Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

الجانبي جذر النظام محرض في doi: 10.3791/53481 Published: January 14, 2016
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

نظام الجذر هو أمر حاسم لنمو النبات، لأنه يضمن مرسى وامتصاص الماء والمواد المغذية من التربة. لأن التوسع في نظام الجذر يعتمد بشكل رئيسي على إنتاج الجذور الجانبية، وقد درست على نطاق واسع شروعهما والتشكيل. وبدأت الجذور الجانبية في مجموعة فرعية معينة من الخلايا محيط بالدائرة، تسمى خلايا مؤسس 1. في معظم dicots، مثل نبات الأرابيدوبسيس thaliana، وتقع هذه الخلايا في القطبين protoxylem في حين أنه في ذوات الفلقة مثل الذرة، وجدوا في القطبين اللحاء 3. وتتميز الخلايا مؤسس بزيادة استجابة أوكسين تليها التعبير عن الجينات دورة الخلية محددة (على سبيل المثال، السيكلين B1، 1 / CYCB1؛ 1)، وبعد ذلك الخضوع لجولة أولى من الانقسامات احديدابي غير المتماثلة 5. بعد سلسلة من الانقسامات احديدابي وpericlinal منسقة، وشكلت منشم الجذر الوحشي التي في النهاية سوف تظهر بوصفها أحدالجذر الوحشي utonomous. موقع وتوقيت الجانبي بدء الجذر ولكن لا يمكن التنبؤ به، لأن هذه الأحداث ليست وفيرة ولا متزامنة. هذا يعوق استخدام نهج الجزيئية مثل transcriptomics لدراسة هذه العملية.

لمعالجة هذا، وقد وضعت جانبي جذر النظام محرض (LRIS) 6، 7، وفي هذا النظام، يتم التعامل مع الشتلات الأولى مع N حامض -1-naphthylphthalamic (NPA)، الذي يثبط النقل أوكسين وتراكم، وبالتالي عرقلة الجانبي بدء الجذر 8. عن طريق نقل في وقت لاحق الشتلات والمتوسطة التي تحتوي على أوكسين الاصطناعية حامض الخليك 1-النفتالين (NAA)، تستجيب الطبقة محيط بالدائرة بأكملها إلى مستويات مرتفعة مما أوكسين بكثافة حمل الجانبية الجذر بدء انقسامات الخلية 6. على هذا النحو، فإن هذا النظام يؤدي إلى سريعة ومتزامنة وشاملة جذور التلقين الجانبية، مما يسمح للمجموعة سهلة من عينات الجذر المخصب لمرحلة محددة في وقت متأخرالتنمية الجذرية راؤول. وفي وقت لاحق، هذه العينات يمكن استخدامها لتحديد ملامح التعبير الجينوم على نطاق خلال تشكيل الجذر الوحشي. قد تسفر عن LRIS معرفة كبيرة بالفعل عن بدء الجانبي الجذرية في نبات الأرابيدوبسيس والذرة 13/09، ولكن الحاجة إلى تطبيق هذا النظام على الأنواع النباتية الأخرى يصبح أكثر وضوحا كما هي التسلسل المزيد من الجينوم، وهناك اهتمام متزايد لنقل المعرفة إلى أهمية اقتصادية الأنواع.

هنا، يتم إعطاء البروتوكولات مفصلة للنبات الأرابيدوبسيس والذرة LRISs. بعد ذلك، يتم توفير مثال على استخدام النظام، من خلال توضيح كيف يمكن استخدام البيانات transcriptomics المكتسبة من LRIS الذرة لتحديد homologs الوظيفية التي لها وظيفة الحفظ أثناء بدء الجذر الوحشي عبر الأنواع النباتية المختلفة. وأخيرا، مبادئ توجيهية لتحسين LRIS ليقترح الأنواع النباتية الأخرى.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. نبات الأرابيدوبسيس بروتوكول LRIS

ملاحظة: يشير النص إلى "الصغيرة" أو "كبيرة" التجارب على نطاق و. التجارب الصغيرة، مثل تحليل خط علامة وتلطيخ النسيجي 6، 14، لا يتطلب سوى بضع عينات. تجارب على نطاق واسع، مثل الكمي في الوقت الحقيقي QRT-PCR، المصفوفات الدقيقة 11/09 أو RNA تسلسل، تتطلب قدرا أكبر من العينات. على هذا النحو، مبلغ ~ 1000 شتلة لكل عينة تم استخدامها من قبل Vanneste وآخرون. 11 لأداء تجربة ميكروأري بعد الجزء الجذر تشريح.

اليوم 1

  1. تعقيم بذور نبات الأرابيدوبسيس
    ملاحظة: يتم اختيار أحد الإجراءات التالية لتعقيم البذور. أي منهم هو مناسبة للخطوات القادمة من البروتوكول. التعقيم الغاز (1.1.2) ويعرض اثنين من المزايا الرئيسية على التعقيم السائل (1.1.1): يستغرق وقتا أقل عند التعامل مع خدر كبيرإيه من البذور، لأنه لا pipetting لأن تحدث لعينات فردية؛ والبذور المعقمة يمكن تخزينها لفترة أطول. ومع ذلك، فإنه يتطلب المجفف ومعالجة متأنية.
    1. التعقيم السائل
      1. صب العدد المطلوب من البذور في أنابيب صغيرة أجهزة الطرد المركزي. استخدام ما يصل إلى 20 ملغ (~ 800 البذور) في أنبوب 1.5 مل أو 40 ملغ (~ 1600 البذور) في 2 مل أنابيب متناهية الصغر الطرد المركزي.
      2. إضافة 1 مل من الايثانول 70٪. عكس أو تهزه برفق لمدة 2 دقيقة.
      3. استبدال الإيثانول 70٪ مع 1 مل من محلول التعقيم لمدة 15 دقيقة. (يعد حل التعقيم العذبة: 3.85 مل هيبوكلوريت الصوديوم (NaOCl) الأسهم (12٪) (تنبيه: استخدام غطاء الدخان)، 5 ميكرولتر توين 20، وتصل إلى 10 مل بالماء عكس أنابيب عدة مرات للتأكد من أن جميع البذور تأتي. في اتصال مع الحل.
      4. في الطباقي مجلس الوزراء تدفق الهواء، واستبدال الحل التعقيم مع 1 مل من الماء المقطر المعقم وشطف البذور 5 مرات لمدة 5 دقائق بواسطة المتكررةلاي استبدال مع 1 مل من الماء المقطر المعقم النقي.
    2. التعقيم الغاز
      1. صب العدد المطلوب من البذور في 2 مل أنبوب الصغرى الطرد المركزي. استخدام أنابيب الفردية عند العمل مع العديد من خطوط المستقلة، وترتيبها افتتح في مربع أنابيب الطرد المركزي الصغيرة من البلاستيك أو حامل. وإذا كان عدد البذور في أنبوب واحد يتجاوز 500 (12.5 ملغ)، تقسيم البذور في العدد المناسب من الأنابيب لضمان التعقيم ناجحة. تأكد من أن أغطية أنابيب المجاورة لا تغطي بعضها البعض. تناسب معا غطاء مربع في الجزء السفلي، كما يجب أن يكون في المجفف فضلا عن التعقيم.
      2. وضع مربع في وعاء من مجفف، جنبا إلى جنب مع كوب من الزجاج (تنبيه: استخدام غطاء الدخان).
      3. ملء كوب مع 100 مل من 12٪ NaOCl (تنبيه: استخدام غطاء الدخان). وضع غطاء على مجفف، ولكن ترك فتحة صغيرة حيث يتم وضع الكأس.
      4. إضافة 3 مل من حمض الهيدروكلوريك 37٪ (دخن) (CAUTION: استخدام غطاء الدخان) إلى كوب من خلال فتحة صغيرة وبسرعة إغلاق المجفف. إرادة فقاعة حل لبعض الوقت بسبب الكلور 2 -gas تشكيل. ترك النظام أغلقت O / N (أو على الأقل 8 ساعة).
      5. إزالة غطاء المجفف. واخراج مربع وتغطية ذلك مع غطاء لتجنب التلوث أثناء النقل.
      6. وضع مربع في الطباقي مجلس الوزراء تدفق الهواء، وإزالة الغطاء وترك البذور لمدة 1 ساعة على RT للسماح إطلاق الغاز.
        ملاحظة: بذور يمكن تخزينها بأمان الجافة في أنابيب صغيرة أجهزة الطرد المركزي مغلقة لمدة تصل إلى 2 أسابيع في 4 درجات مئوية.
  2. الحث الجذر الوحشي في نبات الأرابيدوبسيس
    1. الوحشي الجذر تثبيط (NPA العلاج)
      1. إعداد متوسط ​​النمو للنمو في المختبر. المتوسط ​​يحتوي على نصف قوة Murashige وسكوغ مزيج من الملح 15، 0.1 غرام / L-ميو اينوزيتول، 10 ز / L السكروز، ويتم تخزينها مؤقتا مع 0.5ز / L 2- (N-morpholino) حمض ethanesulfonic (MES).
      2. ضبط درجة الحموضة إلى 5.7 مع 1 M KOH. إضافة 8 غرام / لتر من الأنسجة النباتية وأجار الأوتوكلاف متوسطة لمدة 20 دقيقة في درجة حرارة 121 مئوية.
      3. إعداد 25 ملي حل الأوراق المالية من NPA في dimethylsulfoxide (DMSO) (تنبيه: استخدام القفازات). في الطباقي مجلس الوزراء تدفق الهواء، تبريد متوسطة تعقيمها وصولا الى حوالي 65 درجة مئوية (وهي درجة الحرارة التي الزجاجة يمكن عقد باليد)، وإضافة 25 ملي NPA حل الأسهم للحصول على التركيز النهائي من 10 ميكرومتر NPA.
      4. التجانس على إضافة عن طريق هز بلطف الزجاجة لمدة 10 ثانية. صب 50 مل من المتوسط ​​في طبق بتري مربع (12 سم × 12 سم).
        ملاحظة: في حالة التجربة على نطاق واسع، وتطبيق شبكة من النايلون (20 ميكرون) لضمان سهولة نقل. إعداد شبكة (9 سم × 9 سم) لالتعقيم (الشكل 1A). عندما تعقيمها، وتطبيق شبكة لمتوسط ​​النمو باستخدام ملاقط معقمة (الشكل 1B). دفع بلطف شبكة لمتوسط ​​النمو باستخدام الظريفrilized drigalsky للتأكد من أنها على اتصال جيد مع النمو المتوسطة (الشكل 1B) (تنبيه: العمل في ظروف معقمة).
      5. زرع بذور على NPA-لوحات.
        ملاحظة: في حال تم التخطيط تجربة على نطاق واسع، وزرع 2 صفوف كثيفة ومتماشية بشكل جيد من 50 البذور لتسهيل أخذ العينات (انظر 1.2.2.3).
        1. في حالة التعقيم السائل، وزرع بذور على NPA لوحات باستخدام الماصة 200 ميكرولتر. قطع 3-4 ملم من نهاية نصائح pipetting لفي ظروف معقمة (أو قبل التعقيم من النصائح) من أجل أن تكون قادرة على الماصة البذور. الماصة صعودا وهبوطا عدة مرات لاعادة تعليق البذور، ثم الماصة للمياه حوالي 150 ميكرولتر العقيمة مع 10-20 البذور والانتظار حتى الرواسب البذور في الجزء السفلي من غيض. (تنبيه: العمل في ظروف معقمة)
          ملاحظة: عندما لمس أجار أو شبكة بلطف مع طرف، سيتم الافراج عن قطرة ماء مع بذرة منه (الشكل 1C).
        2. <li> في حالة التعقيم الغاز، وزرع بذور باستخدام تعقيمها toothpicks.Pinch مسواك في آغار قبل اتخاذ بذور لضمان السطح لزجة. التقط واحدة البذور من جانب واحد باستخدام مسواك وتوزيع البذور على لوحات (1D الشكل). بدلا من ذلك، إضافة الماء المعقم للبذور، وزرع كما هو موضح في 1.2.1.5.1 (تنبيه: العمل في ظروف معقمة).
      6. ختم لوحات مع شريط لاصق للتنفس وتخزينها لوحات في 4 درجات مئوية في الظلام لمدة 2 أيام على الأقل وأقصى مدة أسبوع واحد. وهناك حاجة لهذا التقسيم ويضمن تزامن وإنبات أكثر كفاءة.
        ملاحظة: بدلا من ذلك، والبذور يمكن طبقية قبل البذر، مغمورة في الماء المقطر في أنابيب صغيرة أجهزة الطرد المركزي، الأمر الذي يتطلب أقل مساحة الثلاجة. في هذه الحالة، تخزين الأنابيب لمدة أسبوع واحد على الأقل في 4 درجات مئوية، ونقل لوحات لمجلس الوزراء نمو فورا بعد البذر (انظر 1.2.1.7).
        DAY 3 نقل لوحات لمجلس الوزراء النمو (ضوء مستمر (110 μE م -2 ث -1)، 21 ° C) لمدة 5 أيام (2 أيام من الإنبات و3 أيام من النمو) في وضع عمودي تقريبا (80-90 درجة) لضمان نمو الجذور على، وليس في المتوسط.
        DAY 8
    2. الوحشي الجذر التعريفي (NAA العلاج)
      1. إعداد نفس متوسط ​​النمو كما هو موضح في 1.2.1.1 و1.2.1.2. إعداد 50 ملي حل الأوراق المالية من NAA في DMSO (تنبيه: استخدام القفازات). تبريد متوسطة تعقيمها وصولا الى 65 درجة مئوية وإضافة حل NAA إلى وسيلة للحصول على تركيز النهائي من 10 ميكرومتر NAA (تنبيه: العمل في ظروف معقمة).
        1. التجانس على إضافة عن طريق هز بلطف الزجاجة لمدة 10 ثانية. صب 50 مل من المتوسط ​​في طبق بتري مربع (12 سم × 12 سم).
      2. نقل الشتلات من لوحات تحتوي على المتوسط ​​النمو تستكمل مع 10 ميكرومتر NPA لتلك سوبplemented مع 10 ميكرومتر NAA.
        1. ربط أحضان ملاقط منحنية تحت النبتات من الشتلات وإزالة برفق من اللوحة. نقل الشتلات فقط منها جذور نمت تماما في اتصال مع وسيلة NPA-النمو ويفضل أن يكون أسفل.
        2. المقشود الجذرية على النمو المتوسطة سطح المحتوية على NAA على مسافة صغيرة. تأكد من أن جذور النباتات على اتصال جيد مع النمو المتوسطة. إذا لزم الأمر، اضغط على الجذر برفق على سطح النمو المتوسطة مع ملاقط.
          ملاحظة: في حالة وجود تجربة على نطاق واسع، وإزالة جميع الشتلات التي ليست على اتصال مع شبكة ونقل برفع شبكة على اثنين من الزوايا العليا مع ملاقط. تأكد من أن شبكة على اتصال جيد مع المتوسطة التي تحتوي على NAA القشط شبكة على سطح أجار على بعد مسافة صغيرة (الشكل 1E).
      3. ختم لوحات جديدة مع الشريط تنفس ووضعها في خزانة النمو (يخدعضوء tinuous (110 μE م -2 ث -1)، 21 ° C) في وضع عمودي للمرة المطلوب بعد تحريض حتى أخذ العينات.
        ملاحظة: في حالة وجود تجربة على نطاق واسع، واستخدام مشرط لقطع شرائح الجذر في كل مرة مباشرة على شبكة وأخذ عينات منها عن طريق كشط بلطف على سطح شبكة.

2. LRIS بروتوكول الذرة

  1. الطبقات من الذرة الألباب
    1. احتضان حبات الذرة في 4 درجات مئوية في الظلام لمدة 1 أسبوع على الأقل.
      ملاحظة: لقد تم تطوير هذا البروتوكول باستخدام السلالة النقية الذرة B73.
  2. تعقيم الذرة الألباب
    اليوم 1
    ملاحظة: على الرغم من شتلات الذرة لا يجب أن تزرع في ظروف معقمة، فمن المستحسن لتعقيم حبات الذرة والعمل مع مواد معقمة لمنع نمو الفطريات في لفة ورقنظام.
    1. وضع العدد اللازم من حبات الذرة في كوب زجاجي معقم.
    2. إضافة 100 مل من محلول التعقيم (6٪ NaOCl في الماء) (تنبيه: استخدام غطاء الدخان).
    3. إضافة شريط مغناطيسي ووضع الكأس على محرك مغناطيسي في انخفاض سرعة التحريك (ما يقرب من 250 دورة في الدقيقة) في RT لمدة 5 دقائق.
    4. شطف خمس مرات لمدة 5 دقائق عن طريق استبدال الحل مع 100 مل من الماء المعقم النقي.
  3. زرع الذرة الألباب
    1. وضعت على قفازات للحد من مخاطر التلوث، واتخاذ لفة من المناشف الورقية.
    2. تمزيق اثنين تمتد من ناحية منشفة ورقية يبلغ طولها الإجمالي من ورقتين (حوالي 92 سم × 24 سم) ووضعها فوق بعضها البعض على سطح نظيف (الشكل 2A).
    3. طي صحائف مضاعفة على طول (حوالي 92 سم x 12 سم) (الشكل 2A).
    4. استخدام ملاقط لتوزيع 10 حبات في حوالي 2 سم من أعلى أنحاء ركان طول الورقة، مع إبقاء فرجة بين شيئين من 8 سم بين كل نواة و8 سم مجانا عند كلا الطرفين (الشكل 2B). تأكد يواجه الجذير من النواة إلى أسفل ونحو الورقة (الشكل 2B).
    5. لفة بلطف ورقة على طول، مع الحفاظ على البذور في مكان (الشكل 2B). لتسهيل المتداول، وهو اختياري للرش أول ورقة مع الماء المعقم.
    6. وضع لفافات ورق في أنابيب زجاجية معقمة من حوالي 6 سم وقطرها 14 سم ارتفاع (على سبيل المثال، 250 مل أنابيب الطرد المركزي) ووضعها في الرف (الشكل 2C).
  4. الحث الجذر الوحشي في الذرة
    1. إعداد 50 ملي NPA حل سهم (الذائبة في DMSO) (تنبيه: استخدام القفازات).
    2. لكل أنبوب، وجعل 50 ميكرومتر NPA حل عن طريق إضافة 125 ميكرولتر من ملي NPA حل سهم 50-125 مل من الماء المعقم في دورق زجاجي معقم.
    3. تخلط جيدا وصب 125 مل من NPA حل 50 ميكرومتر على ورقة لفة في أنبوب. سوف لفة ورق امتصاص الحل وأصبحت غارقة تماما.
      ملاحظة: عند استخدام لفافات ورق وأنابيب مع الأبعاد الأخرى، وضبط حجم وفقا لذلك. السائل ينبغي أن تصل إلى منتصف الطريق في أنبوب لضمان امتصاص كافية.
    4. وضع نظام لفة ورقة في خزانة النمو لمدة ثلاثة أيام (27 ° C، وعلى ضوء مستمر، والرطوبة النسبية 70٪). تأكد من أن لفافات ورق لا تزال غارقة بإضافة إضافي 50 ميكرومتر NPA الحل، لأن الحل يتبخر مع مرور الوقت (الشكل 2D).
      DAY 4
    5. إعداد 50 ملي NAA حل سهم (الذائبة في DMSO) (تنبيه: استخدام القفازات).
    6. لكل أنبوب، يعد حل NAA 50 ميكرومتر وذلك بإضافة 125 ميكرولتر من المخزون 50 ملي NAA إلى 125 مل من الماء المعقم في دورق زجاجي معقم.
    7. الضغط بلطف من أكثر من الحل NPA المتبقية من لفافات ورق ووضعم في الماء المعقم لمدة 5 دقائق لغسل بها (تنبيه: استخدام القفازات). الضغط بلطف على معظم المياه من لفافات ورق. كرر هذه الخطوة غسل ثلاث مرات.
    8. تخلط جيدا وتصب في حل NAA 50 ميكرومتر على لفافات ورق في الأنابيب. تأكد من أنها غارقة تماما.
    9. وضع نظام لفة الورق في مجلس الوزراء نمو (27 ° C، وعلى ضوء مستمر، والرطوبة النسبية 70٪) لمدة المطلوب بعد تحريض.
  5. الحث الجذر الوحشي في جذور عرضية ولي الذرة
    ملاحظة: LRIS كما هو موضح أعلاه يدفع الجذور الجانبية في الجذر الرئيسي. ومع ذلك، في الذرة وmonocotyledons أخرى، والجذر الرئيسي والجذور الأصيلة الجنينية، جنبا إلى جنب مع جذورهم الجانبية، هي مهمة بشكل أساسي خلال الشتلات التنمية. في مرحلة لاحقة في نمو النبات، تنشأ جذور عرضية بعد الجنينية على الجذع وأيضا تطوير الجذور الجانبية لتشكيل نظام الجذر الجديد 16. وLRIS يمكن أيضا أن يكون استخدامد للحث على الجذور الجانبية على هذه الجذور تاج عرضية بعد الجنينية من خلال اتباع بعض التعديلات الطفيفة على LRIS على الجذر الرئيسي الجنينية.
    1. لجعل لفات الورق، وإنشاء شطيرة من الأوراق على التوالي مع طبقتين من ناحية منشفة ورقية على الجانب الخارجي، وطبقتين من الورق إنبات الداخل. ضع حبات تعقيمها (انظر الخطوات 2،1-2،2) بين اثنين من ورقة من الورق الإنبات. ورقة إنبات، بالمقارنة مع منشفة ورقية جهة، ويكونون أقل عرضة للأن يخترق جذور الشعر والجذور الجانبية، الأمر الذي سيجعل من فتح ورقة لفات أسهل في وقت لاحق. من ناحية أخرى، سوف طبقتين الخارجية من ناحية منشفة ورقية تسهيل امتصاص السائل.
    2. إدراج القوائم في 700 مل أنابيب زجاجية ويصب الماء المعقم دون NPA عليها. تأكد من أنها غارقة تماما.
    3. تنبت بذور معقمة في مجلس الوزراء النمو (راجع الخطوة 2.4.9).
    4. زراعة الشتلات حتى جذور عرضية التاجتبدأ في الظهور (6 أيام لB73). تأكد من إبقاء فات الورق الرطب في جميع الأوقات وذلك بإضافة الماء المعقم عند الضرورة.
    5. نقل إلى حل 25 ميكرومتر NPA لمدة 4 أيام (انظر الخطوات 2.4.1 إلى 2.4.4)، تليها تحريض مماثل من جانبي بدء الجذر بالاستعاضة عن حل NPA مع حل NAA 50 ميكرومتر بعد خطوة الغسيل (راجع الخطوة 2.4 0.5 إلى 2.4.9).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

تطبيق LRIS إلى تنفيذ Transcriptomics المقارن من الجانبي عملية الجذر بدء

تطبيق واحد من LRIS هو المقارنة والربط بين ملامح التعبير الجيني خلال تشكيل الجذر الوحشي في الأنواع المختلفة. نهج transcriptomics المقارنة خلق إمكانية لتحديد orthologous الجينات المشاركة في عملية التنمية الجذرية الجانبية في الأنواع المختلفة. بدء الجذر الوحشي، الذي يتألف من تشكيل الجهاز الجديد من مجموعة فرعية من الخلايا الواردة في محور الجذر شكلت بالفعل، هي الآلية الرئيسية المشتركة بين كاسيات البذور للسيطرة على الهندسة المعمارية جذورها. ونتيجة لذلك، فمن المحتمل جدا أنه تطور من مسارات القائمة الحالية في سلف مشترك والحفظ في جميع أنحاء التطور. في الواقع، تم العثور على المنظمين المحتملة المشتركة الوحشي بدء الجذرية في الأنواع المختلفة <سوب> 17، 18.

أخذ العينات المواد باستخدام LRIS في نبات الأرابيدوبسيس والذرة، وتحليل Transcriptome على

وقد أنشأ LRIS في نوعين من أنواع مختلفة: نبات الأرابيدوبسيس والذرة 10 و 13 في كل من الأنواع، تقرر أخذ عينات من النباتات فقط قبل العلاج NAA، وبعد فترة وجيزة من الاستقراء، في بداية أو خلال الاستجابة أوكسين، كما كذلك في بداية أو أثناء الانقسامات الأولى في محيط بالدائرة. وعلاوة على ذلك، مضان تنشيط خلية فرز 19 (FACS) كانت تستخدم في نبات الأرابيدوبسيس أو الليزر التقاط المجهري 20، 21 (LCM) في الذرة لتحديد لخلايا محيط بالدائرة. في نبات الأرابيدوبسيس، والوقت من نقاط 2 و 6 ساعات بعد تحريض تم اختيارهم بناء على توصيف النسخي من pDR5 :: المكتب المركزي للاحصاءات استجابة أوكسين وpCYCB1(1)؛ :: المكتب المركزي للاحصاءات خطوط علامة دورة الخلية 9 (الشكل 3). في الذرة، وهي المرة الفقرات 2 و 3 و 4 ساعات بعد تحريض اختيرت، بعد توصيف المجهرية النشاط انقسام الخلايا وتحليل العديد من الجينات دورة الخلية علامة التعبير في الوقت الحقيقي باستخدام عكس الكمي سلسلة النسخ تفاعل البلمرة (QRT-PCR) 13 . تم استخراج الحمض النووي الريبي من الخلايا المعزولة والمهجنة على منصات ميكروأري كما هو موضح سابقا 10 و 13.

العثور على Ortholog من نبات الأرابيدوبسيس CYCB1؛ 1 (AtCYCB1؛ 1) في الذرة

في نبات الأرابيدوبسيس، خط علامة pCYCB1؛ (1) :: المكتب المركزي للاحصاءات وقد استخدم على نطاق واسع لتتبع الانقسامات الأولى من محيط بالدائرة خلال الجانبي بدء الجذر. ومن شأن هذه علامة أن يكون جدامفيدة في الذرة. تم العثور على 1 في الذرة (www.maizesequence.org، كل الببتيدات، BLASTP، الإعدادات الافتراضية)؛ عدة homologs من AtCYCB1. وكان ستة منهم موجود على ميكروأري تنفيذها بعد LRIS في الذرة وأظهرت تخصيب كبير. أفضل ضرب انفجار، GRMZM2G310115، أظهرت مستويات عالية جدا النسخ بعد LRIS، على غرار ما لوحظ في نبات الأرابيدوبسيس لAtCYCB1؛ 1 (الشكل 4).

تطبيق LRIS لتحقق فرد التعبير الجيني

للتحقق من صحة GRMZM2G310115 باعتباره ortholog مرشح جيد لAtCYCB1؛ (1) في الذرة الوحشي بدء الجذر، في الوقت الحقيقي QRT-PCR على عينات أخذت في نقاط زمنية مختلفة تم تنفيذها خلال لLRIS 13. وعولج النباتات كما هو موضح في البروتوكول المذكور أعلاه وتحصد في نقاط زمنية مختلفة: قبل Nالعلاج AA (NPA)، وبعد 2 و 3 و 4 ساعات من العلاج NAA. أيضا، كان حصادها المواد من النباتات التي تزرع فقط في الماء لمقارنة الجينات بين LRIS والشروط محايدة. مباشرة بعد الحصاد، وشرائح الجذر المقابلة لمنطقة تضم ما بين 5 ملم و 15 ملم فوق قمة الجذر تم تشريح تحت مجهر. باستخدام الملقط، تم فصل القشرة من الشاهدة (الذي يحتوي على الدائرة المحيطية)، واستخراج الحمض النووي الريبي من كل من الأنسجة. تم تنفيذ هذه الخطوة الأخيرة بدلا من LCM، لأنه أسرع بكثير وأرخص للمصادقة. باستخدام الأمام منهما التالية وعكس الاشعال QRT-PCR، AGCAGGACGCAGTTGGAGAG وGAGCCGAGAGCACAGAAGAAAG، تم التحقق من صحة GRMZM2G310115 أن تكون على LRIS التنظيم يصل، وعلى أن تكون محددة لأنسجة الشاهدة (الشكل 5). بالإضافة إلى ذلك، تظهر هذه التجربة أنه من دون تحريض متزامن، أحداث منفصلة الوحشي بدء الجذر يحدث في جذر المتزايد في المياه ليست قابلة للكشف، وتوضيح الحاجة لLRIS للكشف التفاضلية التعبير الجيني المتعلقة بعملية الوحشي بدء الجذر.

الشكل 1
الشكل 1. الجانبي جذر النظام محرض للنبات الأرابيدوبسيس (A) إعداد شبكة من النايلون (20 ميكرون): قطع شبكة من النايلون (9 سم بنسبة 9 سم)، ألفه في رقائق الألومنيوم ووضعها في كوب زجاجي لالتعقيم. (B) تطبيق شبكة من النايلون على صفيحة NPA التي تحتوي على (10 ميكرومتر) باستخدام الملقط. ثم استخدام drigalski عقيمة من أجل القضاء على فقاعات الهواء. (C) بذر البذور على النايلون شبكة باستخدام الماصة. (D) بذر البذور على شبكة النايلون استخدام المسواك. (E) نقل النايلون شبكة لوحة تحتوي على NAA (10 ميكرومتر) باستخدام الملقط.81 / 53481fig1large.jpg "الهدف =" _ فارغة "> الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 2
الشكل 2. الجانبي جذر النظام محرض للالذرة.   (A) إعداد لفافات ورق: مكان طبقتين من الورق (92 سم × 24 سم، وطول ورقتين) فوق بعضها البعض، وأضعاف مضاعفة لهم على طول (92 سم × 12 سم). (B) بوضع 10 حبات الذرة معقمة مع الجذير متجهة لأسفل على ورقة في 2 سم من أعلى مع interspacing 8 سم. ثم نشمر ورقة مع الحفاظ على حبات الذرة في المكان. (C) ضع لفافات ورق في أنابيب (على سبيل المثال، 250 مل أنابيب الطرد المركزي) ووضعها في رف. (D) تنمو الشتلات الذرة لمدة ثلاثة أيام في 50 ميكرومتر NPA الحل (في 27 ° C، وعلى ضوء مستمر، humi النسبيdity 70٪). (E) بقي من الزمن: الشتلات قبل نقلها إلى NAA؛ الوسط: أقسام مستعرضة مشراح قبل نقلها إلى NAA و 2 أيام بعد نقلها إلى NAA؛ الحق: الشتلات مع مرئية الجذور الجانبية ظهرت بعد 5 أيام نقل إلى NAA الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (3)
يتم تحفيز الشكل 3. الجانبي الجذر بدء عند المطول NAA العلاج. (AF) فترة بالطبع تظهر استجابة أوكسين أثناء العلاج NAA باستخدام سطر علامة pDR5 :: المكتب المركزي للاحصاءات. رد أوكسين، التي تعد واحدة من الأحداث الأولى اثار جانبية بدء الجذر، يبدأ 2 ساعة بعد بدء العلاج NAA. في لوحة العلوي، وتعطى لمحة عامة عن الشتلات كاملة. أقل عرض لوحةليالي استجابة أوكسين في قمة الجذر. (GM) فترة سير العلاج NAA باستخدام pCYCB1؛ (1) :: المكتب المركزي للاحصاءات خط علامة. إشارة المكتب المركزي للاحصاءات تمثل تعبيرا عن CYCB1؛ 1 الجيني، مما يشير إلى أن الانقسامات الخلية الأولى مما أدى إلى تشكيل الجذر الوحشي تبدأ 6 ساعات بعد بدء العلاج NAA. في لوحة العلوي، وتعطى لمحة عامة عن الشتلات كاملة. وتظهر اللوحة السفلى CYCB1؛ 1 التعبير في قمة الجذر (المكتب المركزي للاحصاءات تلطيخ وفقا لBeeckman وإنجلر، 1994 22) الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 4
الرقم 4. الشخصي التعبير عن الجينات CYCB1 في نبات الأرابيدوبسيس والذرة خلال LRIS.   (A) القيم ميكروأري التعبير عن AtCYCB1؛ 1 خلال LRIS كما وصفها دي سميت وآخرون. 2008 10 (B) ميكروأري القيم تعبير عن orthologs المحتملة للAtCYCB1؛ 1 خلال LRIS كما وصفها يانسن وآخرون. 2013 درجة 13 BLASTP هي النتيجة التي تم الحصول عليها عندما نسف تسلسل البروتين من AtCYCB1؛ 1 على جينوم الذرة. أشرطة الخطأ تعبر عن الانحراف المعياري و** تقف لص -value ≤0.01. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 5
الرقم 5. التعبير عن GRMZM2G310115 في مسلة واللحاء من الجذور الذرة خلال LRIS. إن التعبير عن <م> تم تقييم GRMZM2G310115 خلال LRIS في الذرة بنسبة الكمي في الوقت الحقيقي QRT-PCR على تشريح الشاهدة والقشرة العينات. تم إجراء المعاينة التكميلية على النباتات المزروعة في المياه. وتم تطبيع قيم التعبير في شاهدة في الماء. أشرطة الخطأ تعبر عن الانحراف المعياري و** تقف لص -value ≤0.01 (الاشعال والجينات المرجعية وفقا ليانسن وآخرون. 2013 13). يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

في بروتوكول نبات الأرابيدوبسيس LRIS، فمن المهم فقط لنقل الشتلات التي نمت بشكل كامل في اتصال مع متوسط ​​النمو NPA التي تحتوي على. هذا يضمن أن يتم حظر الجانبي بدء الجذر على طول الجذر بأكمله. من أجل منع إصابة شتلات أثناء النقل، أحضان ملقط المنحنية يمكن أن يكون مدمن مخدرات تحت النبتات من الشتلات. عند نقله، تأكد من أن جذور الشتلات على اتصال كاف مع المتوسط ​​أجار التي تحتوي على NAA. ويمكن تحقيق ذلك عن طريق القشط الجذرية على سطح أجار على بعد مسافة صغيرة. وهذا يضمن لمحة تعريفية متزامنة الفعال للبدء الجذر الوحشي على مجموع طول الجذر. يمكن زراعتها جذور تعرضها للضوء دون أن يؤثر ذلك سلبا على نموها والوحشي الاستقراء الجذر.

في بروتوكول الذرة LRIS، فمن المهم أن الجذير من نواة يواجه أسفل ونحو ورقة لضمان الجذر سوف تنمو دownwards ونعلق على الورق في الجانب الصحيح (16). بعد ثلاثة أيام من العلاج NPA، ينبغي أن الشتلات ظهرت من نواة مع تبادل لاطلاق النار صغير، والجذر الرئيسي والجذور الأصيلة 16. يجب أن يكون الجذر الرئيسي ما يقرب من 2 سم طويلة قبل الانتقال إلى تحريض الجانبي بدء الجذر. وقد تم تطوير هذا البروتوكول باستخدام السلالة النقية الذرة B73، ولكن في حالة وجود خط الذرة بمعدل نمو مختلفة، وضبط الوقت الحضانة وفقا لذلك. تأكد من أن لفافات ورق لا تزال غارقة بإضافة بانتظام 50 ميكرومتر NPA الحل عندما يتبخر السائل مع مرور الوقت، وإلا معالجة NPA يمكن أن تكون في وقت مبكر التنمية الجذرية الجانبية غير فعالة وغير المرغوب فيها يمكن ان تحدث. النظام نفسه يمنع المعرض من الجذور إلى الضوء، ولكن النور ليس قضية رئيسية و لا يؤثر على نمو الجذور والوحشي الاستقراء الجذر.

طرق بديلة لتحريض رقابة من الجذور الجانبية هي استخدام MEChanical الانحناء 23 أو 24 gravistimulation. والميزة الرئيسية لهذه الأنظمة هو أن لديهم الحث 'الطبيعي' أكثر مقارنة مع العلاجات الهرمون في LRIS، ولكن العيب هو أن تكون محدودة في كمية من المواد التي يمكن حصاده عند نقطة زمنية معينة لأنها فقط تحقق الجانبي الحدث بدء جذر واحد في منعطف في البادرات مقارنة مع الحث الكامل للمحيط بالدائرة في LRIS.

وLRIS المستخدمة في نبات الأرابيدوبسيس والذرة يمكن استخدامها في مجموعة متنوعة من النباتات، على الرغم من الظروف المواتية في حاجة إلى أن يكون الأمثل. لتثبيت LRIS، خطوتين المتعاقبة مهمة يجب أن تتحقق: (1) حجب النقل أوكسين و(2) تراكم أوكسين للحث على جانبي بدء الجذر. ينبغي للنظام المتزايد تسمح لامتصاص فعال وموحد للمركبات وينبغي أن يسمح تطور جيد من الشتلات. نظم بديلة لوسط صلب (نبات الأرابيدوبسيس) وفات الورق (الذرة)، مثل الثقافة السائل، والزراعة المائية، أو aeroponics، يمكن أن تستخدم لأنواع أخرى. المرحلة الأولى في LRIS، أي حجب نقل أوكسين، لا يمكن أن يتحقق عن طريق إضافة المانع النقل أوكسين. على الرغم من NPA يؤدي إلى كتلة كفاءة الجانبي بدء الجذرية في نبات الأرابيدوبسيس والذرة، ومركبات بديلة مثل حامض 2،3،5-triiodobenzoic (طيبة) أو حامض chlorophenoxyisobutyric P- (PCIB) قد تعمل على نحو أفضل في الأنواع الأخرى. ويمكن أن يتم تحسين مماثلة للخطوة الثانية من LRIS، أي العلاج أوكسين. وأوكسين الاصطناعية يبدو NAA ليكون أكثر ملاءمة لLRIS. مقدمة أوكسين إندول-3-زبدي حامض (IBA) قد يكون بديل جيد لأنه أيضا يحث بقوة الجذور الجانبية ويحتوي على النشاط الحيوي العالي في محطات مختلفة 25، 26. ومن ناحية أخرى، فإن أوكسين الطبيعي الإندول-3-حمض الخل (IAA) هو أقل استقرارا وأكثر سهولة استقلاب 27، ترشيد تأثير أضعف على جمعة الجذراإلمنائية في مثل الذرة أو الأرز 25، 26. وأوكسين الاصطناعية حمض 2،4-ثنائي كلورو فينوكسياسيتين (2،4D) تتراكم بشكل كبير في خلايا محيط بالدائرة، جزئيا لأنه لم يتم تصديرها من الخلايا 28، إضعاف السليم بدء الجذر الوحشي وحمل اصطناعية هياكل تنصهر. كما غيرها من المركبات تتفاعل مع مسارات أوكسين، مثل naxillin 12، وقد ثبت للحث على جانبي بدء الجذرية في نبات الأرابيدوبسيس ويمكن اختبارها في الأنواع الأخرى.

في بعض الحالات، إنبات غير فعالة في وجود جيش الشعب الجديد ويمكن للمرء أن يختار لتنبت البذور لأول مرة في غياب NPA، لنقل في وقت لاحق الشتلات لنظام NPA التي تحتوي على. هذا يؤدي الى احتمال وجود خطر وجود المبكرة براعم الجذر الجانبية التي بدأت قبل الاستقراء الجذر الوحشي مع العلاج NAA، وبالتالي، فمن المهم فقط عينة منطقة الجذر الذي ممدود أثناء العلاج NPA. وعقب هذه الاستراتيجية العامة، شو واحديونيتبول تكون قادرة على تحسين وLRIS للعمليا أي (البذور) مصنع وعلى هذا النحو يكون لها نظام سهل لدراسة التنمية الجذرية الجانبية للمصنع من الفائدة. يمكن أن يحدث مزيد من توصيف توقيت بدء الجذر الوحشي عبر خطوط علامة، كما يتضح للنبات الأرابيدوبسيس. إذا كانت خطوط علامة من الصعب الحصول عليها، يمكن أن يتم دراسة النسيجية مفصلة، ​​ولكن هذا هو مضيعة للوقت وانقسامات الخلية الأولى لا يمكن التعرف عليه بسهولة. بدلا من ذلك، تحليل التعبير عن علامات انقسام الخلايا يمكن استخدامها للإشارة إلى توقيت انقسامات الخلية الأولى.

وLRIS يمكن أن تستخدم لأغراض مختلفة، مثل تحليل Transcriptome على 9-13 كما هو موضح لفترة وجيزة في النتائج، فضلا عن ملاحظات النسيجية على مستوى العيانية والمجهرية خلال الجانبي بدء الجذر 14. أنواع مختلفة من أخذ العينات، بدءا من الجهاز إلى نطاق خلية 29، قد تسمح للانهيار جوانب مختلفة من وقت لاحقآل بدء الجذر. بالإضافة إلى ذلك، LRIS يمكن استخدامها لرصد تأثير مركبات مختلفة على بدء الجذر الوحشي 12، 30. وأخيرا، باستخدام خطوط مراسل وLRIS يمكن أن تستخدم أيضا لتميز بسهولة التعبير الجيني و / أو توطين البروتين خلال الجانبية التنمية الجذرية.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب ليس لديهم ما يكشف.

Materials

Name Company Catalog Number Comments
ARABIDOPSIS LRIS
Seeds
Arabidopsis seeds Col-0 ecotype
Gas sterilization of seeds
micro-centrifuge tubes 1.5 ml SIGMA-ALDRICH 0030 125.215 Eppendorf microtubes 3810X, PCR clean
micro-centrifuge tubes 2 ml SIGMA-ALDRICH 0030 120.094 Eppendorf Safe-Lock microcentrifuge tubes
hydrochloric acid Merck KGaA 1,003,171,000 37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu
glass desiccator SIGMA-ALDRICH Pyrex
glass beaker
plastic micro-centrifuge tubes box or holder
Bleach sterilization of seeds
ethanol Chem-Lab nv CL00.0505.1000 Ethanol, abs. 100% a.r. dilute to 70%
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
Tween 20 SIGMA-ALDRICH P1379
sterile water
Growth medium
Murashige and Skoog salt mixture DUCHEFA Biochemie B.V. M0221-0050
myo-inositol SIGMA-ALDRICH I5125-100G
2-(N-morpholino)ethanesulfonic acid (MES) DUCHEFA Biochemie B.V. M1503.0100
sucrose VWR, Internation LLC 27483.294 D(+)-Sucrose Ph. Eur.
KOH Merck KGaA 1050211000 pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur
Plant Tissue Culture Agar LabM Limited MC029
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 10 µM (Arabidopsis)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 10 µM (Arabidopsis)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Making a mesh for transfer
nylon mesh Prosep byba Synthetic nylon mesh 20 µm
Sowing and seedling handling
square petri dish plates GOSSELIN BP124-05 12 x 12 cm
50 ml DURAN tubes SIGMA-ALDRICH CLS430304 Corning 50 ml centrifuge tubes
drigalski Carl Roth K732.1
pipette
cut pipette tips Daslab 162001X Universal 200, cut off 5 mm of tip before autoclaving
breathable tape  3M Deutschland GmbH cat. no. 1530-1
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
Growth conditions
growth room 21 °C, continuous light
Materials Company Catalog Comments
MAIZE LRIS
Seeds
Maize kernels B-73
Bleach sterilization of kernels
glass beaker
magnetic stirrer  Fiers nv/sa C267.1
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
sterile water
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 50 µM (maize primary root), 25 µM (maize adventitious root)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 50 µM (maize)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Sowing and seedling handling
paper hand towels Kimberly-Clark Professional* 6681 SCOTT Hand Towels - Roll / White; sheet size (24 x 46 cm)
seed germination paper Anchor Paper Company 10 X 15 38# seed germination paper
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
250 ml (centrifuge) tubes SCHOTT DURAN 2160136 approx. 5.6 cm diameter and 14.7 cm height 
700 ml tubes DURAN GROUP 213994609 cylinders, round foot tube, D 60  x 250
rack for maize tubes, home made
sterile water
Growth conditions
growth cabinet 27 °C, continuous light, 70% relative humidity

DOWNLOAD MATERIALS LIST

References

  1. Van Norman, J. M., Xuan, W., Beeckman, T., Benfey, P. N. To branch or not to branch: the role of pre-patterning in lateral root formation. Development. 140, 4301-4310 (2013).
  2. Dolan, L., et al. Cellular organisation of the Arabidopsis thaliana root. Development. 119, 71-84 (1993).
  3. Bell, J. K., McCully, M. E. A histological study of lateral root initiation and development in Zea mays. Protoplasma. 70, 179-205 (1970).
  4. Benkova, E., et al. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell. 115, 591-602 (2003).
  5. Beeckman, T., Burssens, S., Inzé, D. The peri-cell-cycle in Arabidopsis. J. Exp. Bot. 52, 403-411 (2001).
  6. Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inzé, D., Beeckman, T. Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell. 14, 2339-2351 (2002).
  7. Jansen, L., Parizot, B., Beeckman, T. Inducible system for lateral roots in Arabidopsis thaliana and maize. Methods Mol Biol. 959, 149-158 (2013).
  8. Casimiro, I., et al. Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell. 13, 843-852 (2001).
  9. Himanen, K., et al. Transcript profiling of early lateral root initiation. Proc. Natl. Acad. Sci. USA. 101, 5146-5151 (2004).
  10. De Smet, I., et al. Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root. Science. 322, 594-597 (2008).
  11. Vanneste, S., et al. Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana. Plant Cell. 17, 3035-3050 (2005).
  12. De Rybel, B., et al. A role for the root cap in root branching revealed by the non-auxin probe naxillin. Nat. Chem. Biol. 8, 798-805 (2012).
  13. Jansen, L., et al. Comparative transcriptomics as a tool for the identification of root branching genes in maize. Plant Biotechnol. J. 11, 1092-1102 (2013).
  14. Parizot, B., et al. Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation. Plant Physiol. 146, 140-148 (2008).
  15. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 15, 473-497 (1962).
  16. Bellini, C., Pacurar, D. I., Perrone, I. Adventitious roots and lateral roots: similarities and differences. Annu Rev Plant Biol. 65, 639-666 (2014).
  17. Grunewald, W., Parizot, B., Inzé, D., Gheysen, G., Beeckman, T. Developmental biology of roots: One common pathway for all angiosperms? Int. J. Plant Dev. Biol. 1, 212-225 (2007).
  18. Parizot, B., Beeckman, T. Genomics of root development. Root Genomics and Soil Interactions. Crespi, M. 3-28 (2012).
  19. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. Journal of visualized experiments : JoVE. (2010).
  20. Nakazono, M., Qiu, F., Borsuk, L. A., Schnable, P. S. Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize. Plant Cell. 15, 583-596 (2003).
  21. Ludwig, Y., Hochholdinger, F. Laser microdissection of plant cells. Methods Mol Biol. 1080, 249-258 (2014).
  22. Beeckman, T., Engler, G. An easy technique for the clearing of histochemically stained plant tissue. Plant Mol. Biol. Rep. 12, 37-42 (1994).
  23. Ditengou, F. A., et al. Mechanical induction of lateral root initiation in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA. 105, 18818-18823 (2008).
  24. Lucas, M., Godin, C., Jay-Allemand, C., Laplaze, L. Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation. J. Exp. Bot. 59, 55-66 (2008).
  25. Wang, S., Taketa, S., Ichii, M., Xu, L., Xia, K., Zhou, X. Lateral root formation in rice (Oryza Sativa. L.): differential effects of indole-3-acetic acid and indole-3-butyric acid. Plant Growth Regul. 41, 41-47 (2003).
  26. Martinez-de la Cruz, E., Garcia-Ramirez, E., Vazquez-Ramos, J. M., Reyes de la Cruz, H., Lopez-Bucio, J. Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings. J Plant Physiol. 176, 147-156 (2015).
  27. Beyer, E. M., Morgan, P. W. Effect of ethylene on uptake, distribution, and metabolism of indoleacetic acid-1-14C and -2-14C and naphthaleneacetic acid-1-14C. Plant Physiol. 46, 157-162 (1970).
  28. Delbarre, A., Muller, P., Imhoff, V., Guern, J. Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta. 198, 532-541 (1996).
  29. Bailey-Serres, J. Microgenomics: genome-scale, cell-specific monitoring of multiple gene regulation tiers. Annu Rev Plant Biol. 64, 293-325 (2013).
  30. Perez-Torres, C. A., et al. Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor. Plant Cell. 20, 3258-3272 (2008).
الجانبي جذر النظام محرض في<em&gt; نبات الأرابيدوبسيس</em&gt; والذرة
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).More

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter