Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Lateral système inductible Racine dans doi: 10.3791/53481 Published: January 14, 2016
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Le système racinaire est crucial pour la croissance des plantes, car il assure l'ancrage et l'absorption de l'eau et les nutriments du sol. Étant donné que l'expansion d'un système racinaire repose principalement sur la production de racines latérales, leur initiation et de la formation ont été largement étudiées. Les racines latérales sont lancés dans un sous-ensemble spécifique de cellules péricycle, appelées cellules fondateurs 1. Dans la plupart des dicotylédones, telles que Arabidopsis thaliana, ces cellules se trouvent au niveau des pôles de protoxylème 2, alors que dans les monocotylédones telles que le maïs, ils se trouvent au niveau des pôles du phloème 3. Fondateur de cellules sont marquées par une réponse de l'auxine augmenté de 4, suivie par l'expression de gènes du cycle cellulaire spécifiques (par exemple, la cycline B1; 1 / CYCB1; 1), après quoi ils subissent une première série de divisions anticlinales asymétriques 5. Après une série de divisions anticlinales et périclines coordonnés, une ébauche de racine latérale est formée qui a finalement émergera comme unracine latérale utonomous. Le lieu et le moment de l'initiation des racines latérales ne sont cependant pas prévisible, depuis ces événements ne sont ni abondante ni synchronisées. Cela empêche l'utilisation d'approches moléculaires tels que la transcriptomique pour étudier ce processus.

Pour y remédier, un système latéral inductible Root (SCIF) a été développé 6, 7. Dans ce système, les semis sont d'abord traités avec N -1-naphthylphthalamique (NPA), qui inhibe le transport de l'auxine et l'accumulation par conséquent, bloquer latéral initiation des racines 8. En transférant ensuite le plant de milieu contenant de l'acide acétique 1-naphtalène auxine synthétique (NAA), la couche de péricycle entier répond à des niveaux élevés d'auxine ainsi massivement profondes ouverture divisions cellulaires latérales inducteurs 6. En tant que tel, ce système conduit à rapides, synchrones et de vastes racines latérales initiations, permettant la collecte facile des échantillons de racines enrichis pour une étape spécifique de la finle développement des racines RAL. Par la suite, ces échantillons peuvent être utilisés pour déterminer les profils d'expression du génome entier au cours de la formation de racines latérales. Le SCIF a donné des connaissances déjà important au sujet latérale initiation des racines chez Arabidopsis et le maïs 9-13, mais la nécessité d'appliquer ce système à d'autres espèces de plantes devient plus apparente que plusieurs génomes sont séquencés et il ya un intérêt croissant pour transférer les connaissances aux économique importante espèce.

Ici, les protocoles détaillés de l'Arabidopsis et du maïs LRISs sont donnés. Ensuite, un exemple de l'utilisation du système est prévu, en illustrant la façon dont les données acquises à partir de la transcriptomique LRIS de maïs peuvent être utilisées pour identifier des homologues fonctionnels qui ont une fonction conservée lors de l'initiation de racine latérale dans différentes espèces végétales. Enfin, les lignes directrices pour optimiser la SCIF pour d'autres espèces de plantes sont proposées.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Arabidopsis Protocole SCIF

Note: Le texte se réfère à "petits" ou "grands" expériences à grande échelle. Expériences à petite échelle, telles que l'analyse de la ligne de marqueur et coloration histologique 6, 14, ne nécessitent que quelques échantillons. Expériences à grande échelle, tels que quantitative en temps réel qRT-PCR, micro-arrays 9-11 ou séquençage de l'ARN, exigent une plus grande quantité d'échantillons. En tant que tel, un montant de ~ 1000 plants par échantillon a été utilisé par 11 Vanneste et al. Pour effectuer expérience de puces à ADN après segment de racine dissection.

JOUR 1

  1. Stérilisation des graines d'Arabidopsis
    Remarque: Sélectionnez l'une des procédures suivantes pour la stérilisation des semences. Chacun d'entre eux est adapté pour les prochaines étapes du protocole. La stérilisation de gaz (1.1.2) présente deux principaux avantages sur la stérilisation de liquide (1.1.1): il prend moins de temps lors de la manipulation d'un grand engourdieer de graines, car aucune pipetage doit se produire pour les échantillons individuels; et les graines stérilisées peuvent être stockées pendant une période plus longue. Cependant, elle nécessite un dessiccateur et une manutention prudente.
    1. Liquide de stérilisation
      1. Verser le nombre souhaité de graines dans des tubes de micro-centrifugation. Utilisez jusqu'à 20 mg (~ 800 graines) dans un tube de 1,5 ml ou de 40 mg (~ 1600 graines) dans 2 ml d'un des tubes de micro-centrifugation.
      2. Ajouter 1 ml d'éthanol à 70%. Inversez ou secouer doucement pendant 2 min.
      3. Remplacer l'éthanol avec 1 ml de solution de stérilisation de 70% pendant 15 min. (Préparer la solution de stérilisation frais: 3,85 ml d'hypochlorite de sodium (NaOCl) stock (12%) (ATTENTION: L'utilisation hotte), 5 pi de Tween 20, jusqu'à 10 ml avec de l'eau inverser les tubes à plusieurs reprises pour faire en sorte que toutes les graines viennent. en contact avec la solution.
      4. Dans une hotte à flux d'air laminaire, remplacer la solution de stérilisation avec 1 ml d'eau distillée stérile et rincer les graines 5 fois pendant 5 min répété parLy remplaçant avec 1 ml d'eau fraîche distillée stérile.
    2. Stérilisation de gaz
      1. Verser le nombre souhaité de graines dans un tube de micro-centrifugeuse de 2 ml. Utilisez des tubes individuels lorsque vous travaillez avec plusieurs lignes indépendantes, et les disposer ouverts dans une boîte ou un support de micro-tubes à centrifuger en plastique. Si le nombre de graines dans un tube est supérieure à 500 (12,5 mg), de subdiviser les graines dans le nombre approprié de tubes pour assurer la stérilisation réussie. Assurez-vous que les bouchons des tubes voisins ne couvrent pas l'autre. Assembler le couvercle de la boîte sur le fond, car il a besoin d'être dans le dessiccateur ainsi pour la stérilisation.
      2. Placez la boîte dans le bol d'un dessiccateur, avec un gobelet de verre (ATTENTION: L'utilisation hotte).
      3. Remplir le bécher avec 100 ml de 12% NaOCl (ATTENTION: L'utilisation capot fumées). Mettez le couvercle sur le dessiccateur, mais laisser une petite ouverture où le bécher est placé.
      4. Ajouter 3 ml d'acide chlorhydrique à 37% (fumant) (CAUTION: utilisation hotte) dans le bécher à travers la petite ouverture et fermer rapidement le dessiccateur. La volonté bulle de solution pour un certain temps en raison de la formation Cl 2 -gaz. Laissez le système fermé O / N (ou au moins 8 heures).
      5. Retirer le couvercle du dessiccateur. Sortez la boîte et le couvrir avec le couvercle pour éviter toute contamination pendant le transport.
      6. Mettez la boîte dans une hotte à flux d'air laminaire, retirez le couvercle et laisser les graines pendant environ 1 heure à température ambiante pour permettre la libération de gaz.
        Note: Les graines peuvent être stockés en toute sécurité à sec dans des tubes de micro-centrifugation fermés jusqu'à 2 semaines à 4 ° C.
  2. Induction des racines latérales chez Arabidopsis
    1. Inhibition de racines latérales (traitement NPA)
      1. Préparer un milieu de croissance pour la croissance in vitro. Le milieu contient la moitié de la force mélange Murashige et Skoog 15 sel, 0,1 g / L de myo-inositol, 10 g / L de saccharose, et est tamponnée avec 0,5g / L 2- (N-morpholino) éthanesulfonique (MES).
      2. Ajuster le pH à 5,7 avec KOH 1 M. Ajouter 8 g / L de gélose de tissus végétaux et de l'autoclave le moyen pendant 20 min à 121 ° C.
      3. Préparer un mM solution de NPA 25 dans le diméthylsulfoxyde (DMSO) (ATTENTION: Utiliser des gants). Dans une hotte à flux d'air laminaire, refroidir le milieu autoclave jusqu'à environ 65 ° C (qui est la température à laquelle la bouteille peut être tenu à la main), et d'ajouter mM NPA solution stock 25 pour obtenir une concentration finale de 10 uM NPA.
      4. Homogénéiser lors de l'addition en agitant doucement le flacon pendant 10 secondes. Verser 50 ml de milieu par boîte de Pétri carrée (12 cm x 12 cm).
        Remarque: En cas de grande expérience à grande échelle, appliquer un filet de nylon (20 um) pour assurer le transfert facile. Préparer une maille (9 cm x 9 cm) de l'autoclave (figure 1A). Quand l'autoclave, à appliquer le maillage du milieu de croissance en utilisant des pinces stériles (Figure 1B). Poussez doucement le maillage pour le milieu de croissance en utilisant un sterilized drigalsky pour vous assurer qu'il est en bon contact avec le milieu de croissance (figure 1B) (ATTENTION: travailler dans des conditions stériles).
      5. Semez les graines sur les NPA-plaques.
        Remarque: Dans le cas d'une grande expérience à grande échelle est prévu, sèment 2 lignes denses et bien alignées de 50 graines pour faciliter l'échantillonnage (voir 1.2.2.3).
        1. En cas de stérilisation liquide, semer les graines sur NPA-plaques à l'aide d'une pipette de 200 pi. Coupez 3 - 4 mm de la fin des conseils de pipetage dans des conditions stériles (ou avant la stérilisation des conseils) afin d'être en mesure de pipeter les graines. Pipet monter et descendre une couple de fois pour remettre en suspension les graines, puis de pipettes à aspiration de l'eau à environ 150 pi stérile avec 10 - 20 graines et attendre que les sédiments des semences au bas de la pointe. (ATTENTION: travailler dans des conditions stériles)
          Note: Lorsque vous touchez la agar ou la maille délicatement avec la pointe, une goutte d'eau avec une graine sera libéré de ce (figure 1C).
        2. <li> En cas de stérilisation au gaz, semer les graines à l'aide autoclave toothpicks.Pinch le cure-dent dans la gélose avant de prendre les graines pour assurer une surface collante. Ramassez la graines une à une aide de la cure-dent et de distribuer les graines sur les plaques (figure 1D). Alternativement, ajouter de l'eau stérile pour les graines, et de semer comme décrit dans 1.2.1.5.1 (ATTENTION: travailler dans des conditions stériles).
      6. Sceller les plaques avec du ruban adhésif respirant et rangez-les plaques à 4 ° C dans l'obscurité pendant au moins 2 jours et au maximum une semaine. Ceci est nécessaire pour la stratification et assure la synchronisation et la germination plus efficace.
        Note: Alternativement, les graines peuvent être stratifiés avant le semis, immergés dans de l'eau distillée dans les micro-centrifugeuse tubes, ce qui nécessite moins d'espace de réfrigérateur. Dans ce cas, stocker les tubes pendant au moins une semaine à 4 ° C, et déplacer les plaques à l'armoire de croissance immédiatement après le semis (voir 1.2.1.7).
        JOUR 3 Déplacer les plaques à l'armoire de croissance (lumière continue (110 uE m -2 s -1), 21 ° C) pendant 5 jours (2 jours de germination et 3 jours de croissance) dans une position presque verticale (80 à 90 °) pour assurer la croissance des racines sur, et non dans le milieu.
        JOUR 8
    2. De racines latérales induction (traitement NAA)
      1. Préparer le même milieu de croissance tel que décrit dans 1.2.1.1 1.2.1.2 et. Préparer une solution à 50 mM de NAA dans le DMSO (ATTENTION: Utiliser des gants). Refroidir le milieu à l'autoclave à 65 ° C et ajouter la solution NAA pour le moyen d'obtenir une concentration finale de 10 uM NAA (ATTENTION: travailler dans des conditions stériles).
        1. Homogénéiser lors de l'addition en agitant doucement le flacon pendant 10 secondes. Verser 50 ml de milieu par boîte de Pétri carrée (12 cm x 12 cm).
      2. Transférer les plants provenant des plaques contenant du milieu de croissance supplémenté avec 10 uM de l'APM à celles supplétées avec 10 uM NAA.
        1. Accrocher les bras de pincettes courbes sous les cotylédons de la plantule et retirez-le délicatement de la plaque. Transférer seulement les plants dont les racines sont cultivées dans tout contact avec le milieu de croissance et l'APM de préférence vers le bas.
        2. Écumer la racine sur la surface du milieu de croissance contenant NAA sur une petite distance. Assurez-vous que les racines des plantes sont en bon contact avec le milieu de croissance. Si nécessaire, appuyez sur la racine doucement à la surface du milieu de croissance avec la pince à épiler.
          Remarque: Dans le cas d'une expérience à grande échelle, supprimer tous les plants qui ne sont pas en contact avec la maille et le transfert en soulevant le filet sur les deux coins supérieurs avec des pincettes. Assurez-vous que le maillage est en bon contact avec le milieu contenant NAA par écrémage de la maille sur la surface de la gélose sur une petite distance (figure 1E).
      3. Sceller les nouvelles plaques avec du ruban adhésif respirant et placez-les dans l'armoire de la croissance (conlumière continu (110 uE m -2 s -1), 21 ° C) dans une position verticale pendant le temps désiré après induction jusqu'à ce que l'échantillonnage.
        Remarque: Dans le cas d'une expérience à grande échelle, utiliser un scalpel pour couper les segments de racines à la fois directement sur le maillage et les déguster en grattant délicatement la surface de la maille.

2. SCIF Protocole maïs

  1. Stratification de maïs Kernels
    1. Incuber les grains de maïs à 4 ° C dans l'obscurité pendant au moins une semaine.
      Remarque: Ce protocole a été développé en utilisant la lignée consanguine B73 de maïs.
  2. Stérilisation des des grains de maïs
    JOUR 1
    Remarque: Bien que les semis de maïs ne doivent pas être cultivées dans des conditions stériles, il est recommandé de stériliser les grains de maïs et de travailler avec du matériel stérile pour empêcher la croissance fongique dans le rouleau de papiersystème.
    1. Mettez le nombre nécessaire de grains de maïs dans un bécher en verre stérilisée.
    2. Ajouter 100 ml de solution de stérilisation (6% NaOCl dans l'eau) (ATTENTION: Utiliser hotte fumées).
    3. Ajouter une barre d'agitation magnétique et placer le bécher sur un agitateur magnétique à faible vitesse d'agitation (environ 250 rpm) à température ambiante pendant 5 min.
    4. Rincer cinq fois pendant 5 minutes par le remplacement de la solution avec 100 ml d'eau stérile frais.
  3. Semer des grains de maïs
    1. Mettez des gants afin de réduire le risque de contamination, et de prendre un rouleau de serviettes en papier.
    2. Déchirez deux tronçons de papier essuie-main avec une longueur totale de deux feuilles (environ 92 cm x 24 cm) et de les placer sur le dessus de l'autre sur une surface propre (figure 2A).
    3. Pliez les feuilles de doubler sur la longueur (environ 92 cm x 12 cm) (figure 2A).
    4. Utilisez des pinces à distribuer 10 noyaux à environ 2 cm du haut sur til toute la longueur du papier, tout en gardant un espace de 8 cm entre chaque noyau et 8 cm libre aux deux extrémités (figure 2B). Assurez-vous que la radicule du noyau est orientée vers le bas et vers le papier (figure 2B).
    5. Rouler délicatement le papier sur la longueur, tout en gardant les graines en place (figure 2B). Pour faciliter le roulement, il est facultatif pour pulvériser d'abord le papier avec de l'eau stérile.
    6. Placez les rouleaux de papier en tubes de verre stérilisés d'environ 6 cm de diamètre et 14 cm de hauteur (par exemple, 250 ml tubes de centrifugeuses) et les placer dans un rack (figure 2C).
  4. Induction des racines latérales chez le maïs
    1. Préparer une solution stock mM NPA 50 (dissous dans du DMSO) (ATTENTION: Utiliser des gants).
    2. Pour chaque tube, préparer une solution 50 uM NPA en ajoutant 125 pi du NPA mM solution stock de 50 à 125 ml d'eau stérile dans un récipient en verre stérilisés.
    3. Mélangez bien etversez 125 ml de la solution 50 uM NPA sur le rouleau de papier dans le tube. Le rouleau de papier va absorber la solution et devenir complètement trempé.
      Remarque: Lors de l'utilisation des rouleaux et des tubes de papier avec d'autres dimensions, ajuster le volume en conséquence. Le liquide devrait atteindre la moitié du tube pour assurer l'absorption suffisante.
    4. Placez le système de rouleau de papier dans une armoire de croissance pendant trois jours (27 ° C, éclairage continu, 70% d'humidité relative). Assurez-vous que les rouleaux de papier restent trempés par l'ajout supplémentaire solution à 50 uM NPA, puisque la solution évapore au fil du temps (figure 2D).
      JOUR 4
    5. Préparer une NAA mM solution stock 50 (dissous dans du DMSO) (ATTENTION: Utiliser des gants).
    6. Pour chaque tube, préparer une solution de NAA 50 uM en ajoutant 125 pi de stock mM NAA 50 à 125 ml d'eau stérile dans un récipient en verre stérilisés.
    7. Doucement extraire plus de la solution APM restant des rouleaux de papier et placez lem dans l'eau stérile pendant 5 min à laver sur (ATTENTION: Utiliser des gants). Appuyez doucement sur la plupart de l'eau à partir des rouleaux de papier. Répéter cette étape de lavage à trois reprises.
    8. Mélangez bien et versez la solution de NAA 50 uM sur les rouleaux de papier dans les tubes. Assurez-vous qu'ils sont complètement trempés.
    9. Placer le système de rouleau de papier dans l'armoire de croissance (27 ° C, lumière continue, humidité relative 70%) pendant la durée voulue après l'induction.
  5. Induction de racines latérales dans des racines adventives de la Couronne de maïs
    Remarque: Le SCIF comme décrit ci-dessus induit racines latérales dans la racine primaire. Toutefois, dans le maïs et d'autres monocotylédones, la racine primaire et les racines séminales embryonnaires, avec leurs racines latérales, sont principalement important pendant le développement des semis. A un stade ultérieur de la croissance des plantes, les racines adventives post-embryonnaires posent sur ​​la tige et aussi développent des racines latérales pour former un nouveau système de racine 16. Le SCIF peut également être utiliséd pour induire racines latérales sur ces racines adventives de la Couronne post-embryonnaires en suivant quelques ajustements mineurs à la SCIF sur la racine primaire embryonnaire.
    1. Pour faire les rouleaux de papier, créer un sandwich de papiers avec respectivement deux couches de papier essuie-mains sur le côté extérieur, et deux couches de papier de germination sein. Placez les grains stérilisés (voir les étapes 02/01 au 02/02) entre les deux feuilles de papier de germination. Papier de germination, par rapport au papier essuie-mains, sera moins enclin à être pénétré par les poils absorbants et les racines latérales, ce qui rendra l'ouverture de la rouleaux de papier plus facile plus tard. D'autre part, les deux couches externes de papier essuie-mains vont faciliter l'absorption du liquide.
    2. Insérez les rouleaux dans 700 ml tubes de verre et versez de l'eau stérile sans NPA sur eux. Assurez-vous qu'ils sont complètement trempés.
    3. Germer les grains stérilisés dans l'armoire de la croissance (voir l'étape 2.4.9).
    4. Cultivez les semis jusqu'à ce que les racines adventives de la Couronnecommencer à émerger (6 jours pour les B73). Assurez-vous que les rouleaux de papier sont maintenus humides en tout temps en ajoutant de l'eau stérile si nécessaire.
    5. Transfert à une solution à 25 uM NPA pendant 4 jours (voir les étapes 2.4.1 à 2.4.4), suivie par une induction similaire de latéral initiation des racines en remplaçant la solution APM avec une solution de NAA 50 uM après une étape de lavage (voir l'étape 2.4 0,5 à 2.4.9).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Application de la SCIF à Effectuer transcriptomique comparative des processus racine Initiation latéral

Une application de la LRIS est la comparaison et de corrélation des profils d'expression de gènes au cours de la formation de racines latérales chez différentes espèces. Transcriptomique comparative des approches de créer la possibilité d'identifier les gènes orthologues impliqués dans le processus de développement des racines latérales chez différentes espèces. Lateral root initiation, qui comprend la formation d'un nouvel organe à partir d'un sous-ensemble de cellules contenues dans un axe de la racine déjà formée, est le principal mécanisme partagé par les angiospermes de contrôler leur architecture racinaire. Par conséquent, il est très probable qu'il a évolué à partir des voies existantes présentes dans un ancêtre commun et a été conservée tout au long de l'évolution. En effet, les régulateurs potentiels communs de latéral initiation des racines ont été trouvés dans différentes espèces <sup> 17, 18.

Matériel d'échantillonnage en utilisant le SCIF chez Arabidopsis et le maïs, et de l'analyse du transcriptome

Le SCIF a été établie dans deux espèces différentes:. Arabidopsis et le maïs 10, 13 Dans les deux espèces, il a été décidé de goûter les plantes juste avant le traitement NAA, et peu de temps après l'induction, au début ou au cours de la réponse de l'auxine, comme ainsi qu'à l'apparition de, ou pendant les premières divisions dans le péricycle. En outre, tri cellulaire activé par fluorescence 19 (FACS) a été utilisé chez Arabidopsis ou microscopie laser capture 20, 21 (LCM) dans le maïs pour sélectionner les cellules de péricycle. Chez Arabidopsis, les points de temps de 2 et 6 heures après l'induction ont été choisis en fonction de la caractérisation de la transcription de l'PDR5 :: réponse de l'auxine de GUS et pCYCB1; 1 :: GUS cycle cellulaire lignes de marquage 9 (figure 3). Dans le maïs, les points 2, 3 et 4 h après l'induction du temps, ont été sélectionnés après caractérisation microscopique de l'activité de division cellulaire et l'analyse de plusieurs gènes marqueurs de cycle cellulaire expression en utilisant en temps réel inverse quantitative réaction en chaîne transcription de la polymerase (qRT-PCR) 13 . L'ARN a été extrait des cellules isolées et hybride sur des plates-formes de puces à ADN comme décrit précédemment 10, 13.

Trouver le orthologue d'Arabidopsis CYCB1; 1 (AtCYCB1; 1) dans le maïs

Chez Arabidopsis, la ligne de marqueur pCYCB1; 1 :: GUS a été largement utilisé pour suivre les premières divisions de l'péricycle pendant latéral initiation des racines. Tel marqueur serait trèsutile dans le maïs. Plusieurs homologues de AtCYCB1; 1 ont été trouvés dans le maïs (www.maizesequence.org, tous les peptides, BLASTP, les paramètres par défaut). Six d'entre eux étaient présents sur la puce réalisée après SCIF dans le maïs et montré enrichissement significatif. Le meilleur coup de BLAST, GRMZM2G310115, a montré des niveaux très élevés de transcription après SCIF, similaire à ce qui a été observé chez Arabidopsis pour AtCYCB1; 1 (figure 4).

Application de la SCIF à Vérifiez individuelle Gene Expression

Pour valider GRMZM2G310115 comme un bon candidat orthologue de AtCYCB1; 1 dans le maïs latéral racine initiation, en temps réel qRT-PCR sur des échantillons prélevés à différents points dans le temps a été réalisée au cours d'une SCIF 13. Les plantes ont été traitées comme décrit dans le protocole mentionné ci-dessus et récolté à différents points dans le temps: avant NTraitement de l'AA (NPA), et après 2, 3 et 4 h du traitement NAA. En outre, le matériel de plantes cultivées seulement dans l'eau a été récolté à comparer l'expression de gènes entre SCIF et des conditions neutres. Immédiatement après la récolte, des segments de racines correspondant à une région comprise entre 5 mm et 15 mm au-dessus de la pointe de la racine ont été disséqués sous la loupe binoculaire. En utilisant des pinces, le cortex a été séparé de la stèle (qui contient le péricycle), et l'ARN a été extrait à partir de deux tissus. Cette dernière étape a été effectuée au lieu de LCM, car il est beaucoup plus rapide et moins cher pour validation. Utilisation du terme respectif suivant et inverser amorces qRT-PCR, AGCAGGACGCAGTTGGAGAG et GAGCCGAGAGCACAGAAGAAAG, GRMZM2G310115 a été validé pour être régulés à la hausse sur SCIF, et d'être spécifique pour les tissus de la stèle (figure 5). En outre, cette expérience montre que sans induction synchrone, les événements discrets de latéral initiation des racines qui se passe dans une racine de plus en plus dans l'eau ne sont pas détectables, et d'illustrer la nécessité de la SCIF pour révéler l'expression différentielle des gènes liés au processus d'initiation des racines latérales.

Figure 1
Figure 1. Lateral Root System inductible pour Arabidopsis (A) Préparation du filet de nylon (20 pm):. Couper le filet de nylon (9 cm par 9 cm), l'envelopper dans une feuille d'aluminium et le mettre dans un récipient en verre pour autoclave. (B) Appliquer le filet de nylon sur une plaque contenant NPA (10 uM) en utilisant une pince à épiler. Ensuite, utilisez un Drigalski stérile afin d'éliminer les bulles d'air. (C) à semer des graines sur le filet de nylon à l'aide d'une pipette. (D) semer des graines sur le filet de nylon à l'aide d'un cure-dent. (E) transférer le filet de nylon à une plaque contenant NAA (10 uM) en utilisant une pince à épiler.81 / 53481fig1large.jpg "target =" _ blank "> S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2. latéral système inductible Racine pour le maïs.   (A) Préparation des rouleaux de papier: placez deux couches de papier (92 cm x 24 cm, longueur de deux feuilles) sur le dessus de l'autre et plier en double sur la longueur (92 cm x 12 cm). (B) de mettre 10 grains de maïs stérilisés avec la radicule vers le bas sur le papier à 2 cm du haut avec un interspacing de 8 cm. Puis rouler le papier tout en gardant les grains de maïs en place. (C) Placez les rouleaux de papier dans des tubes (par exemple, 250 ml tubes de centrifugeuses) et les mettre dans un rack. (D) Cultivez les semis de maïs pour trois jours dans une solution APM de 50 um (à 27 ° C, lumière continue, humi rapportdité 70%). (E) Gauche: semis juste avant le transfert à NAA; Moyen: sections transversales microtome juste avant le transfert à l'ANA et 2 jours après le transfert de NAA; Droite:. Semis avec des racines latérales visibles émergé 5 jours après le transfert de NAA S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 3
Figure 3. racines latérales Initiation est stimulée Sur prolongée cours NAA traitement. (AF) Temps montrant la réponse de l'auxine pendant un traitement NAA utilisant la ligne de marqueur PDR5 :: GUS. La réponse de l'auxine, qui est l'un des premiers événements déclencheurs latérale initiation des racines, commence 2 heures après le début du traitement NAA. Dans le panneau supérieur, un aperçu de l'ensemble des semis est donné; le spectacle de panneau inférieurs la réponse de l'auxine dans la pointe de la racine. Bien sûr (GM) Temps d'un traitement utilisant la NAA pCYCB1; ligne de marqueur 1 :: GUS. Le signal de GUS représente l'expression de la CYCB1; une gène, ce qui indique que les premières divisions cellulaires conduisant à la formation de racines latérales commencent à 6 h après le début du traitement NAA. Dans le panneau supérieur, un aperçu de l'ensemble des semis est donné; le panneau inférieur montre CYCB1;. 1 expression dans la pointe de la racine (coloration GUS selon Beeckman et Engler 1994 22) S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 4
Figure 4. Profil de l'expression des gènes dans Arabidopsis CYCB1 et de maïs au cours de SCIF.   (A) des valeurs d'expression de puces à ADN de AtCYCB1; 1 pendant SCIF comme décrit par De Smet et al. 2008 10 (B) biopuces valeurs d'expression de orthologues potentiels de AtCYCB1; 1 cours SCIF comme décrit par Jansen et al. 2,013 pointage 13 BLASTP est le score obtenu lorsque le dynamitage de la séquence protéique de AtCYCB1; 1 sur le génome du maïs. Les barres d'erreur expriment écart-type et ** représente un valeur p ≤0.01. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 5
Figure 5. Expression des GRMZM2G310115 dans la Stèle et le cortex de maïs Roots pendant SCIF. L'expression de <em> GRMZM2G310115 pendant LRIS dans le maïs a été évaluée en temps réel quantitative qRT-PCR sur des échantillons de cortex disséqués et stèle. Un échantillonnage supplémentaire a été réalisée sur les plantes cultivées sur l'eau. Les valeurs ont été normalisées pour l'expression dans la stèle dans l'eau. Les barres d'erreur expriment écart-type et ** représente un valeur p ≤0.01 (amorces et les gènes de référence selon Jansen et al. 2 013 13). S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dans le protocole d'Arabidopsis LRIS, il est important de transférer uniquement les plants qui ont poussé entièrement en contact avec le milieu de croissance contenant l'APM. Cela garantit que l'initiation de racine latérale est bloquée sur toute la longueur des racines. Afin d'éviter de blesser les plantules pendant le transfert, les bras de la pince courbes peuvent être accrochés sous les cotylédons de la plantule. Lors du transfert, assurez-vous que les racines des plantules sont suffisamment en contact avec le milieu d'agar contenant NAA. Ceci peut être réalisé par écrémage de la racine sur la surface de la gélose sur une petite distance. Cela permettra d'assurer une induction synchronisé efficace de l'initiation des racines latérales sur la longueur totale des racines. Les racines peuvent être cultivées exposées à la lumière sans affecter négativement leur croissance et latérale induction racine.

Dans le protocole de maïs LRIS, il est important que le radical du noyau tournée vers le bas et vers le papier d'assurer la racine se développera downwards et fixer sur le papier au bon côté 16. Après trois jours de traitement NPA, les semis devraient ont émergé du noyau avec un petit shoot, une racine principale et des racines séminales 16. La racine principale doit être d'environ 2 cm de long avant de procéder à l'induction de l'initiation des racines latérales. Ce protocole a été développé en utilisant la lignée consanguine B73 de maïs, mais en cas d'une lignée de maïs avec un taux de croissance différents, régler le temps d'incubation en conséquence. Assurez-vous que les rouleaux de papier restent trempées en ajoutant régulièrement de 50 uM solution NPA lorsque le liquide se vaporise au fil du temps, sinon le traitement NPA pourrait être le développement inefficaces et indésirables racine latérale précoce pourrait se produire. Le système lui-même empêche exposition des racines à la lumière, mais la lumière est pas un problème majeur, et ne modifie pas la croissance des racines et latérale induction racine.

D'autres moyens pour l'induction contrôlée de racines latérales sont l'utilisation de MECanique de pliage 23 ou 24 gravistimulation. Le principal avantage de ces systèmes est qu'ils ont une induction plus «naturel» par rapport aux traitements hormonaux dans le SCIF, mais l'inconvénient est qu'ils sont limités dans la quantité de matière qui peut être récoltée à un instant donné, parce qu'ils ne donner un latéral événement initiation des racines dans le virage par plant par rapport à une induction complète de la péricycle dans le SCIF.

Le LRIS utilisé dans Arabidopsis et du maïs peut être utilisé dans une variété de plantes, bien que des conditions favorables doivent être optimisés. Pour installer une SCIF, deux étapes successives importants doivent être réalisés: (1) le blocage du transport de l'auxine et (2) l'accumulation d'auxine pour induire latéral initiation des racines. Le système de croissance devrait permettre l'absorption efficace et uniforme des composés et devrait permettre un bon développement des plants. Systèmes alternatifs pour milieu solide (Arabidopsis) et de rouleaux de papier (maïs), tels que la culture liquide, la culture hydroponique ou aéroponique, pourrait être utilisé pour d'autres espèces. La première étape dans la LRIS, à savoir le blocage du transport de l'auxine, peut être obtenue par addition d'un inhibiteur de transport d'auxine de. Bien NPA conduit à un bloc efficace de latéral initiation des racines chez Arabidopsis et le maïs, d'autres composés tels que l'acide 2,3,5-triiodobenzoïque (TIBA) ou de l'acide chlorophenoxyisobutyric p- (de PCIB) pourraient mieux travailler dans d'autres espèces. Une optimisation similaire peut être fait pour la deuxième étape de la LRIS, à savoir le traitement auxine. L'auxine synthétique NAA semble être la plus adaptée pour un SCIF. Le précurseur de l'auxine indole-3 butyrique acide (IBA) pourrait être une bonne alternative car il induit également fortement racines latérales et a une bioactivité élevée dans différentes plantes 25, D'autre part, l'acide indole-3-acétique 26. Auxine naturelle (IAA) est moins stable et plus facilement métabolisé 27, la rationalisation de son effet plus faible sur devel racinepement dans, par exemple maïs ou de riz 25, 26. L'auxine synthétique acide 2,4-dichlorophénoxyacétique (2,4-D) accumule fortement dans les cellules péricycle, partiellement parce que ce ne sont pas exportées à partir des cellules 28, altérer bonne initiation des racines latérales et induire artificielle structures fusionnées. En outre, on a montré d'autres composés interagissant avec les voies de l'auxine, comme naxillin 12 pour induire latéral initiation des racines chez Arabidopsis et peuvent être testés dans d'autres espèces.

Dans certains cas, la germination est inefficace en présence d'APM et une première pourrait choisir de faire germer les graines en l'absence de l'APM, à transférer ensuite les plants dans le système contenant de l'APM. Ceci induit un risque possible d'avoir premières ébauches racines latérales engagées avant l'induction de la racine latérale avec un traitement NAA et, par conséquent, il est important de ne goûter la région de la racine que allongé pendant le traitement NPA. Suite à cette stratégie générale, un shoULD être en mesure d'optimiser une SCIF pour pratiquement toutes les plantes (semences) et en tant que tels, ont un système facile à étudier le développement des racines latérales pour la plante d'intérêt. Une caractérisation plus poussée de la synchronisation de l'initiation des racines latérales peut se produire par l'intermédiaire de lignes de marquage, comme en témoigne d'Arabidopsis. Si les lignes de marquage sont difficiles à obtenir, une étude histologique détaillée pourrait être fait, mais cela prend du temps et les premières divisions cellulaires ne sont pas facilement reconnaissable. En variante, l'analyse de l'expression des marqueurs de division cellulaire peut être utilisé pour indiquer le moment où les premières divisions cellulaires.

Le SCIF peut être utilisé à des fins différentes, telles que l'analyse du transcriptome 9-13 comme décrit brièvement dans les résultats, ainsi que des observations histologiques au niveau macroscopique et microscopique pendant latéral initiation des racines 14. Différents types d'échantillonnage, allant de l'organe à l'échelle de la cellule 29, pourrait permettre à démêler les différents aspects de la suiteal racine initiation. En outre, le SCIF peut être utilisé pour surveiller l'effet de différents composés sur l'initiation de racine latérale 12, 30. Enfin, à l'aide de lignes de rapporteurs, un LRIS peut également être utilisé pour caractériser facilement l'expression du gène et / ou la localisation des protéines pendant latérale le développement des racines.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs ont rien à révéler.

Materials

Name Company Catalog Number Comments
ARABIDOPSIS LRIS
Seeds
Arabidopsis seeds Col-0 ecotype
Gas sterilization of seeds
micro-centrifuge tubes 1.5 ml SIGMA-ALDRICH 0030 125.215 Eppendorf microtubes 3810X, PCR clean
micro-centrifuge tubes 2 ml SIGMA-ALDRICH 0030 120.094 Eppendorf Safe-Lock microcentrifuge tubes
hydrochloric acid Merck KGaA 1,003,171,000 37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu
glass desiccator SIGMA-ALDRICH Pyrex
glass beaker
plastic micro-centrifuge tubes box or holder
Bleach sterilization of seeds
ethanol Chem-Lab nv CL00.0505.1000 Ethanol, abs. 100% a.r. dilute to 70%
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
Tween 20 SIGMA-ALDRICH P1379
sterile water
Growth medium
Murashige and Skoog salt mixture DUCHEFA Biochemie B.V. M0221-0050
myo-inositol SIGMA-ALDRICH I5125-100G
2-(N-morpholino)ethanesulfonic acid (MES) DUCHEFA Biochemie B.V. M1503.0100
sucrose VWR, Internation LLC 27483.294 D(+)-Sucrose Ph. Eur.
KOH Merck KGaA 1050211000 pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur
Plant Tissue Culture Agar LabM Limited MC029
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 10 µM (Arabidopsis)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 10 µM (Arabidopsis)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Making a mesh for transfer
nylon mesh Prosep byba Synthetic nylon mesh 20 µm
Sowing and seedling handling
square petri dish plates GOSSELIN BP124-05 12 x 12 cm
50 ml DURAN tubes SIGMA-ALDRICH CLS430304 Corning 50 ml centrifuge tubes
drigalski Carl Roth K732.1
pipette
cut pipette tips Daslab 162001X Universal 200, cut off 5 mm of tip before autoclaving
breathable tape  3M Deutschland GmbH cat. no. 1530-1
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
Growth conditions
growth room 21 °C, continuous light
Materials Company Catalog Comments
MAIZE LRIS
Seeds
Maize kernels B-73
Bleach sterilization of kernels
glass beaker
magnetic stirrer  Fiers nv/sa C267.1
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
sterile water
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 50 µM (maize primary root), 25 µM (maize adventitious root)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 50 µM (maize)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Sowing and seedling handling
paper hand towels Kimberly-Clark Professional* 6681 SCOTT Hand Towels - Roll / White; sheet size (24 x 46 cm)
seed germination paper Anchor Paper Company 10 X 15 38# seed germination paper
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
250 ml (centrifuge) tubes SCHOTT DURAN 2160136 approx. 5.6 cm diameter and 14.7 cm height 
700 ml tubes DURAN GROUP 213994609 cylinders, round foot tube, D 60  x 250
rack for maize tubes, home made
sterile water
Growth conditions
growth cabinet 27 °C, continuous light, 70% relative humidity

DOWNLOAD MATERIALS LIST

References

  1. Van Norman, J. M., Xuan, W., Beeckman, T., Benfey, P. N. To branch or not to branch: the role of pre-patterning in lateral root formation. Development. 140, 4301-4310 (2013).
  2. Dolan, L., et al. Cellular organisation of the Arabidopsis thaliana root. Development. 119, 71-84 (1993).
  3. Bell, J. K., McCully, M. E. A histological study of lateral root initiation and development in Zea mays. Protoplasma. 70, 179-205 (1970).
  4. Benkova, E., et al. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell. 115, 591-602 (2003).
  5. Beeckman, T., Burssens, S., Inzé, D. The peri-cell-cycle in Arabidopsis. J. Exp. Bot. 52, 403-411 (2001).
  6. Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inzé, D., Beeckman, T. Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell. 14, 2339-2351 (2002).
  7. Jansen, L., Parizot, B., Beeckman, T. Inducible system for lateral roots in Arabidopsis thaliana and maize. Methods Mol Biol. 959, 149-158 (2013).
  8. Casimiro, I., et al. Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell. 13, 843-852 (2001).
  9. Himanen, K., et al. Transcript profiling of early lateral root initiation. Proc. Natl. Acad. Sci. USA. 101, 5146-5151 (2004).
  10. De Smet, I., et al. Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root. Science. 322, 594-597 (2008).
  11. Vanneste, S., et al. Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana. Plant Cell. 17, 3035-3050 (2005).
  12. De Rybel, B., et al. A role for the root cap in root branching revealed by the non-auxin probe naxillin. Nat. Chem. Biol. 8, 798-805 (2012).
  13. Jansen, L., et al. Comparative transcriptomics as a tool for the identification of root branching genes in maize. Plant Biotechnol. J. 11, 1092-1102 (2013).
  14. Parizot, B., et al. Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation. Plant Physiol. 146, 140-148 (2008).
  15. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 15, 473-497 (1962).
  16. Bellini, C., Pacurar, D. I., Perrone, I. Adventitious roots and lateral roots: similarities and differences. Annu Rev Plant Biol. 65, 639-666 (2014).
  17. Grunewald, W., Parizot, B., Inzé, D., Gheysen, G., Beeckman, T. Developmental biology of roots: One common pathway for all angiosperms? Int. J. Plant Dev. Biol. 1, 212-225 (2007).
  18. Parizot, B., Beeckman, T. Genomics of root development. Root Genomics and Soil Interactions. Crespi, M. 3-28 (2012).
  19. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. Journal of visualized experiments : JoVE. (2010).
  20. Nakazono, M., Qiu, F., Borsuk, L. A., Schnable, P. S. Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize. Plant Cell. 15, 583-596 (2003).
  21. Ludwig, Y., Hochholdinger, F. Laser microdissection of plant cells. Methods Mol Biol. 1080, 249-258 (2014).
  22. Beeckman, T., Engler, G. An easy technique for the clearing of histochemically stained plant tissue. Plant Mol. Biol. Rep. 12, 37-42 (1994).
  23. Ditengou, F. A., et al. Mechanical induction of lateral root initiation in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA. 105, 18818-18823 (2008).
  24. Lucas, M., Godin, C., Jay-Allemand, C., Laplaze, L. Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation. J. Exp. Bot. 59, 55-66 (2008).
  25. Wang, S., Taketa, S., Ichii, M., Xu, L., Xia, K., Zhou, X. Lateral root formation in rice (Oryza Sativa. L.): differential effects of indole-3-acetic acid and indole-3-butyric acid. Plant Growth Regul. 41, 41-47 (2003).
  26. Martinez-de la Cruz, E., Garcia-Ramirez, E., Vazquez-Ramos, J. M., Reyes de la Cruz, H., Lopez-Bucio, J. Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings. J Plant Physiol. 176, 147-156 (2015).
  27. Beyer, E. M., Morgan, P. W. Effect of ethylene on uptake, distribution, and metabolism of indoleacetic acid-1-14C and -2-14C and naphthaleneacetic acid-1-14C. Plant Physiol. 46, 157-162 (1970).
  28. Delbarre, A., Muller, P., Imhoff, V., Guern, J. Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta. 198, 532-541 (1996).
  29. Bailey-Serres, J. Microgenomics: genome-scale, cell-specific monitoring of multiple gene regulation tiers. Annu Rev Plant Biol. 64, 293-325 (2013).
  30. Perez-Torres, C. A., et al. Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor. Plant Cell. 20, 3258-3272 (2008).
Lateral système inductible Racine dans<em&gt; Arabidopsis</em&gt; Et de maïs
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).More

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter