Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Lateral Root Inducerbar System doi: 10.3791/53481 Published: January 14, 2016
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Roden er afgørende for planternes vækst, da det sikrer forankring og optagelse af vand og næringsstoffer fra jorden. Fordi udvidelse af et rodsystem hovedsageligt er afhængig af produktionen af ​​laterale rødder, har deres indvielse og dannelse blevet bredt undersøgt. Lateral rødder indledt i en specifik undergruppe af pericycle celler, kaldet grundlægger celler 1. I de fleste tokimbladede, såsom Arabidopsis thaliana, er disse celler placeret på protoxylem poler 2, mens der i enkimbladede planter, såsom majs, findes de ved Phloem poler 3. Stiftende celler er markeret med en øget auxin respons 4, efterfulgt af ekspression af specifikke gener cellecyklus (f.eks cyclin B1, 1 / CYCB1; 1), hvorefter de underkastes en første runde af asymmetriske anticlinal divisioner 5. Efter en række koordinerede anticlinal og periclinal divisioner, er en lateral rod primordium dannet, der vil til sidst fremstå som en etutonomous lateral rod. Placeringen og timingen af ​​lateral rod indvielse er dog ikke forudsigelig, da disse begivenheder er hverken rigelige eller synkroniseret. Dette vanskeliggør brugen af ​​molekylære metoder såsom transcriptomics at studere denne proces.

For at løse dette, har en lateral Root Inducerbar System (lris) er udviklet 6, 7. I dette system er frøplanter først behandles med N -1-naphthylphthalamic syre (NPA), som hæmmer auxin transport og akkumulering dermed blokere lateral rodinitiering 8. Ved efterfølgende at overføre sætteplante til medium, der indeholder det syntetiske auxin 1-naphthalen eddikesyre (NAA), hele pericycle laget reagerer på de forhøjede auxin niveauer derved massivt inducerende laterale root indlede celledelinger 6. Som sådan, dette system fører til hurtige, synkrone og omfattende laterale rødder indvielser, giver nem samling af rod prøver beriget til et bestemt tidspunkt i slutningen afral rodudvikling. Efterfølgende kan disse prøver anvendes til at bestemme genom-dækkende udtryk profiler under lateral roddannelse. Den lris har givet allerede betydelige viden om lateral rod initiering i Arabidopsis og majs 9-13, men det er nødvendigt at anvende dette system til andre plantearter bliver tydeligere, efterhånden som flere genomer er sekventeret og der er en stigende interesse for at overføre viden til økonomisk vigtige arter.

Her er de detaljerede protokoller fra Arabidopsis og majs LRISs givet. Dernæst et eksempel på brugen af ​​ordningen, ved at illustrere, hvordan transcriptomics data opnået fra majs lris kan bruges til at identificere funktionelle homologer, der har en bevaret funktion under lateral rodinitiering tværs af forskellige plantearter. Endelig retningslinjer optimere lris for foreslås andre plantearter.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Arabidopsis lris protokol

Bemærk! Teksten refererer til "små" eller "store" skala eksperimenter. Lille skala eksperimenter, såsom markering line analyse og histologisk farvning 6, 14, kræver kun nogle få prøver. Forsøg i stor skala, såsom kvantitativ realtids-PCR QRT-microarrays 9-11 eller RNA-sekventering kræver en større mængde af prøver. Som sådan, at et beløb på ~ 1000 kimplanter pr prøve blev anvendt af Vanneste et al. 11 udfører microarray eksperiment efter rod segment dissektion.

DAG 1

  1. Sterilisering af Arabidopsis Frø
    Bemærk: Vælg en af ​​følgende procedurer for frø sterilisering. Nogen af ​​dem er egnet til de næste trin i protokollen. Gas sterilisation (1.1.2) præsenterer to vigtigste fordele frem flydende sterilisering (1.1.1): det tager mindre tid, når du håndterer en stor følelsesløsis af frø, da ingen pipettering skal ske for de enkelte prøver; og de steriliserede frø kan opbevares i en længere periode. Men det kræver en ekssikkator og omhyggelig håndtering.
    1. Flydende sterilisation
      1. Hæld det ønskede antal frø i mikro-centrifugerør. Brug op til 20 mg (~ 800 frø) i en 1,5 ml rør eller 40 mg (~ 1600 frø) i en 2 ml mikrocentrifugerør.
      2. Tilsæt 1 ml 70% ethanol. Vend eller forsigtigt ryste i 2 min.
      3. Erstatte 70% ethanol med 1 ml sterilisering opløsningen i 15 minutter. (Forbered frisk sterilisation løsning: 3,85 ml natriumhypochlorit (NaOCI) lager (12%) (ADVARSEL: Brug stinkskab), 5 pi Tween 20, op til 10 ml med vand Vend rørene flere gange for at sikre, at alle frø kommer. i kontakt med opløsningen.
      4. I en laminar air flow skab, udskifte sterilisationsopløsning med 1 ml sterilt destilleret vand og skyl frøene 5 gange i 5 minutter ved gentagenly erstatte med 1 ml frisk sterilt destilleret vand.
    2. Gas Sterilisation
      1. Hæld det ønskede antal frø i en 2 ml mikro-centrifugerør. Brug enkelte rør, når du arbejder med flere uafhængige linjer, og arrangere dem åbnede i en plastik mikro-centrifugerør boks eller indehaveren. Hvis antallet af frø i ét rør overstiger 500 (12,5 mg), underinddele frøene i passende antal rør for at sikre en vellykket sterilisation. Sørg for, at hætter af tilstødende rør ikke dækker hinanden. Passer sammen låget af kassen på bunden, som det er nødvendigt at være i ekssikkator samt til sterilisering.
      2. Placer kassen i skålen af ​​en ekssikkator, sammen med et glas bægerglas (ADVARSEL: Brug stinkskab).
      3. Fyld bægeret med 100 ml 12% NaOCI (ADVARSEL: Brug stinkskab). Læg låg på ekssikkator, men lad en lille åbning, hvor bægeret er placeret.
      4. Tilsæt 3 ml 37% saltsyre (rygende) (CAUTION: Brug stinkskab) til bægerglasset gennem den lille blænde og hurtigt lukke ekssikkator. Opløsningen vil boble i nogen tid som følge af Cl 2 -gas formation. Forlade systemet lukket O / N (eller mindst 8 timer).
      5. Tag låget af ekssikkator. Tag kassen og dække det med låget for at undgå forurening under transport.
      6. Sæt kassen i en laminar air flow skab, fjernes låget, og lad frøene i ca. 1 time ved stuetemperatur for at tillade gas release.
        Bemærk: Frø kan sikkert opbevares tørt i lukkede mikro-centrifugerør i op til 2 uger ved 4 ° C.
  2. Lateral rodinduktion i Arabidopsis
    1. Lateral Root Hæmning (NPA Behandling)
      1. Forbered vækstmedium for in vitro vækst. Mediet indeholder halv styrke Murashige og Skoog saltblanding 15, 0,1 g / L myo-inositol, 10 g / l saccharose og bufres med 0,5g / L 2- (N-morpholino) ethansulfonsyre (MES).
      2. PH justeres til 5,7 med 1 M KOH. Tilsæt 8 g / l plantevæv agar og autoklaveres mediet i 20 minutter ved 121 ° C.
      3. Forbered en 25 mM stamopløsning af NPA i dimethylsulfoxid (DMSO) (ADVARSEL: Brug handsker). I en laminar air flow skab afkøl autoklaveret medium ned til ca. 65 ° C (som er den temperatur, ved hvilken flasken kan holdes i hånden), og der tilsættes 25 mM NPA stamopløsning til opnåelse af en slutkoncentration på 10 uM NPA.
      4. Homogeniseres ved tilsætning ved forsigtigt at ryste flasken i 10 sek. Hæld 50 ml medium per kvadrat petriskål (12 cm x 12 cm).
        Bemærk: I tilfælde af storstilet forsøg, anvende en nylon mesh (20 pm) for at sikre nem overførsel. Forbered en mesh (9 cm x 9 cm) til autoklavering (figur 1A). Når autoklaveret anvende masken til mediet vækst ved hjælp af sterile pincetter (figur 1B). Skub forsigtigt masken til vækstmediet ved hjælp af en sterilized drigalsky at sikre, at det er i god kontakt med vækstmedium (figur 1B) (ADVARSEL: Arbejde i sterile forhold).
      5. Så frøene på NPA-plader.
        Bemærk: I tilfælde er der planlagt en storstilet forsøg, so 2 tætte og godt afstemt rækker af 50 frø for at lette prøvetagning (se 1.2.2.3).
        1. I tilfælde af flydende sterilisering, så frøene på NPA-plader under anvendelse af en 200 pi pipette. Skær 3 - 4 mm fra enden af ​​pipettering tip i sterile betingelser (eller før sterilisering af spidserne) med henblik på at kunne pipetteres frøene. Pipet op og ned et par gange for at re-suspendere frøene, så pipetteres ca. 150 ul sterilt vand med 10 - 20 frø og vente til frø sediment i bunden af ​​spidsen. (ADVARSEL: Arbejde i sterile forhold)
          Bemærk: Når røre agar eller masken forsigtigt med spidsen, vil en dråbe vand med et frø frigøres fra det (figur 1C).
        2. <li> I tilfælde af gas sterilisering, så frøene ved hjælp autoklaveret toothpicks.Pinch tandstikker i agaren, før du tager frøene til at sikre en klæbrig overflade. Afhente frø én efter én ved hjælp af tandstikker og distribuere frøene på pladerne (figur 1D). Alternativt, tilsæt sterilt vand til frøene, og sår som beskrevet i 1.2.1.5.1 (ADVARSEL: Arbejde i sterile forhold).
      6. Forsegl pladerne med åndbar tape, og gemme dem pladerne ved 4 ° C i mørke i mindst 2 dage og højst en uge. Dette er nødvendigt for lagdeling og sikrer synkroniserede og mere effektiv spiring.
        Bemærk: Alternativt kan frø stratificeres før såning, nedsænket i destilleret vand i mikro-centrifugerør, som kræver mindre plads køleskab. I dette tilfælde opbevares rørene i mindst en uge ved 4 ° C, og flytte pladerne til kabinettet væksten umiddelbart efter såning (se 1.2.1.7).
        DAG 3 Flyt pladerne til kabinettet vækst (konstant lys (110 uE m -2 s -1), 21 ° C) i 5 dage (2 dage spiring og 3 dages vækst) i en næsten lodret position (80 til 90 °) at sikre rodvækst på, og ikke i mediet.
        DAG 8
    2. Lateral rodinduktion (NAA behandling)
      1. Forbered samme vækstmedium som beskrevet i 1.2.1.1 og 1.2.1.2. Forbered en 50 mM stamopløsning af NAA i DMSO (ADVARSEL: Brug handsker). Afkøl autoklaveret medium ned til 65 ° C og tilsæt NAA løsning til mediet til opnåelse af en slutkoncentration på 10 uM NAA (ADVARSEL: Arbejde i sterile betingelser).
        1. Homogeniseres ved tilsætning ved forsigtigt at ryste flasken i 10 sek. Hæld 50 ml medium per kvadrat petriskål (12 cm x 12 cm).
      2. Overfør frøplanter fra pladerne indeholdende vækstmedium suppleret med 10 pM NPA til dem supmenteret med 10 pM NAA.
        1. Hook armene på buede pincet under kimbladene af kimplanter og forsigtigt fjerne det fra pladen. Kun at overføre kimplanter som rødderne er vokset helt i berøring med mediet NPA-vækst og fortrinsvis nedad.
        2. Skim roden over NAA-holdige vækstmedium overflade over en lille afstand. Sørg for, at planternes rødder er i god kontakt med vækstmediet. Hvis det er nødvendigt, skal du trykke på roden forsigtigt for at vækstmediet overflade med pincet.
          Bemærk: I tilfælde af et storstilet forsøg, fjerne alle planter, der ikke er i kontakt med masken og overførsel ved at løfte masken ved de to øverste hjørner med en pincet. Sørg masken er i god kontakt med NAA-medium ved at skumme masken over agaroverfladen over en lille afstand (figur 1E).
      3. Forsegl nye plader med åndbar tape og placere dem i kabinettet vækst (conkontinuerlig lys (110 uE m -2 s -1), 21 ° C) i en lodret position for den ønskede efter induktion indtil prøveudtagning.
        Bemærk: I tilfælde af et storstilet forsøg, skal du bruge en skalpel til at skære roden segmenter på én gang direkte på nettet og prøve dem ved forsigtigt at skrabe overfladen af ​​masken.

2. lris Majs protokollen

  1. Lagdeling af majskerner
    1. Inkuber kernerne majs ved 4 ° C i mørke i mindst 1 uge.
      Bemærk: Denne protokol er blevet udviklet ved hjælp af B73 majs indavlede linje.
  2. Sterilisering af majskerner
    DAG 1
    Bemærk: Selvom majsfrøplanter ikke behøver at blive dyrket under sterile forhold, anbefales det at sterilisere kernerne majs og arbejde med sterilt materiale for at forhindre svampevækst i papirrullensystem.
    1. Sæt det nødvendige antal majskerner i en steriliseret glasbæger.
    2. Tilsættes 100 ml sterilisering opløsning (6% NaOCl i vand) (ADVARSEL: Brug stinkskab).
    3. Tilføj en magnetisk omrører og placer bægeret på en magnetisk omrører ved lav omrøringshastighed (ca. 250 rpm) ved stuetemperatur i 5 minutter.
    4. Skyl fem gange i 5 minutter ved at erstatte opløsningen med 100 ml frisk sterilt vand.
  3. Såning majskerner
    1. Sæt på handsker for at reducere risikoen for forurening, og tage en rulle papir håndklæder.
    2. Riv to strækninger af håndklæde papir med en samlet længde på to ark (ca. 92 cm x 24 cm), og læg dem oven på hinanden på en ren overflade (figur 2A).
    3. Fold arkene fordobles over længden (ca. 92 cm x 12 cm) (figur 2A).
    4. Brug en pincet til at distribuere 10 kerner på ca. 2 cm fra toppen i løbet af than hele længden af papiret, samtidig med at et mellemrum på 8 cm mellem hver kerne og 8 cm fri i begge ender (figur 2B). Sørg for, at kimroden af kernen vender nedad og ind mod papiret (figur 2B).
    5. Rulle forsigtigt papiret over længden, og samtidig holde frøene på plads (Figur 2B). For at lette rulning, det er valgfrit først sprøjte papiret med sterilt vand.
    6. Læg papirruller i steriliserede glasrør på ca. 6 cm i diameter og 14 cm højde (f.eks 250 ml centrifugeglas) og placere dem i et rack (figur 2C).
  4. Lateral Root Induktion i Majs
    1. Forbered en 50 mM NPA stamopløsning (opløst i DMSO) (ADVARSEL: Brug handsker).
    2. For hvert rør, lave en 50 uM NPA ved tilsætning 125 pi fra 50 mM NPA stamopløsning til 125 ml sterilt vand i en steriliseret glasbæger.
    3. Bland godt ogHæld 125 ml af 50 pM NPA opløsning over papirrullen i røret. Papirrullen vil absorbere opløsningen og bliver gennemblødt.
      Bemærk: Når du bruger papirruller og rør med andre dimensioner, justere lydstyrken i overensstemmelse hermed. Væsken skal nå halvvejs røret for at sikre tilstrækkelig optagelse.
    4. Placer papirrullen systemet i et skab i tre dage (27 ° C, konstant lys, 70% relativ fugtighed) vækst. Sørg for, at papirruller forbliver gennemblødt ved at tilføje ekstra 50 pM NPA løsning, da løsningen fordamper over tid (figur 2D).
      DAG 4
    5. Forbered en 50 mM NAA stamopløsning (opløst i DMSO) (ADVARSEL: Brug handsker).
    6. For hvert rør fremstilles en 50 uM NAA ved tilsætning 125 pi fra 50 mM NAA lager til 125 ml sterilt vand i en steriliseret glasbæger.
    7. Forsigtigt klemme ud det meste af den resterende NPA løsningen fra papirruller og placerm i sterilt vand i 5 minutter for at vaske det ud (ADVARSEL: Brug handsker). Forsigtigt klemme ud det meste af vandet fra papirruller. Gentag dette vaskningstrin tre gange.
    8. Bland godt og hæld 50 uM NAA opløsning over rullerne papir i rørene. Sørg for, at de er fuldstændig gennemblødt.
    9. Placer papirrullen systemet i kabinettet vækst (27 ° C, konstant lys, 70% relativ fugtighed) i den ønskede tid efter induktion.
  5. Lateral Root Induktion i Utilsigtet Crown rødder Majs
    Bemærk: Den lris som beskrevet ovenfor inducerer laterale rødder i den primære rod. Men i majs og andre enkimbladede, den primære rod og de embryonale skelsættende rødder, sammen med deres laterale rødder, er hovedsagelig vigtigt under sætteplante udvikling. På et senere tidspunkt i plantevækst opstår, post-embryonale birødder på stænglen og også udvikle laterale rødder til at danne et nyt rodnet 16. Den lris kan også være brugd at fremkalde laterale rødder på disse post-embryonale utilsigtede krone rødder ved at følge nogle mindre justeringer af lris på embryonale primære rod.
    1. For at gøre papirruller, oprette en sandwich af papirer med henholdsvis to lag håndklæde papir på ydersiden, og to lag af spiring papir inden. Placer steriliserede kerner (se trin 2.1 og 2.2) i mellem de to ark spiring papir. Spiring papir, sammenlignet med håndklæde papir, vil være mindre tilbøjelige til at blive gennemtrængt af rodhår og laterale rødder, hvilket vil gøre åbningen af ​​papiret ruller lettere senere. På den anden side vil de to eksterne lag af håndklæde papir lette absorption af væsken.
    2. Sæt ruller i 700 ml glasrør og hæld sterilt vand uden NPA over dem. Sørg for, at de er fuldstændig gennemblødt.
    3. Spire de steriliserede kerner i kabinettet vækst (se trin 2.4.9).
    4. Grow de planter indtil de utilsigtede krone rødderbegynde at dukke op (6 dage for B73). Sørg for papirruller holdes våd hele tiden ved at tilføje sterilt vand, når det er nødvendigt.
    5. Overføres til en 25 uM NPA løsning til 4 dage (se trin 2.4.1 til 2.4.4), efterfulgt af en lignende induktion af lateral rodinitiering ved at erstatte NPA opløsning med en 50 uM NAA opløsning efter et vasketrin (se trin 2.4 0,5 til 2.4.9).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Anvendelse af lris at udføre Komparative Transcriptomics af den laterale Root Initiation Process

En anvendelse af lris er sammenligningen og korrelation af genekspressionsprofiler under lateral roddannelse i forskellige arter. Sammenlignende transcriptomics nærmer skabe mulighed for at lokalisere ortologe gener involveret i den laterale rodudvikling processen på forskellige arter. Lateral rodinitiering, som består af dannelse af et nyt organ fra en delmængde af celler indeholdt i en allerede roddannet akse, er hovedmekanismen deles af dækfrøede at styre deres rodarkitektur. Det er derfor meget sandsynligt, at det har udviklet sig fra de eksisterende veje er til stede i en fælles forfader og var bevaret i hele evolutionen. Faktisk har fælles potentielle regulatorer af lateral rod initiering blevet fundet i forskellige arter <sup> 17, 18.

Sampling Materiale bruge lris i Arabidopsis og majs, og Transkriptomet Analysis

Den lris er etableret i to forskellige arter:. Arabidopsis og majs 10, 13 I begge arter blev det besluttet at prøve planterne lige før NAA behandling, og kort efter induktion, ved starten af, eller under auxin respons, som samt ved begyndelsen af ​​eller i de første divisioner i pericycle. Endvidere fluorescensaktiveret cellesortering 19 (FACS) blev anvendt i Arabidopsis eller Laser Capture Mikroskopi 20, 21 (LCM) i majs at selektere for pericycle celler. I Arabidopsis blev tidspunkter af 2 og 6 timer efter induktion valgt baseret på den transkriptionelle karakterisering af pDR5 :: GUS auxin respons og pCYCB1; 1 :: GUS cellecyklus markeringslinierne 9 (figur 3). I majs, tidspunkterne 2, 3 og 4 timer efter induktion, blev udvalgt efter mikroskopisk karakterisering af celledeling aktivitet og analyse af flere cellecyklus markørgener ekspression under anvendelse af kvantitativ realtids-revers transkription polymerasekædereaktion (QRT-PCR) 13 . RNA blev ekstraheret fra de isolerede celler og hybridiseret på microarray platforme som tidligere beskrevet 10, 13.

At finde den Ortolog af Arabidopsis CYCB1, 1 (AtCYCB1; 1) i Majs

I Arabidopsis, markør linje pCYCB1; 1 :: GUS har været meget anvendt til at spore de første afdelinger af pericycle under lateral rod indvielse. En sådan markering vil være megetnyttige i majs. Adskillige homologer af AtCYCB1, 1 blev fundet i majs (www.maizesequence.org, alle peptider, BLASTP, standardindstillinger). Seks af dem var til stede på microarray udføres efter lris i majs og viste signifikant berigelse. Den bedste BLAST hit, GRMZM2G310115, udviste meget høje transkriptionsniveauer efter lris, svarende til hvad der blev observeret i Arabidopsis for AtCYCB1; 1 (figur 4).

Anvendelse af lris skal tjekkes Individuel genekspression

At validere GRMZM2G310115 som en god kandidat ortolog af AtCYCB1, 1 i majs lateral rod indvielse, en real-time QRT-PCR på prøver udtaget på forskellige tidspunkter blev udført i løbet af en lris 13. Planter blev behandlet som beskrevet i den ovennævnte protokol og høstet på forskellige tidspunkter: før NAA behandling (NPA), og efter 2, 3 og 4 timer i NAA behandling. Desuden blev materiale planter dyrket kun i vand, høstede at sammenligne genekspression mellem lris og neutrale forhold. Umiddelbart efter høst, root segmenter svarende til et område på mellem 5 mm og 15 mm over rodenden blev dissekeret under kikkerten. Med en pincet, blev cortex adskilt fra stele (som indeholder pericycle), og RNA blev ekstraheret fra begge væv. Dette sidste trin blev udført i stedet for LCM, fordi det er meget hurtigere og billigere for validering. Ved hjælp af følgende respektive frem og tilbage QRT-PCR-primere, AGCAGGACGCAGTTGGAGAG og GAGCCGAGAGCACAGAAGAAAG blev GRMZM2G310115 valideret til at være opreguleret på lris, og for at være specifik for stele væv (Figur 5). Derudover dette forsøg viser, at uden synkron induktion, de diskrete begivenheder lateral rodinitiering sker i en rod vokser i vand, ikke kan opfanges, og illustrerer behovet for lris at afsløre differentiel genekspression i forbindelse med processen med lateral rodinitiering.

Figur 1
Figur 1. Lateral Root Inducerbar System for Arabidopsis (A) Forberedelse af nylonnet (20 um):. Skære nylonnet (9 cm 9 cm), pak den ind i alufolie og læg det i et glas bæger til autoklavering. (B) Påfør nylonnet på en NPA-holdige plade (10 uM) med en pincet. Så brug en steril Drigalski for at fjerne luftbobler. (C) udsæd frø på nylonnet ved hjælp af en pipette. (D) sår frø på nylon mesh bruge en tandstik. (E) Overfør nylonnet til en NAA-holdige plade (10 uM) med en pincet.81 / 53481fig1large.jpg "target =" _ blank "> Klik her for at se en større version af dette tal.

Figur 2
Figur 2. Lateral Root Inducerbar System for majs.   (A) Forberedelse af papirruller: place to lag papir (92 cm x 24 cm, længde på to ark) oven på hinanden og fold dem fordobles over længden (92 cm x 12 cm). (B) Sæt 10 steriliserede majskerner med kimroden nedad på papiret på 2 cm fra toppen med en indbyrdes afstand på 8 cm. Så rulle op papiret samtidig holde kernerne majs på plads. (C) Placér ruller papir i rør (f.eks 250 ml centrifugeglas) og læg dem i et rack. (D) Dyrk de majs kimplanter i tre dage i en 50 pM NPA opløsning (ved 27 ° C, konstant lys, relativ Humidity 70%). (E) Venstre: sætteplante lige før overførsel til NAA; I midten: mikrotomknive tværgående sektioner lige før overførsel til NAA og 2 dage efter overførsel til NAA; Til højre:. Sætteplante med synlige opstået laterale rødder 5 dage efter overførsel til NAA Klik her for at se en større version af dette tal.

Figur 3
Figur 3. Lateral Root Indvielse stimuleres Ved Langvarig NAA behandling. (AF) Tidsforløb viser auxin respons under en NAA behandling ved hjælp af pDR5 :: GUS markør linje. Den auxin respons, som er en af ​​de første begivenheder udløser lateral rodinitiering, starter 2 timer efter starten af ​​NAA behandling. I det øverste panel, er et overblik over hele sætteplante givet; det nederste panel viserer den auxin respons i roden spids. (GM) Tidsforløb for en NAA behandling ved hjælp af pCYCB1; 1 :: GUS markør linje. GUS signal repræsenterer ekspressionen af CYCB1, 1-genet, hvilket viser, at de første celledelinger fører til lateral roddannelse starte 6 timer efter starten af NAA behandling. I det øverste panel, er et overblik over hele sætteplante givet; det nederste panel viser CYCB1;. 1-ekspression i roden spids (GUS farvning ifølge Beeckman og Engler, 1994 22) Klik her for at se en større version af dette tal.

Figur 4
Figur 4. Expression Profil af CYCB1 gener i Arabidopsis og majs i lris.   (A) Microarray udtrykket værdier AtCYCB1; 1 under lris som beskrevet af De Smet et al. 2008 10 (B) Microarray udtrykket værdier af potentielle orthologer af AtCYCB1; 1 under lris som beskrevet af Jansen et al. 2013 13 BLASTP score er det opnåede, når sprængning protein sekvens af AtCYCB1 score, 1 på majs genom. Fejlsøjler udtrykker standardafvigelse og ** står for en p-værdi ≤0.01. Klik her for at se en større version af dette tal.

Figur 5
Figur 5. Angivelse af GRMZM2G310115 i Stele og Cortex af majs Roots løbet lris. Ekspressionen af <em> GRMZM2G310115 under lris i majs blev evalueret ved kvantitativ realtids-QRT-PCR på dissekerede Stele og cortex prøver. En supplerende prøveudtagning blev udført på planter dyrket på vand. Værdier blev normaliseret til ekspression i stele i vand. Fejlsøjler udtrykker standardafvigelse og ** står for en p-værdi ≤0.01 (primere og referencematerialer gener ifølge Jansen et al. 2013 13). Klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I Arabidopsis lris protokollen, er det vigtigt kun at overføre de planter, der er vokset helt i kontakt med NPA-holdige vækstmedium. Dette sikrer, at lateral rodinitiering blokeres over hele root længde. For at undgå sårdannelse småplanterne under overførslen, kan armene på de buede pincet være tilsluttet under kimbladene af kimplanter. Ved overførsel, sørg for, at sætteplante rødder er i tilstrækkelig kontakt med NAA-holdige agar medium. Dette kan opnås ved at skumme roden over agar overflade over en lille afstand. Dette vil sikre en effektiv synkroniseret induktion af den laterale rodinitiering over den samlede root længde. Rødderne kan dyrkes udsat for lys uden negativ indflydelse på deres vækst og lateral rodinduktion.

I majs lris protokollen, er det vigtigt, at kimroden af ​​kernen vender nedad og mod papiret for at sikre roden vil vokse downwards og tillægger papiret på den rigtige side 16. Efter tre dage med NPA behandling, bør de planter er opstået fra kernen med en lille skyde, en primær rod og skelsættende rødder 16. Det primære rod skal være ca 2 cm lange før du fortsætter til induktion af lateral rod indvielse. Denne protokol er blevet udviklet ved hjælp af B73 majs indavlet linje, men i tilfælde af en majslinje med en anden vækstrate, justere inkubationstiden i overensstemmelse hermed. Sørg for, at papirruller forbliver gennemblødt ved at tilføje regelmæssigt 50 pM NPA løsning, når væsken fordamper over tid, ellers NPA behandling kunne være ineffektiv og uønsket tidlig lateral rodudvikling kunne forekomme. Selve systemet forhindrer fremstilling af rødderne til lyset, men lyset er ikke et stort problem og påvirker ikke rodvækst og lateral rod induktion.

Alternative måder til kontrolleret induktion af laterale rødder er anvendelsen af ​​mechanical bøjning 23 eller gravistimulation 24. Den største fordel ved disse systemer er, at de har en mere "naturlig" induktion sammenlignet med hormonbehandlinger i lris, men ulempen er, at de er begrænset i mængden af ​​materiale, der kan høstes på et givet tidspunkt, fordi de kun udbytte en lateral rod indvielse begivenhed i svinget pr sætteplante forhold til en fuld induktion af pericycle i lris.

Den lris anvendes i Arabidopsis og majs kan anvendes i en række planter, selvom gunstige betingelser skal optimeres. For at installere en lris, har to vigtige hinanden følgende trin, der skal nås: (1) blokering af auxin transport og (2) ophobning af auxin at fremkalde lateral rod indvielse. Den voksende Systemet skal give mulighed for en effektiv og ensartet optagelse af forbindelserne, og skulle muliggøre god udvikling af de planter. Alternative systemer til fast medium (Arabidopsis) og papirruller (majs), såsom flydende kultur, hydroponics eller aeroponics, kan anvendes til andre arter. Det første trin i lris, dvs. blokering af auxin transport, kan opnås ved tilsætning af en auxin transport inhibitor. Selvom NPA fører til en effektiv blok af lateral rod initiering i Arabidopsis og majs, alternative forbindelser såsom 2,3,5-triiodbenzoesyre (TIBA) eller p-chlorophenoxyisobutyric syre (PCIB) kunne fungere bedre i andre arter. En lignende optimering kan gøres for det andet trin i lris, dvs auxin behandling. Det syntetiske auxin NAA synes at være den mest egnede til en lris. Den auxin precursor indol-3-smørsyre (IBA) kan være et godt alternativ, som det også kraftigt inducerer laterale rødder og har en høj bioaktivitet i forskellige planter 25, 26. På den anden side, den naturlige auxin indol-3-eddikesyre (IAA) er mindre stabil og lettere metaboliseres 27, rationalisering sin svagere effekt på rod develling i for eksempel majs eller ris 25, 26. Den syntetiske auxin 2,4-D (2,4d) akkumuleres højt i pericycle celler, delvist fordi det ikke eksporteres fra cellerne 28, forringe ordentlig lateral rod initiering og fremkalde kunstig kondenserede strukturer. Også andre forbindelser, der interagerer med auxin veje, såsom naxillin 12, er blevet vist at inducere lateral rodinitiering i Arabidopsis og kan testes i andre arter.

I nogle tilfælde spiring er ineffektiv i nærværelse af NPA og man kan vælge først at spire frøene i fravær af NPA, for efterfølgende at overføre kimplanter til NPA-holdige system. Dette inducerer en mulig risiko for at få tidlige laterale rod primordier indledt før lateral rod induktion med NAA behandling og dermed er det vigtigt kun at prøve området af roden, der aflange under NPA-behandling. Efter denne generelle strategi, en shoULD kunne optimere en lris for praktisk talt alle (frø) anlæg, og som sådan har en nem system til at studere lateral rodudvikling for anlægget af interesse. Yderligere karakterisering af timingen af den laterale rodinitiering kan ske via markeringslinierne, som eksemplificeret for Arabidopsis. Hvis markør linjer er vanskeligt at opnå, kunne en detaljeret histologisk undersøgelse skal gøres, men det er tidskrævende, og de første celledelinger ikke er let genkendelige. Alternativt kan anvendes ekspressionsanalyse af celledeling markører for at angive tidspunktet for den første celledelinger.

Den lris kan bruges til forskellige formål, såsom transkriptom analyse 9-13 som kort beskrevet i resultaterne, samt histologiske observationer på makroskopiske og mikroskopiske niveau under lateral rodinitiering 14. Forskellige typer af prøvetagning, der spænder fra orgel til celle skala 29, kunne gøre det muligt optrævling forskellige aspekter af senereal rod indvielse. Desuden kan lris anvendes til at overvåge virkningen af forskellige forbindelser på den laterale rodinitiering 12, 30. Endelig ved hjælp reporter linjer, en lris kan også anvendes til let at karakterisere genekspression og / eller protein lokalisering under lateral rodudvikling.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Materials

Name Company Catalog Number Comments
ARABIDOPSIS LRIS
Seeds
Arabidopsis seeds Col-0 ecotype
Gas sterilization of seeds
micro-centrifuge tubes 1.5 ml SIGMA-ALDRICH 0030 125.215 Eppendorf microtubes 3810X, PCR clean
micro-centrifuge tubes 2 ml SIGMA-ALDRICH 0030 120.094 Eppendorf Safe-Lock microcentrifuge tubes
hydrochloric acid Merck KGaA 1,003,171,000 37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu
glass desiccator SIGMA-ALDRICH Pyrex
glass beaker
plastic micro-centrifuge tubes box or holder
Bleach sterilization of seeds
ethanol Chem-Lab nv CL00.0505.1000 Ethanol, abs. 100% a.r. dilute to 70%
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
Tween 20 SIGMA-ALDRICH P1379
sterile water
Growth medium
Murashige and Skoog salt mixture DUCHEFA Biochemie B.V. M0221-0050
myo-inositol SIGMA-ALDRICH I5125-100G
2-(N-morpholino)ethanesulfonic acid (MES) DUCHEFA Biochemie B.V. M1503.0100
sucrose VWR, Internation LLC 27483.294 D(+)-Sucrose Ph. Eur.
KOH Merck KGaA 1050211000 pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur
Plant Tissue Culture Agar LabM Limited MC029
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 10 µM (Arabidopsis)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 10 µM (Arabidopsis)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Making a mesh for transfer
nylon mesh Prosep byba Synthetic nylon mesh 20 µm
Sowing and seedling handling
square petri dish plates GOSSELIN BP124-05 12 x 12 cm
50 ml DURAN tubes SIGMA-ALDRICH CLS430304 Corning 50 ml centrifuge tubes
drigalski Carl Roth K732.1
pipette
cut pipette tips Daslab 162001X Universal 200, cut off 5 mm of tip before autoclaving
breathable tape  3M Deutschland GmbH cat. no. 1530-1
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
Growth conditions
growth room 21 °C, continuous light
Materials Company Catalog Comments
MAIZE LRIS
Seeds
Maize kernels B-73
Bleach sterilization of kernels
glass beaker
magnetic stirrer  Fiers nv/sa C267.1
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
sterile water
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 50 µM (maize primary root), 25 µM (maize adventitious root)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 50 µM (maize)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Sowing and seedling handling
paper hand towels Kimberly-Clark Professional* 6681 SCOTT Hand Towels - Roll / White; sheet size (24 x 46 cm)
seed germination paper Anchor Paper Company 10 X 15 38# seed germination paper
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
250 ml (centrifuge) tubes SCHOTT DURAN 2160136 approx. 5.6 cm diameter and 14.7 cm height 
700 ml tubes DURAN GROUP 213994609 cylinders, round foot tube, D 60  x 250
rack for maize tubes, home made
sterile water
Growth conditions
growth cabinet 27 °C, continuous light, 70% relative humidity

DOWNLOAD MATERIALS LIST

References

  1. Van Norman, J. M., Xuan, W., Beeckman, T., Benfey, P. N. To branch or not to branch: the role of pre-patterning in lateral root formation. Development. 140, 4301-4310 (2013).
  2. Dolan, L., et al. Cellular organisation of the Arabidopsis thaliana root. Development. 119, 71-84 (1993).
  3. Bell, J. K., McCully, M. E. A histological study of lateral root initiation and development in Zea mays. Protoplasma. 70, 179-205 (1970).
  4. Benkova, E., et al. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell. 115, 591-602 (2003).
  5. Beeckman, T., Burssens, S., Inzé, D. The peri-cell-cycle in Arabidopsis. J. Exp. Bot. 52, 403-411 (2001).
  6. Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inzé, D., Beeckman, T. Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell. 14, 2339-2351 (2002).
  7. Jansen, L., Parizot, B., Beeckman, T. Inducible system for lateral roots in Arabidopsis thaliana and maize. Methods Mol Biol. 959, 149-158 (2013).
  8. Casimiro, I., et al. Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell. 13, 843-852 (2001).
  9. Himanen, K., et al. Transcript profiling of early lateral root initiation. Proc. Natl. Acad. Sci. USA. 101, 5146-5151 (2004).
  10. De Smet, I., et al. Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root. Science. 322, 594-597 (2008).
  11. Vanneste, S., et al. Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana. Plant Cell. 17, 3035-3050 (2005).
  12. De Rybel, B., et al. A role for the root cap in root branching revealed by the non-auxin probe naxillin. Nat. Chem. Biol. 8, 798-805 (2012).
  13. Jansen, L., et al. Comparative transcriptomics as a tool for the identification of root branching genes in maize. Plant Biotechnol. J. 11, 1092-1102 (2013).
  14. Parizot, B., et al. Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation. Plant Physiol. 146, 140-148 (2008).
  15. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 15, 473-497 (1962).
  16. Bellini, C., Pacurar, D. I., Perrone, I. Adventitious roots and lateral roots: similarities and differences. Annu Rev Plant Biol. 65, 639-666 (2014).
  17. Grunewald, W., Parizot, B., Inzé, D., Gheysen, G., Beeckman, T. Developmental biology of roots: One common pathway for all angiosperms? Int. J. Plant Dev. Biol. 1, 212-225 (2007).
  18. Parizot, B., Beeckman, T. Genomics of root development. Root Genomics and Soil Interactions. Crespi, M. 3-28 (2012).
  19. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. Journal of visualized experiments : JoVE. (2010).
  20. Nakazono, M., Qiu, F., Borsuk, L. A., Schnable, P. S. Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize. Plant Cell. 15, 583-596 (2003).
  21. Ludwig, Y., Hochholdinger, F. Laser microdissection of plant cells. Methods Mol Biol. 1080, 249-258 (2014).
  22. Beeckman, T., Engler, G. An easy technique for the clearing of histochemically stained plant tissue. Plant Mol. Biol. Rep. 12, 37-42 (1994).
  23. Ditengou, F. A., et al. Mechanical induction of lateral root initiation in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA. 105, 18818-18823 (2008).
  24. Lucas, M., Godin, C., Jay-Allemand, C., Laplaze, L. Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation. J. Exp. Bot. 59, 55-66 (2008).
  25. Wang, S., Taketa, S., Ichii, M., Xu, L., Xia, K., Zhou, X. Lateral root formation in rice (Oryza Sativa. L.): differential effects of indole-3-acetic acid and indole-3-butyric acid. Plant Growth Regul. 41, 41-47 (2003).
  26. Martinez-de la Cruz, E., Garcia-Ramirez, E., Vazquez-Ramos, J. M., Reyes de la Cruz, H., Lopez-Bucio, J. Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings. J Plant Physiol. 176, 147-156 (2015).
  27. Beyer, E. M., Morgan, P. W. Effect of ethylene on uptake, distribution, and metabolism of indoleacetic acid-1-14C and -2-14C and naphthaleneacetic acid-1-14C. Plant Physiol. 46, 157-162 (1970).
  28. Delbarre, A., Muller, P., Imhoff, V., Guern, J. Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta. 198, 532-541 (1996).
  29. Bailey-Serres, J. Microgenomics: genome-scale, cell-specific monitoring of multiple gene regulation tiers. Annu Rev Plant Biol. 64, 293-325 (2013).
  30. Perez-Torres, C. A., et al. Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor. Plant Cell. 20, 3258-3272 (2008).
Lateral Root Inducerbar System<em&gt; Arabidopsis</em&gt; Og Majs
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).More

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter