Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

מערכת עין מתנהל שורש לרוחב ב doi: 10.3791/53481 Published: January 14, 2016
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

מערכת השורשים היא קריטית לצמיחת צמח, שכן הוא מבטיח מעגן וספיגה של מים וחומרים מזינים מהאדמה. בגלל ההתרחבות של מערכת שורשים בעיקר מסתמכת על הייצור של שורשים לרוחב, הייזום והקמה שלהם נחקרו בהרחבה. שורשים לרוחב הם יזמו בתת-קבוצה מסוימת של תאי pericycle, הנקראים תאי מייסד 1. ברוב dicots, כגון thaliana ארבידופסיס, תאים אלה נמצאים בקטבי protoxylem 2, ואילו בmonocots, כגון תירס, שהם נמצאים בקטבי השיפה 3. תאי מייסד מסומנים על ידי תגובת אוקסין עלה 4, ואחריו ביטוי של גני מחזור התא ספציפיים (למשל, cyclin B1; 1 / CYCB1; 1), לאחר שהם עוברים סיבוב ראשון של חטיבות anticlinal סימטריות 5. לאחר סדרה של חטיבות anticlinal וpericlinal מתואמות, primordium שורש לרוחב נוצר שסופו של דבר יתגלה כשורש לרוחב utonomous. המיקום והעיתוי של תחילת שורש לרוחב עם זאת לא צפויים, שכן אירועים אלה הם לא בשפע ולא מסונכרנים. זה מונע את השימוש של גישות מולקולריות כגון transcriptomics ללמוד את התהליך הזה.

כדי להתמודד עם זה, מערכת לרוחב שורש עין מתנהל (LRIS) פותחה 6, 7. במערכת זו, מטופלים שתילים ראשון עם N חומצת -1-naphthylphthalamic (רט"ג), אשר מעכב תחבורת אוקסין וצבירה, וכתוצאה מכך חסימת ייזום שורש לרוחב 8. על ידי המשך העברת השתיל למדיום המכיל את חומצת אוקסין הסינתטי 1-נפתלין אצטית (NAA), כל שכבת pericycle מגיבה לרמות הגבוהות אוקסין כך מסיבית חטיבות התרמה לרוחב שורש ייזום תא 6. ככזה, מערכת זו מובילה לחניכות שורשים לרוחב מהירות, סינכרוני ונרחבים, המאפשרת איסוף קל של דגימות שורש מועשרים לשלב ספציפי של מנוחפיתוח שורש RAL. בהמשך לכך, ניתן להשתמש בדוגמאות אלה כדי לקבוע פרופילי ביטוי הגנום במהלך היווצרות שורש לרוחב. LRIS הניב ידע משמעותי כבר על התחלה לרוחב שורש בארבידופסיס ותירס 9-13, אבל הצורך ליישם במערכת זו כדי מיני צמחים אחרים הופך ברור יותר ככל שיותר הגנומים רצף ויש עניין גובר להעברת ידע לחשוב חסכוניים מִין.

הנה, הפרוטוקולים מפורטים של ארבידופסיס וLRISs התירס מקבלים. בשלב הבא, דוגמא של השימוש במערכת מסופקת, על ידי הממחיש כיצד ניתן להשתמש בנתוני transcriptomics צברו מLRIS התירס לזהות homologs הפונקציונלי שיש להם תפקיד שימור בייזום שורש לרוחב על פני מיני צמחים שונים. לבסוף, הנחיות כדי לייעל את LRIS למיני צמחים אחרים מוצעים.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. ארבידופסיס LRIS פרוטוקול

הערה: הטקסט מתייחס לניסויים בקנה מידה "קטנים" או "גדולים". ניסויים בקנה מידה קטנים, כגון ניתוח קו הסמן וצביעה היסטולוגית 6, 14, דורשים רק כמה דוגמאות. ניסויים בקנה מידה גדולים, כגון בזמן אמת כמותי qRT-PCR, מיקרו-מערכי 9-11 או רצף RNA, דורשים כמות גדולה יותר של דגימות. ככזה, סכום של ~ 1000 שתילים לדגימה שימש אל Vanneste et. 11 לבצע ניסוי microarray לאחר נתיחת קטע השורש.

יום 1

  1. עיקור של זרעי ארבידופסיס
    הערה: בחר באחד מההליכים לעיקור הזרע הבאים. כל אחד מהם מתאים לשלבים הבאים של הפרוטוקול. עיקור גז (1.1.2) מציג שני יתרונות עיקריים על פני עיקור נוזלי (1.1.1): זה לוקח פחות זמן בעת ​​טיפול בתחושה גדולהאה של זרעים, שכן אין pipetting צריך להתרחש לדגימות בודדות; וניתן לאחסן את הזרעים המעוקרים לתקופה ארוכה יותר. עם זאת, זה דורש ייבוש וטיפול זהיר.
    1. עיקור נוזל
      1. יוצקים את המספר הרצוי של זרעים בצינורות מיקרו צנטריפוגות. השתמש עד 20 מ"ג (~ 800 זרעים) בצינור 1.5 מיליליטר או 40 מ"ג (~ 1,600 זרעים) ב2 צינורות מיליליטר מיקרו צנטריפוגות.
      2. הוסף 1 מיליליטר של אתנול 70%. היפוך או בעדינות לנער במשך 2 דקות.
      3. החלף את אתנול 70% עם פתרון עיקור 1 מיליליטר במשך 15 דקות. (הכן פתרון עיקור טרי: 3.85 מיליליטר hypochlorite נתרן (מניית NaOCl) (12%) (זהירות: שימוש בעשן מכסה המנוע), 5 μl 20 Tween, עד 10 מיליליטר עם מים להפוך את הצינורות כמה פעמים כדי לוודא שכל הזרעים לבוא. במגע עם הפתרון.
      4. בזרימה אוויר קבינט מינרית, להחליף את פתרון העיקור במים מזוקקים סטריליים 1 מיליליטר ולשטוף את הזרעים 5 פעמים במשך 5 דקות על ידי חוזר ונשנהly החלפה עם 1 מיליליטר של מים מזוקקים סטריליים טריים.
    2. עיקור גז
      1. יוצקים את המספר הרצוי של זרעים בצינור מיקרו צנטריפוגות 2 מיליליטר. השתמש בצינורות בודדים כאשר עובדים עם כמה שורות עצמאיות, ולסדר אותם פתח בתיבת צינורות מיקרו צנטריפוגות פלסטיק או בעל. אם מספר הזרעים בצינור אחד עולה על 500 (12.5 מ"ג), לחלק את הזרעים במספר המתאים של צינורות כדי להבטיח עיקור מוצלח. ודא כמוסות של צינורות שכנים לא לכסות אחד את השני. מתאים זה לזה את המכסה של התיבה בתחתית, כפי שהוא צריך להיות בתא הייבוש, כמו גם לעיקור.
      2. מניחים את התיבה בקערה של ייבוש, יחד עם כוס זכוכית (זהירות: שימוש בעשן מכסה המנוע).
      3. מלא את הכוס עם 12% NaOCl 100 מיליליטר (זהירות: מנדף שימוש). שים את המכסה על הייבוש, אבל להשאיר פתח קטן שבו הכוס ממוקמת.
      4. להוסיף 3 מיליליטר של 37% חומצה הידרוכלורית (רותח) (CAUהמוזכרות: השתמשו עשן מכסה המנוע) לכוס דרך פתח הקטן ולסגור את הייבוש במהירות. בועת הפתרון לכמה זמן עקב היווצרות Cl 2 -gas. השאר את המערכת סגורה O / N (או לפחות 8 שעות).
      5. הסר את מכסה תא ייבוש. קח את הקופסה ולכסות אותו עם המכסה, כדי למנוע זיהום במהלך הובלה.
      6. לשים את הקופסה בזרימה אוויר קבינט מינרית, להסיר את המכסה ולהשאיר את הזרעים כ 1 שעות על RT כדי לאפשר שחרור גז.
        הערה: זרעים יכולים להיות מאוחסנים בבטחה יבש בצינורות מיקרו צנטריפוגות סגורים עד 2 שבועות ב 4 מעלות צלזיוס.
  2. אינדוקציה שורש לרוחב בארבידופסיס
    1. רוחב שורש עיכוב (רשות הטבע והגנים טיפול)
      1. הכן מדיום גידול לצמיחה במבחנה. הבינוני מכיל מחצית כוח תערובת Murashige וSkoog מלח 15, מיו-אינוסיטול L / 0.1 G, 10 גר '/ סוכרוז L, והוא נאגר עם 0.5g / L חומצת ethanesulfonic 2 (N-morpholino) (MES).
      2. התאם את ה- pH 5.7 עם 1 M KOH. הוסף 8 גרם / L של אגר רקמות צמח וחיטוי הבינוני במשך 20 דקות ב 121 מעלות צלזיוס.
      3. הכן פתרון מניות מ"מ 25 של רשות הטבע והגנים בdimethylsulfoxide (DMSO) (זהירות: כפפות שימוש). בזרימה אוויר קבינט מינרית, לקרר את מדיום autoclaved עד כ 65 מעלות צלזיוס (שהיא הטמפרטורה בה הבקבוק יכול להיות מוחזק ביד), ולהוסיף 25 פתרון מניות מ"מ רשות הטבע והגנים כדי להשיג ריכוז סופי של 10 מיקרומטר רשות הטבע והגנים.
      4. Homogenize על ידי בעדינות רועדת בנוסף הבקבוק במשך 10 שניות. יוצקים 50 מיליליטר של מדיום לצלחת פטרי רבוע (12 סנטימטרים X 12 סנטימטרים).
        הערה: במקרה של ניסוי בקנה מידה גדול, תחול רשת ניילון (20 מיקרומטר) כדי להבטיח העברה קלה. הכן רשת (9 סנטימטרים x 9 סנטימטרים) למעוקר (איור 1 א). כאשר autoclaved, להחיל את הרשת למדיום הגידול באמצעות פינצטה סטרילית (איור 1). דחף בעדינות את הרשת למדיום הגידול באמצעות STErilized drigalsky כדי לוודא שהוא נמצא בקשר טוב עם מדיום הגידול (איור 1) (זהירות: עבודה בתנאים סטריליים).
      5. לזרוע את הזרעים ברשות הטבע והגנים-הצלחות.
        הערה: במקרה ניסוי בקנה מידה גדול מתוכנן, לזרוע 2 שורות צפופות ומיושרים היטב של 50 זרעים כדי להקל על הדגימה (ראה 1.2.2.3).
        1. במקרה של עיקור נוזל, לזרוע את הזרעים ברשות טבע וגנים-צלחות באמצעות pipet 200 μl. חותך את 3 - 4 מ"מ של סוף הטיפים pipetting בתנאים סטריליים (או לפני העיקור של הטיפים) כדי להיות מסוגל pipet הזרעים. Pipet למעלה ולמטה כמה פעמים מחדש להשעות את הזרעים, ואז pipet מים כ 150 μl סטרילי עם 10 - 20 זרעים ולחכות עד משקעי זרעים בתחתית של הקצה. (זהירות: עבודה בתנאים סטריליים)
          הערה: כאשר נוגע באגרה או הרשת בעדינות עם הקצה, טיפת מים עם זרע תשוחרר ממנו (איור 1 ג).
        2. <li> במקרה של עיקור גז, לזרוע את הזרעים באמצעות toothpicks.Pinch autoclaved הקיסם לתוך אגר לפני שלקח את הזרעים על מנת להבטיח משטח דביק. להרים את הזרעים האחד אחד באמצעות הקיסם ולהפיץ את הזרעים על הצלחות (1D איור). לחלופין, להוסיף מים סטריליים לזרעים, ולזרוע כמתואר ב1.2.1.5.1 (זהירות: עבודה בתנאים סטריליים).
      6. לאטום את הצלחות עם נייר דבק לנשימה ולאחסן אותם צלחות על 4 מעלות צלזיוס בחושך במשך לפחות 2 ימים ובשבוע אחד לכל היותר. זה נחוץ לריבוד ומבטיח מסונכרנים ונביטה יעילה יותר.
        הערה: לחלופין, ניתן ריבוד זרעים לפני הזריעה, שקועים במים מזוקקים בצינורות מיקרו צנטריפוגות, אשר דורש מרחב מקרר פחות. במקרה זה, לאחסן הצינורות לפחות שבוע אחד ב 4 ° C, ולהעביר את הצלחות לארון הצמיחה מייד לאחר הזריעה (ראה 1.2.1.7).
        יום 3 הזז את הצלחות לארון הגידול (אור רציף (110 מטר של -2 -1), ג '21 ° μE) במשך 5 ימים (2 ימים של נביטה וצמיחה של 3 ימים) במצב כמעט אנכי (80 עד 90 מעלות) על מנת להבטיח צמיחת שורש ב, ולא בטווח הבינוני.
        יום 8
    2. רוחב שורש אינדוקציה (NAA טיפול)
      1. הכן את אותו מדיום הגידול כפי שתואר ב1.2.1.1 ו1.2.1.2. הכן פתרון 50 מ"מ מניות של NAA בDMSO (זהירות: כפפות שימוש). מגניב בינוני autoclaved עד 65 מעלות צלזיוס ולהוסיף פתרון NAA למדיום כדי להשיג ריכוז סופי של 10 מיקרומטר NAA (זהירות: עבודה בתנאים סטריליים).
        1. Homogenize על ידי בעדינות רועדת בנוסף הבקבוק במשך 10 שניות. יוצקים 50 מיליליטר של מדיום לצלחת פטרי רבוע (12 סנטימטרים X 12 סנטימטרים).
      2. העבר את השתילים מהצלחות המכילות מדיום גידול בתוספת 10 מיקרומטר רשות הטבע והגנים לsup אלהליישמם עם 10 מיקרומטר NAA.
        1. הוק זרועות פינצטה מעוקלת תחת הפסיגים של השתיל ובעדינות מסירה אותו מהצלחת. להעביר רק שתילים שהשורשים גדלו כולו במגע עם רשות הטבע והגנים בינוניים-צמיחה ורצוי כלפי מטה.
        2. לרחף השורש על פני מדיום גידול המכיל NAA על פני מרחק קטן. ודא ששורשי הצמח נמצאים בקשר טוב עם מדיום הגידול. במידת הצורך, לחץ על השורש בעדינות אל פני השטח מדיום גידול עם פינצטה.
          הערה: במקרה של ניסוי בקנה מידה גדולה, להסיר את כל השתילים שאינם במגע עם הרשת והעברה על ידי הרמת הרשת בשתי פינות העליונות עם פינצטה. ודא הרשת נמצאת בקשר טוב עם המדיום המכיל NAA על ידי רפרוף הרשת על פני אגר על פני מרחק קטן (איור 1E).
      3. לאטום את הצלחות החדשות עם קלטת לנשימה ולמקם אותם בארון הצמיחה (קוןאור tinuous (110 מטר של -2 -1 μE), ג '21 °) במצב אנכי לזמן הרצוי לאחר אינדוקציה עד דגימה.
        הערה: במקרה של ניסוי בקנה מידה גדולה, להשתמש באזמל כדי לחתוך קטעי השורש בבת אחת ישירות על הרשת ולדגום אותם בעדינות על ידי גירוד פני השטח של הרשת.

2. LRIS תירס פרוטוקול

  1. ריבוד של גרעיני תירס
    1. דגירה גרעיני התירס ב 4 ° C בחושך במשך השבוע לפחות 1.
      הערה: פרוטוקול זה פותח באמצעות הקו טהור תירס B73.
  2. עיקור של גרעיני תירס
    יום 1
    הערה: למרות ששתילי תירס לא צריכים להיות מבוגרים בתנאים סטריליים, מומלץ לעקר את גרעיני התירס ולעבוד עם חומר סטרילי כדי למנוע צמיחת פטרייה בגליל הניירמַעֲרֶכֶת.
    1. שים את המספר הדרוש של גרעיני תירס בכוס זכוכית מעוקרת.
    2. להוסיף לפתרון עיקור (6% NaOCl במים) (זהירות: מנדף שימוש) 100 מיליליטר.
    3. הוסף בר ומערבבים מגנטיים ומניח את הכוס על בוחש מגנטי במהירות ערבוב נמוכה (כ 250 סל"ד) על RT במשך 5 דקות.
    4. לשטוף חמש פעמים במשך 5 דקות על ידי החלפת הפתרון עם מים סטריליים טריים 100 מיליליטר.
  3. זריעת גרעיני תירס
    1. שים את כפפות כדי להפחית את הסיכון לזיהום, ולקחת גליל של מגבות נייר.
    2. לקרוע את שתי רצועות של נייר מגבת יד באורך כולל של שני גיליונות (כ 92 סנטימטרים X 24 סנטימטרים) ומניח אותם על גבי זה על משטח נקי (איור 2 א).
    3. מקפלים את היריעות להכפיל על פני האורך (92 סנטימטרים X 12 סנטימטרים בערך) (איור 2 א).
    4. להשתמש בפינצטה כדי להפיץ 10 גרעינים בכ 2 סנטימטר מהחלק העליון מעל tהוא כל אורך הנייר, תוך שמירה על חלל ביניים של 8 סנטימטר בין כל ליבה ו8 סנטימטר חופשי בשני קצותיו (איור 2). ודא radicle של הקרנל פונה כלפי מטה וכלפי הנייר (איור 2).
    5. בעדינות לגלגל את הנייר על פני האורך, תוך שמירה על הזרעים במקום (איור 2). כדי להקל על הגלגול, זה הוא אופציונלי לראשון לרסס את הנייר עם מים סטריליים.
    6. שים את גלילי נייר בצינורות זכוכית מעוקרות של כ 6 סנטימטרים קוטר וגובה סנטימטר 14 (לדוגמא, 250 צינורות צנטריפוגה מיליליטר) ולמקם אותם במעמד (איור 2 ג).
  4. אינדוקציה שורש לרוחב בתירס
    1. הכן פתרון 50 מ"מ רשות הטבע והגנים מניות (מומס DMSO) (זהירות: כפפות שימוש).
    2. לכל צינור, להפוך את רשות הטבע והגנים פתרון 50 מיקרומטר על ידי הוספת 125 μl מפתרון מניות מ"מ רשות הטבע והגנים 50 עד 125 מיליליטר מים סטריליים בכוס זכוכית מעוקרת.
    3. מערבבים היטב ולשפוך 125 מיליליטר של פתרון רט"ג 50 מיקרומטר על גליל נייר בצינור. גליל הנייר יספוג את הפתרון ולהיות ספוגים לגמרי.
      הערה: כאשר משתמשים בגלילי נייר וצינורות עם ממדים אחרים, להתאים את עוצמת הקול בהתאם. הנוזל צריך להגיע באמצע הצינור כדי להבטיח ספיגה מספיקה.
    4. הנח את מערכת גליל נייר בקבינט צמיחה במשך שלושה ימים (27 מעלות צלזיוס, אור רציף, 70% לחות יחסית). ודא שגלילי הנייר יישארו ספוגים על ידי הוספת פתרון רט"ג 50 מיקרומטר נוספים, שכן הפתרון מתאדה לאורך הזמן (איור 2 ד).
      יום 4
    5. הכן פתרון 50 מ"מ NAA מניות (מומס DMSO) (זהירות: כפפות שימוש).
    6. לכל צינור, להכין פתרון NAA 50 מיקרומטר על ידי הוספת 125 μl ממניות 50 מ"מ NAA למים סטריליים 125 מיליליטר בכוס זכוכית מעוקרת.
    7. יש ללחוץ בעדינות את רוב פתרון רט"ג שנותר מגלילי נייר ומניחמ 'במים סטריליים במשך 5 דקות כדי לשטוף אותו החוצה (זהירות: כפפות שימוש). יש ללחוץ בעדינות את רוב המים מגלילי הנייר. חזור על שלב זה כביסה שלוש פעמים.
    8. מערבבים היטב ויוצקים את פתרון NAA 50 מיקרומטר מעל גלילי נייר בצינורות. לוודא שהם ספוגים לגמרי.
    9. הנח את מערכת גליל נייר בקבינט הצמיחה (27 מעלות צלזיוס, אור רציף, 70% לחות יחסית) למשך הרצוי לאחר אינדוקציה.
  5. אינדוקציה שורש לרוחב בשורשים adventitious כתר של תירס
    הערה: LRIS כפי שתואר לעיל גורם שורשים לרוחב בשורש הראשוני. עם זאת, בתירס וmonocotyledons אחר, השורש היסודי ושורשי הזרע העובריים, יחד עם השורשים לרוחבם, הם בעיקר חשובים בשתיל פיתוח. בשלב מאוחר יותר בגידול צמחים, שורשי adventitious פוסט-עובריים להתעורר על הגזע וגם לפתח שורשים לרוחב כדי ליצור מערכת שורשים חדשה 16. LRIS יכול להיות גם שימושד כדי לגרום לשורשים לרוחב על שורשי כתר adventitious פוסט-עובריים אלה על ידי ביצוע כמה שינויים קלים לLRIS על השורש העיקרי העוברי.
    1. כדי להפוך את גלילי נייר, ליצור כריך של ניירות עם בהתאמה שתי שכבות של נייר מגבת יד בצד החיצוני, ושתי שכבות של נייר נביטה בתוך. מניחים את הגרעינים המעוקרים (ראה צעדים 2.1-2.2) בין שני גיליונות נייר נביטה. נייר נביטה, בהשוואה לנייר מגבת, יהיה פחות נוטה לעבירות לשערות שורש ושורשים לרוחב, אשר תהפוך את הפתיחה של הנייר מתגלגלת קלה יותר בהמשך. מצד השני, שתי שכבות חיצוניות של נייר מגבת יד תקל קליטה של ​​הנוזל.
    2. הכנס את הלחמניות ב700 מיליליטר צינורות זכוכית ויוצקים מים סטריליים ללא רשות הטבע והגנים עליהם. לוודא שהם ספוגים לגמרי.
    3. לנבוט גרעינים המעוקרים בקבינט הצמיחה (ראה שלב 2.4.9).
    4. לגדול השתילים עד שורשי כתר adventitiousמתחיל לצוץ (6 ימים לB73). ודא גלילי נייר נשמרים רטובים כל הזמן על ידי הוספת מים סטריליים בעת צורך.
    5. העברה לפתרון 25 מיקרומטר רשות הטבע והגנים במשך 4 ימים (ראה צעדים 2.4.1 ל2.4.4), ואחריו אינדוקציה דומה חניכה שורש לרוחב על ידי החלפת פתרון רט"ג עם פתרון NAA 50 מיקרומטר לאחר שלב כביסה (ראה שלב 2.4 .5 ל2.4.9).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

יישום של LRIS לבצע transcriptomics השוואתי של תהליך רוט ייזום הרוחב

אחד יישומים של LRIS הוא ההשוואה וההתאמה של פרופילי ביטוי גנים במהלך היווצרות שורש לרוחב במינים שונים. transcriptomics השוואתי גישות ליצור את האפשרות להצביע גני orthologous המעורבים בתהליך פיתוח השורש לרוחב במינים שונים. חניכה לרוחב שורש, אשר מורכבת מההיווצרות של איבר חדש מקבוצת משנה של תאים כלולים בציר שורש כבר נוצר, היא המנגנון העיקרי המשותפים למכוסי זרע לשלוט ארכיטקטורת השורש שלהם. כתוצאה מכך, סביר מאוד שהוא התפתח ממסלולים קיימים כיום באב קדמון משותף ושימור לאורך אבולוציה. ואכן, רגולטורים פוטנציאליים משותפים של ייזום שורש לרוחב נמצאו במינים שונים <sup> 17, 18.

דגימת חומר באמצעות LRIS בארבידופסיס ותירס, וtranscriptome ניתוח

LRIS כבר נקבע בשני מינים שונים:. ארבידופסיס ותירס 10, 13 בשני המינים, הוחלט לדגום את הצמחים רק לפני טיפול NAA, וזמן קצר לאחר גיוס, בתחילת, או בתגובה לאוקסין, כ גם בתחילת, או בחטיבות הראשונות בpericycle. יתר על כן, הקרינה הופעל תא מיון 19 (FACS) שימשה בארבידופסיס או מיקרוסקופית לייזר לכידת 20, 21 (LCM) בתירס כדי לבחור עבור תאי pericycle. בארבידופסיס, נקודות הזמן של 2 ו -6 שעות לאחר האינדוקציה נבחרו מבוססות על אפיון תעתיק של pDR5 :: תגובת אוקסין גאס וpCYCB1; 1 :: קווי סמן מחזור תא גאס 9 (איור 3). בתירס, בפעם מצביעה 2, 3 ו -4 שעות לאחר אינדוקציה, נבחרו לאחר אפיון מיקרוסקופי של פעילות חלוקת תא והניתוח של ביטוי גנים כמה סמן מחזור התא באמצעות בזמן אמת תגובת השרשרת של פולימראז השעתוק לאחור כמותית (qRT-PCR) 13 . RNA הופק מהתאים המבודדים והכלאה על פלטפורמות microarray כמתואר 10, 13 בעבר.

מציאת ortholog של ארבידופסיס CYCB1; 1 (AtCYCB1; 1) בתירס

בארבידופסיס, קו הסמן pCYCB1; 1 :: גאס כבר בשימוש נרחב כדי לעקוב אחר החטיבות הראשונות של pericycle במהלך חניכת שורש לרוחב. סמן כזה יהיה מאודשימושי בתירס. כמה homologs של AtCYCB1; 1 נמצא בתירס (www.maizesequence.org, כל פפטידים, BLASTP, הגדרות ברירת מחדל). שישה מהם היו נוכחים בmicroarray בוצע לאחר LRIS בתירס והראו העשרה משמעותית. הלהיט תפציץ הטוב ביותר, GRMZM2G310115, הראה רמות גבוהות מאוד שעתוק לאחר LRIS, דומות למה שנצפה בארבידופסיס לAtCYCB1; 1 (איור 4).

יישום של LRIS לבדוק ביטוי אישי ג'ין

כדי לאמת GRMZM2G310115 כortholog מועמד טוב של AtCYCB1; 1 בייזום שורש לרוחב תירס, בזמן אמת qRT-PCR על דגימות שנלקחו בנקודות זמן שונות בוצע במהלך LRIS 13. טופלו צמחים כפי שתואר בפרוטוקול הנ"ל ונקטפו בנקודות זמן שונות: לפני Nטיפול AA (רט"ג), ואחרי 2, 3 ו -4 שעות של טיפול NAA. כמו כן, חומר של צמחים גדלו רק במים שנקטפו להשוות ביטוי גנים בין LRIS ותנאים ניטראליים. מייד לאחר קציר, מגזרי שורש מתאים לאזור המורכב בין 5 מ"מ ו -15 מ"מ מעל קצה השורש נותחו תחת משקפת. באמצעות פינצטה, הקליפה הופרדה מהאסטלה (המכיל את pericycle), וRNA הופק משני הרקמות. השלב אחרון זה בוצע במקום LCM, כי זה מהיר יותר וזול יותר בהרבה לאימות. פריימרים qRT-PCR באמצעות קדימה בהתאמה הבאה ולהפוך, AGCAGGACGCAGTTGGAGAG וGAGCCGAGAGCACAGAAGAAAG, GRMZM2G310115 קבלו תוקף להיות על LRIS-מוסדר, ולהיות ספציפי לרקמות אסטלה (איור 5). בנוסף, ניסוי זה מראה כי ללא אינדוקציה סינכרוני, האירועים הבדידים חניכה שורש לרוחב קורים בשורש גדל במים אינם יכולים לאתר, ולהמחיש את הצורך של LRIS לחשוף ביטוי גני ההפרש הקשורים לתהליך של חניכת שורש לרוחב.

איור 1
איור 1. מערכת רוחב שורש עין מתנהל לארבידופסיס () הכנת רשת הניילון (20 מיקרומטר):. לחתוך את רשת הניילון (9 סנטימטר על ידי 9 סנטימטרים), לעטוף אותו בנייר אלומיניום ולשים אותו בכוס זכוכית למעוקר. (ב) החל את רשת הניילון על צלחת רשות הטבע והגנים המכילים (10 מיקרומטר) באמצעות פינצטה. לאחר מכן להשתמש drigalski סטרילי כדי למנוע בועות אוויר. (ג) לזרוע זרעים ברשת הניילון באמצעות pipet. (ד) לזרוע זרעים ברשת הניילון באמצעות קיסם. (ה) מעבירים את רשת הניילון לצלחת המכיל NAA (10 מיקרומטר) באמצעות פינצטה.81 53481fig1large.jpg "target =" / _ blank "> לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
איור 2. מערכת עין מתנהל שורש לרוחב לתירס.   (א) הכנת גלילי נייר: מקום שתי שכבות של נייר (92 סנטימטרים X 24 סנטימטר, אורך של שני גיליונות) על גבי זה ולקפל אותם להכפיל על פני האורך (92 סנטימטרים X 12 סנטימטרים). (ב) שים 10 גרעיני תירס מעוקרים עם radicle פונה כלפי מטה על הנייר ב 2 סנטימטר מהחלק העליון עם interspacing של 8 סנטימטר. ואז לגלגל את הנייר, תוך שמירה על גרעיני התירס במקום. (ג) מניחים את גלילי נייר בצינורות (למשל, 250 מיליליטר צינורות צנטריפוגה) ולשים אותם במעמד. (ד) לגדול שתילי התירס במשך שלושה ימים בפתרון רט"ג 50 מיקרומטר (ב 27 מעלות צלזיוס, אור רציף, humi היחסיdity 70%). (ה) משמאל: שתיל ממש לפני ההעברה לNAA; התיכון: חלקים רוחביים microtome רק לפני ההעברה לNAA ו- 2 ימים לאחר ההעברה לNAA; מימין:. שתיל עם שורשים לרוחב יצאו גלויים 5 ימים לאחר ההעברה לNAA אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
איור 3. רוחב שורש ייזום מגורה עם כמובן NAA טיפול. (AF) זמן ממושך מראה את תגובת אוקסין במהלך טיפול NAA באמצעות שורת סמן pDR5 :: גאס. תגובת אוקסין, שהוא אחד מהאירועים הראשונים מפעילות ייזום שורש לרוחב, מתחילה 2 שעות לאחר תחילת טיפול NAA. בפנל העליון, סקירה של כל השתיל ניתן; הצג הפנל התחתוןזה תגובת אוקסין בקצה השורש. כמובן (GM) זמן של טיפול NAA באמצעות pCYCB1; קו סמן גאס 1 ::. אות גאס מייצגת את הביטוי של CYCB1; גן 1, המציין את חלוקות התא הראשונות שמובילות להיווצרות שורש לרוחב להתחיל 6 שעות לאחר תחילת טיפול NAA. בפנל העליון, סקירה של כל השתיל ניתן; הפנל התחתון מציג CYCB1;. ביטוי 1 בקצה השורש (מכתים גאס לפי Beeckman ואנגלר, 1994 22) אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 4
פרופיל ביטוי של גני איור 4. CYCB1 בארבידופסיס והתירס בLRIS.   () ערכי ביטוי Microarray של AtCYCB1; 1 בLRIS כפי שתואר על ידי דה et al Smet. 2,008 ערכי 10 microarray (ב ') ביטוי של orthologs פוטנציאל של AtCYCB1; 1 בLRIS כפי שתואר על ידי אל יאנסן ואח. 2,013 ציון 13 BLASTP הוא הציון מתקבל כאשר פיצוץ רצף החלבון של AtCYCB1; 1 על הגנום התירס. ברים שגיאה להביע סטיית תקן ו** מייצג -value עמ ≤0.01. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 5
איור 5. ביטוי של GRMZM2G310115 באסטלה וCortex של שורשי תירס במהלך LRIS. הביטוי של <em> GRMZM2G310115 במהלך LRIS בתירס הוערך על ידי בזמן אמת כמותי qRT-PCR על דגימות אסטלה וקליפה גזור. דגימה משלימה בוצעה על צמחים גדלים במים. ערכים היו מנורמלים לביטוי במצבה במים. ברים שגיאה להביע סטיית תקן ו** מייצג -value עמ ≤0.01 (פריימרים וגני התייחסות לפי Jansen et al. 2,013 13). אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

בפרוטוקול ארבידופסיס LRIS, חשוב להעביר רק את השתילים שצמחו כולו במגע עם מדיום גידול רשות הטבע והגנים המכיל. הדבר מבטיח כי ייזום שורש לרוחב חסום על אורך השורש כל. כדי למנוע פציעת שתילי במהלך העברה, זרועות המלקחיים המעוקלים יכולות להיות מכור תחת הפסיגים של השתיל. עם ההעברה, לוודא כי שורשי השתיל נמצאים בקשר עם מספיק הבינוני אגר המכיל NAA. זו יכולה להיות מושגת על ידי רפרוף השורש על פני אגר על פני מרחק קטן. זה יבטיח אינדוקציה מסונכרנת יעילה של ייזום שורש לרוחב על סך אורך השורש. ניתן לגדל השורשים חשופים לאור ללא משפיע לרעה על צמיחתם ואינדוקציה שורש לרוחב.

בפרוטוקול LRIS התירס, חשוב שradicle של הקרנל פונה כלפי מטה וכלפי הנייר כדי להבטיח את השורש יגדל דownwards ולצרף לנייר בצד הנכון 16. אחרי שלושה ימים של טיפול רשות הטבע והגנים, השתילים צריכים יצאו מהליבה עם לירות קטן, שורש יסודי ושורשי זרע 16. השורש העיקרי צריך להיות באורך של כ 2 סנטימטר לפני שתמשיך לאינדוקציה של ייזום שורש לרוחב. פרוטוקול זה פותח באמצעות הקו טהור תירס B73, אבל במקרה של קו תירס עם שיעור צמיחה שונה, להתאים את זמן הדגירה בהתאם. ודא שגלילי הנייר יישארו ספוגים באופן קבוע על ידי הוספת 50 מיקרומטר פתרון רט"ג כאשר הנוזל מתאדה לאורך זמן, אחרת טיפול רשות הטבע והגנים יכולים להיות פיתוח רוחב מוקדם לא יעיל ולא רצוי שורש יכול להתרחש. המערכת עצמה מונעת חשיפה של השורשים לאור, אבל אור הוא לא נושא מרכזי ולא משפיע על צמיחת שורש ואינדוקציה שורש לרוחב.

דרכים אלטרנטיביות לזירוז מבוקר של שורשים לרוחב הן השימוש בMEChanical כיפוף 23 או 24 gravistimulation. היתרון העיקרי של מערכות אלה הוא שיש להם השראה "טבעית" יותר בהשוואה לטיפולי הורמונים בLRIS, אבל החסרון הוא שהם מוגבלים בכמות החומר שניתן לקצור בנקודת זמן נתונה, כי הם רק להניב אירוע חניכת שורש לרוחב אחד בעיקול לשתיל בהשוואה לגיוס מלא של pericycle בLRIS.

LRIS משמש בארבידופסיס ותירס יכול לשמש במגוון רחב של צמחים, למרות תנאים נוחים צריכים להיות מותאמים. כדי להתקין LRIS, שני צעדים רצופים חשובים צריכים להיות מושגת: (1) חסימת תחבורת אוקסין ו( 2) ההצטברות של אוקסין לגרום לייזום שורש לרוחב. המערכת גדלה צריכה לאפשר לספיגה יעילה ואחידה של התרכובות וצריכה לאפשר התפתחות טובה של השתילים. מערכות אלטרנטיביות למדיום מוצק (ארבידופסיס) וגלילי נייר (תירס), כגון תרבות נוזלית, הידרופוניקה, או aeroponics, יכול לשמש למינים אחרים. השלב הראשון בLRIS, כלומר, החסימה של תחבורת אוקסין, יכול להיות מושגת על ידי הוספת מעכב תחבורת אוקסין. למרות שרשות הטבע והגנים מובילים לבלוק יעיל חניכה שורש לרוחב בארבידופסיס ותירס, עשויות תרכובות חלופיות כגון חומצת 2,3,5-triiodobenzoic (TIBA) או חומצת chlorophenoxyisobutyric p- (PCIB) לעבוד טוב יותר במינים אחרים. אופטימיזציה דומה ניתן לעשות עבור השלב השני של LRIS, כלומר, טיפול אוקסין. אוקסין NAA הסינתטי נראה המתאים ביותר לLRIS. מבשר אוקסין indol-3-butyric החומצה (רשות השידור) עשוי להיות חלופה טובה כפי שהוא גם חזק גורם שורשים לרוחב ויש לו פעילות ביולוגית גבוהה בצמחים שונים 25, 26. מצד השני, חומצת אינדול-3-אצטית אוקסין הטבעי (רשות העתיקות) היא פחות יציבה ויותר בקלות חילוף חומרים 27, הרציונליזציה ההשפעה החלשה שלה בdevel השורשopment בלמשל תירס או אורז 25, 26. חומצת 2,4-dichlorophenoxyacetic אוקסין הסינתטי (2,4D) מצטברת מאוד בתאי pericycle, באופן חלקי משום שהוא לא ייצא מהתאים 28, פוגע בייזום שורש לרוחב נכון וגרימה מלאכותית מבנים התמזגו. כמו כן תרכובות אחרות באינטראקציה עם מסלולי אוקסין, כגון naxillin 12, הוכחו לגרום לייזום שורש לרוחב בארבידופסיס וניתן לבדוק במינים אחרים.

במקרים מסוימים, נביטה היא לא יעילה בנוכחות של רשות הטבע והגנים ואחד יכול לבחור ראשון לנבוט זרעים בהעדר רשות הטבע והגנים, להעביר לאחר מכן את השתילים למערכת רט"ג המכילה. זה גורם סיכון אפשרי שיש primordia שורש לרוחב המוקדם יזם לפני גיוס שורש לרוחב עם טיפול NAA ו, ומכאן, חשוב לדגום את האזור של השורש שמוארך במהלך טיפול רשות הטבע והגנים בלבד. בעקבות אסטרטגיה כללית זו, sho אחדuld תוכל לייעל LRIS לכל צמח כמעט (זרע) וככזה יש לי מערכת קלה ללמוד פיתוח שורש לרוחב למפעל של עניין. אפיון נוסף של עיתוי ייזום שורש לרוחב יכול להתרחש באמצעות קווי סמן, כפי שהודגם לארבידופסיס. אם קווי סמן קשה להשיג, אפשר לעשות מחקר היסטולוגית מפורט, אבל זה גוזל זמן וחלוקות התא הראשונים הן לא קלה לזיהוי. לחלופין, ניתוח ביטוי של סמני חלוקת תא יכול לשמש כדי לציין את העיתוי של חלוקות התא הראשונות.

LRIS יכול לשמש למטרות שונות, כגון ניתוח transcriptome 9-13 כמתואר בקצרה בתוצאות, כמו גם תצפיות היסטולוגית ברמת מקרוסקופית והמיקרוסקופית בייזום שורש רוחב 14. סוגים שונים של דגימה, החל מאיבר לתא בקנה מידה 29, עשויים לאפשר התרת היבטים שונים של מאוחר יותרייזום שורש אל. בנוסף, LRIS ניתן להשתמש כדי לפקח על ההשפעה של תרכובות שונות בייזום לרוחב שורש 12, 30. לבסוף, על ידי שימוש בקווי כתב, יכול לשמש גם LRIS לאפיין בקלות את ביטוי הגנים ו / או לוקליזציה חלבון במהלך רוחב פיתוח שורש.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

יש המחברים אין לחשוף.

Materials

Name Company Catalog Number Comments
ARABIDOPSIS LRIS
Seeds
Arabidopsis seeds Col-0 ecotype
Gas sterilization of seeds
micro-centrifuge tubes 1.5 ml SIGMA-ALDRICH 0030 125.215 Eppendorf microtubes 3810X, PCR clean
micro-centrifuge tubes 2 ml SIGMA-ALDRICH 0030 120.094 Eppendorf Safe-Lock microcentrifuge tubes
hydrochloric acid Merck KGaA 1,003,171,000 37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu
glass desiccator SIGMA-ALDRICH Pyrex
glass beaker
plastic micro-centrifuge tubes box or holder
Bleach sterilization of seeds
ethanol Chem-Lab nv CL00.0505.1000 Ethanol, abs. 100% a.r. dilute to 70%
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
Tween 20 SIGMA-ALDRICH P1379
sterile water
Growth medium
Murashige and Skoog salt mixture DUCHEFA Biochemie B.V. M0221-0050
myo-inositol SIGMA-ALDRICH I5125-100G
2-(N-morpholino)ethanesulfonic acid (MES) DUCHEFA Biochemie B.V. M1503.0100
sucrose VWR, Internation LLC 27483.294 D(+)-Sucrose Ph. Eur.
KOH Merck KGaA 1050211000 pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur
Plant Tissue Culture Agar LabM Limited MC029
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 10 µM (Arabidopsis)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 10 µM (Arabidopsis)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Making a mesh for transfer
nylon mesh Prosep byba Synthetic nylon mesh 20 µm
Sowing and seedling handling
square petri dish plates GOSSELIN BP124-05 12 x 12 cm
50 ml DURAN tubes SIGMA-ALDRICH CLS430304 Corning 50 ml centrifuge tubes
drigalski Carl Roth K732.1
pipette
cut pipette tips Daslab 162001X Universal 200, cut off 5 mm of tip before autoclaving
breathable tape  3M Deutschland GmbH cat. no. 1530-1
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
Growth conditions
growth room 21 °C, continuous light
Materials Company Catalog Comments
MAIZE LRIS
Seeds
Maize kernels B-73
Bleach sterilization of kernels
glass beaker
magnetic stirrer  Fiers nv/sa C267.1
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
sterile water
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 50 µM (maize primary root), 25 µM (maize adventitious root)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 50 µM (maize)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Sowing and seedling handling
paper hand towels Kimberly-Clark Professional* 6681 SCOTT Hand Towels - Roll / White; sheet size (24 x 46 cm)
seed germination paper Anchor Paper Company 10 X 15 38# seed germination paper
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
250 ml (centrifuge) tubes SCHOTT DURAN 2160136 approx. 5.6 cm diameter and 14.7 cm height 
700 ml tubes DURAN GROUP 213994609 cylinders, round foot tube, D 60  x 250
rack for maize tubes, home made
sterile water
Growth conditions
growth cabinet 27 °C, continuous light, 70% relative humidity

DOWNLOAD MATERIALS LIST

References

  1. Van Norman, J. M., Xuan, W., Beeckman, T., Benfey, P. N. To branch or not to branch: the role of pre-patterning in lateral root formation. Development. 140, 4301-4310 (2013).
  2. Dolan, L., et al. Cellular organisation of the Arabidopsis thaliana root. Development. 119, 71-84 (1993).
  3. Bell, J. K., McCully, M. E. A histological study of lateral root initiation and development in Zea mays. Protoplasma. 70, 179-205 (1970).
  4. Benkova, E., et al. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell. 115, 591-602 (2003).
  5. Beeckman, T., Burssens, S., Inzé, D. The peri-cell-cycle in Arabidopsis. J. Exp. Bot. 52, 403-411 (2001).
  6. Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inzé, D., Beeckman, T. Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell. 14, 2339-2351 (2002).
  7. Jansen, L., Parizot, B., Beeckman, T. Inducible system for lateral roots in Arabidopsis thaliana and maize. Methods Mol Biol. 959, 149-158 (2013).
  8. Casimiro, I., et al. Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell. 13, 843-852 (2001).
  9. Himanen, K., et al. Transcript profiling of early lateral root initiation. Proc. Natl. Acad. Sci. USA. 101, 5146-5151 (2004).
  10. De Smet, I., et al. Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root. Science. 322, 594-597 (2008).
  11. Vanneste, S., et al. Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana. Plant Cell. 17, 3035-3050 (2005).
  12. De Rybel, B., et al. A role for the root cap in root branching revealed by the non-auxin probe naxillin. Nat. Chem. Biol. 8, 798-805 (2012).
  13. Jansen, L., et al. Comparative transcriptomics as a tool for the identification of root branching genes in maize. Plant Biotechnol. J. 11, 1092-1102 (2013).
  14. Parizot, B., et al. Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation. Plant Physiol. 146, 140-148 (2008).
  15. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 15, 473-497 (1962).
  16. Bellini, C., Pacurar, D. I., Perrone, I. Adventitious roots and lateral roots: similarities and differences. Annu Rev Plant Biol. 65, 639-666 (2014).
  17. Grunewald, W., Parizot, B., Inzé, D., Gheysen, G., Beeckman, T. Developmental biology of roots: One common pathway for all angiosperms? Int. J. Plant Dev. Biol. 1, 212-225 (2007).
  18. Parizot, B., Beeckman, T. Genomics of root development. Root Genomics and Soil Interactions. Crespi, M. 3-28 (2012).
  19. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. Journal of visualized experiments : JoVE. (2010).
  20. Nakazono, M., Qiu, F., Borsuk, L. A., Schnable, P. S. Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize. Plant Cell. 15, 583-596 (2003).
  21. Ludwig, Y., Hochholdinger, F. Laser microdissection of plant cells. Methods Mol Biol. 1080, 249-258 (2014).
  22. Beeckman, T., Engler, G. An easy technique for the clearing of histochemically stained plant tissue. Plant Mol. Biol. Rep. 12, 37-42 (1994).
  23. Ditengou, F. A., et al. Mechanical induction of lateral root initiation in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA. 105, 18818-18823 (2008).
  24. Lucas, M., Godin, C., Jay-Allemand, C., Laplaze, L. Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation. J. Exp. Bot. 59, 55-66 (2008).
  25. Wang, S., Taketa, S., Ichii, M., Xu, L., Xia, K., Zhou, X. Lateral root formation in rice (Oryza Sativa. L.): differential effects of indole-3-acetic acid and indole-3-butyric acid. Plant Growth Regul. 41, 41-47 (2003).
  26. Martinez-de la Cruz, E., Garcia-Ramirez, E., Vazquez-Ramos, J. M., Reyes de la Cruz, H., Lopez-Bucio, J. Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings. J Plant Physiol. 176, 147-156 (2015).
  27. Beyer, E. M., Morgan, P. W. Effect of ethylene on uptake, distribution, and metabolism of indoleacetic acid-1-14C and -2-14C and naphthaleneacetic acid-1-14C. Plant Physiol. 46, 157-162 (1970).
  28. Delbarre, A., Muller, P., Imhoff, V., Guern, J. Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta. 198, 532-541 (1996).
  29. Bailey-Serres, J. Microgenomics: genome-scale, cell-specific monitoring of multiple gene regulation tiers. Annu Rev Plant Biol. 64, 293-325 (2013).
  30. Perez-Torres, C. A., et al. Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor. Plant Cell. 20, 3258-3272 (2008).
מערכת עין מתנהל שורש לרוחב ב<em&gt; ארבידופסיס</em&gt; ותירס
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).More

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter