مع نسبة النواة إلى الهيولى (القروض المتعثرة)، مما يدل على أن RC تم الحصول عليها مع هذا الإجراء في أوقات مختلفة بعد الإصابة تعكس المتوقع الزمني نمط الجمعيات DBP لRC. عنصرا أساسيا من RC الفيروسي هو مؤسسة التبغ الحكومية العراقية الحمض النووي الفيروسيLF. في التجارب كما هو موضح في الشكل (3) علينا أن نبرهن على كميات متزايدة من المنتسبين DNA الفيروسي مع التعاون الإقليمي باسم دورة تكاثر الفيروس تقدم، مشيرا إلى أن، أما بالنسبة DBP، ونمط الزمني لتكرار الحمض النووي في هذه الكسور يمكن أيضا أن تدرس.

إلى جانب تحتوي على البروتينات الفيروسية والجينوم الفيروسي، RC أيضا مواقع الفيروسي التعبير أواخر الجينات. في الشكل 4 نقدم نتائج ممثلة من تجارب مصممة لقياس بواسطة RT-PCR مستوى الأنواع المختلفة من أواخر مرنا الفيروسي وعزلهم بين التعاون الإقليمي والقروض المتعثرة في 36 HPI. وقد تم تجميع مرنا في وقت متأخر الفيروسية في RC وتجهيزها postranscriptional يبدأ في هذه المواقع؛ في وقت لاحق هذه مرنا الفيروسية تنفصل عن RC، هي المحررة إلى جبلة النواة، ويتم تصديرها لاحقا إلى السيتوبلازم. وقد تم قياس تجمع إجمالي ناضجة أواخر مرنا الفيروسي (ML مرنا) باستخدام بادئات أن تضخيم وتقاطع اكسون الزعيم الثلاثي، وهوالتسلسل الذي يشكل 5 'من كل أواخر مرنا الفيروسة الغدانية (الشكل 4A). تقاطعات اكسون في مرنا النصوص ناضجة محددة من L2، كما تم قياس L4 L5 والأسر. وقد ثبت أن كمرحلة متأخرة من دورة تكاثر الفيروس تقدم، ويتم تصدير كميات متزايدة من مرنا أواخر الفيروسية إلى السيتوبلازم. ومع ذلك، من خلال زيادة أواخر الأوقات إنتاج الأنواع L5 مرنا أيضا في مقارنة مع غيرها من الأسر أواخر مرنا. في نتائج تمثيلية زرعت في الشكل (4) لوحظ اختلاف ما يقرب من 2.5 أضعاف في ML مرنا في القروض المتعثرة مقارنة مع إطار التعاون الإقليمي، كما هو متوقع. ومن المثير للاهتمام عندما نقارن مرنا من عائلات معينة، تظهر كلا L2 و L4 مرنا ليتم توزيعها في مستويات مماثلة بين الصورتين النووية الدقيقة (الشكل 4B و C، على التوالي)، في حين أظهرت L5 مرنا في المقابل بزيادة ما يقرب من 2 أضعاف في القروض المتعثرة بالمقارنة مع إطار التعاون الإقليمي. هذه النتائج تشير إلى وجود نمط الفرق في سي nthesis والتحرر من مختلف الأنواع أواخر مرنا الفيروسية من الفيروسة الغدانية RC (كما اقترح قبل 10). إلى حد كبير، تثبت هذه النتائج أن قياسات دقيقة لمختلف الخطوات في نشوء حيوي من مرنا الفيروسي يمكن القيام بها باستخدام معزولة RC مع هذا الإجراء الرواية.

الشكل 1
الشكل 1. مشرق الميدان المجهري للخطوات مختلفة خلال إجراء تجزئة. وخلال عزل RC، تحتاج العينات التي سيتم رصدها من قبل المجهر الضوئي لضمان سلامة الكسور الفرعية الخلوية. يوضح الشكل الخطوات المستخدمة في إجراءات الحصول على التعاون الإقليمي، من تورم خلايا HFF، لفصل النوى والعزلة إطار التعاون الإقليمي من خلال الوسائد السكروز. 40X الميكروسكوب: شريط نطاق 50 μ م؛ 63X الميكروسكوب: شريط مقياس مكون من 5 μ م؛ يظهر DBP باللون الأخضر.TPS: //www.jove.com/files/ftp_upload/53296/53296fig1large.jpg "الهدف =" _ فارغة "> الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 2
الشكل 2. وصمة عار الغربية ضد DBP. ويتم تحليل العينات بواسطة SDS-PAGE ومعالجتها لطخة غربية ضد DBP، علامة حسنة النية من RC الفيروسي. لتحديد التخصيب من البروتين في إطار التعاون الإقليمي، فمن المفيد أن نقارن بين وجود وفرة نسبية من DBP في كل إطار التعاون الإقليمي والقروض المتعثرة في أوقات مختلفة بعد العدوى. في الخلايا HFF يمثل 16 HPI وقت مبكر أثناء دورة النسخ المتماثل الفيروسة الغدانية. يصادف 24 HPI الانتقال إلى المرحلة المتأخرة من العدوى مع بدء تركيب الحمض النووي الفيروسي. يمثل 36 HPI في وقت متأخر من الوقت بعد الإصابة. يظهر الكتلة الجزيئية المتوقع من DBP. الرجاء أنقرك هنا لمشاهدة نسخة أكبر من هذا الرقم.

الشكل (3)
الشكل 3. PCR الفحص لكشف الفيروسي DNA (vDNA) في إطار التعاون الإقليمي. DNA وتنقيته من التعاون الإقليمي والقروض المتعثرة في 24 و 36 HPI. تم تضخيم الحمض النووي الفيروسي عن طريق PCR باستخدام بادئات محددة لالجينوم الفيروسي. ويوضح الرسم البياني لتخصيب اليورانيوم من الحمض النووي الفيروسي في إطار التعاون الإقليمي في 36 HPI. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 4
. الشكل 4. تم عزل تحليل الفيروسي RNA مرنا في وقت متأخر من التعاون الإقليمي والقروض المتعثرة وتحليلها بواسطة RT-PCR للكشف عن معين أواخر مرنا الفيروسي (A) إجمالي الفيروسية في وقت متأخر مرنا (ML: الرائد في وقت متأخر)؛ (B) مرنا من L2 الأسرة؛ (C) مرنا من L4 الأسرة؛ (D) مرنا من L5 الأسرة. وتمثل القيم ± متوسط ​​الانحراف المعياري للعينة ثلاث نسخ. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

اسم تسلسل التمهيدي إلى الأمام (5'-3 ') تسلسل التمهيدي العكسي (5'-3 ') درجة الحرارة الصلب

الجدول 1. الاشعال المستخدمة لالفيروسية في وقت متأخر مرنا التضخيم ML مرنا: هذه البادئات تسمح التضخيم من منطقة داخل زعيم الثلاثي، و'تسلسل 5 التي هي مشتركة بين كل أواخر مرنا الفيروسي. الاشعال L2 مرنا تسمح التضخيم من منطقة محددة داخل الكهروضوئية مرنا. الاشعال L4 مرنا تسمح التضخيم من منطقة محددة داخل 100 K مرنا. L5 مرنا يسمح التضخيم من منطقة داخل مرنا الألياف. درجات الحرارة تسلسل والصلب لكل متزمتوتظهر إيه.

Subscription Required. Please recommend JoVE to your librarian.


Name Company Catalog Number Comments
DMEM Gibco 12100-046 Warm in 37 ºC water bath before use
Fetal Bovine Serum Gibco 12484-028
Sucrose, Ultra Pure Research Organics 0928S Prepare a 2.55 M stock solution and store at 4 ºC
Dounce homogenizer Kontess Glass Company 884900-0000
Branson 1800 Ultrasonic Bath Branson Z769533 SIGMA Turn on 15 min before use.
Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate Life Technologies A-21121 Use at a 1:2,000 dilution in PBS
Silane-Prep Slides Sigma S4651-72EA Open in a laminar flow cabinet
SuperSignal West Pico Chemiluminescent Substrate Pierce ThermoScientific 34080



  1. Doucas, V., et al. Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure. Genes & Dev. 10, 196-207 (1996).
  2. Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. DNA virus replication compartments. J. Virol. 88, 1404-1420 (2014).
  3. Boon, J. A., Diaz, A., Ahlquist, P. Cytoplasmic viral replication complexes. Cell host microbe. 8, 77-85 (2010).
  4. Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment. J. Virol. 87, 10612-10627 (2013).
  5. Busch, H., et al. Isolation of Nucleoli. Exp Cell Res. 24, Suppl 9. 150-163 (1963).
  6. Lam, Y. W., Lyon, C. E., Lamond, A. I. Large-scale isolation of Cajal bodies from HeLa cells. Mol. Biol. Cell. 13, 2461-2473 (2002).
  7. Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. The nucleolus. J Cell Sci. 118, 1335-1337 (2005).
  8. Groitl, P., Dobner, T. Construction of adenovirus type 5 early region 1 and 4 virus mutants. Methods Mol Med. 130, 29-39 (2007).
  9. Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein. Virology. 128, 480-484 (1983).
  10. Leppard, K. N. Selective effects on adenovirus late gene expression of deleting the E1b 55K protein. J Gen Virol. 74, (Pt 4), 575-582 (1993).
  11. Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts. J. Virol. 80, 964-974 (2006).
  12. Castillo-Villanueva, E., et al. The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection. ISRN Virology. 2014, 14 (2014).
  13. Morris, S. J., Scott, G. E., Leppard, K. N. Adenovirus late-phase infection is controlled by a novel L4 promoter. J. Virol. 84, 7096-7104 (2010).
  14. Wright, J., Leppard, K. N. The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53. J. Virol. 87, 11617-11625 (2013).
العزلة الفيروسية النسخ المتماثل حجرة التخصيب النووي الكسور الفرعية من اتش المصابة الخلايا الطبيعية الإنسان
Play Video

Cite this Article

Hidalgo, P., Gonzalez, R. A. Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells. J. Vis. Exp. (105), e53296, doi:10.3791/53296 (2015).More

Hidalgo, P., Gonzalez, R. A. Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells. J. Vis. Exp. (105), e53296, doi:10.3791/53296 (2015).

Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter