Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

में पार्श्व रूट inducible प्रणाली doi: 10.3791/53481 Published: January 14, 2016
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

यह मिट्टी से लंगर और पानी की तेज और पोषक तत्वों को सुनिश्चित करता है के बाद से जड़ प्रणाली, पौधों की वृद्धि के लिए महत्वपूर्ण है। एक रूट प्रणाली के विस्तार के लिए मुख्य रूप से पार्श्व जड़ों के उत्पादन पर निर्भर करता है, इसलिए उनकी दीक्षा और गठन के लिए व्यापक रूप से अध्ययन किया गया है। पार्श्व जड़ों संस्थापक कोशिकाओं 1 कहा जाता है, पेरिसाइकिल कोशिकाओं का एक विशिष्ट सबसेट में शुरू कर रहे हैं। इस तरह के मक्का के रूप में monocots में, वे फ्लोएम डंडे 3 में पाए जाते हैं, जबकि इस तरह के Arabidopsis thaliana के रूप में सबसे डाइकोटों, में, इन कोशिकाओं, protoxylem डंडे 2 पर स्थित हैं। संस्थापक कोशिकाओं विशेष सेल चक्र जीनों की अभिव्यक्ति के द्वारा पीछा किया, एक वृद्धि auxin प्रतिक्रिया 4 द्वारा चिह्नित कर रहे हैं (जैसे, cyclin बी 1, 1 / CYCB1; 1), जिसके बाद वे असममित अपनत डिवीजनों 5 के पहले दौर से गुजरना। समन्वित अपनत और periclinal डिवीजनों की एक श्रृंखला के बाद, एक पार्श्व जड़ उत्स के अंत में एक एक के रूप में उभरेगा कि गठन किया गया हैutonomous पार्श्व जड़। इन घटनाओं के प्रचुर मात्रा में है और न ही सिंक्रनाइज़ न रहे, क्योंकि स्थान और पार्श्व रूट दीक्षा के समय, हालांकि उम्मीद के मुताबिक नहीं हैं। इस तरह से इस प्रक्रिया का अध्ययन करने के transcriptomics के रूप में आणविक दृष्टिकोण के उपयोग में बाधा उत्पन्न करती।

इस से निपटने के लिए, एक पार्श्व रूट inducible प्रणाली (LRIS), 6 विकसित किया गया है 7। इस प्रणाली में, पौध पहले फलस्वरूप पार्श्व रूट दीक्षा अवरुद्ध, auxin परिवहन और संचय को रोकता है जो एन -1-naphthylphthalamic एसिड (एनपीए) के साथ व्यवहार कर रहे हैं 8। बाद में सिंथेटिक auxin 1-नेफ़थलीन एसिटिक एसिड (NAA) से युक्त मध्यम करने के अंकुर स्थानांतरित करके, पूरे पेरिसाइकिल परत है, जिससे बड़े पैमाने पर ऊंचा auxin स्तरों उत्प्रेरण पार्श्व रूट की शुरुआत कोशिका विभाजन 6 का जवाब। जैसे, इस प्रणाली देर की एक विशिष्ट चरण के लिए समृद्ध जड़ नमूनों की आसान संग्रह की अनुमति, तेजी से तुल्यकालिक और व्यापक पार्श्व जड़ों पहल करने के लिए सुरागRAL जड़ विकास। बाद में, इन नमूनों पार्श्व रूट गठन के दौरान जीनोम चौड़ा अभिव्यक्ति प्रोफाइल निर्धारित करने के लिए इस्तेमाल किया जा सकता है। LRIS अन्य पौधों की प्रजातियों के लिए इस प्रणाली को लागू करने के पार्श्व रूट एराबिडोप्सिस में दीक्षा और मक्का 9-13, लेकिन जरूरत के बारे में पहले से ही महत्वपूर्ण ज्ञान प्राप्त हुए है और अधिक जीनोम अनुक्रम कर रहे हैं के रूप में अधिक स्पष्ट हो जाता है और किफायती महत्वपूर्ण करने के लिए ज्ञान के हस्तांतरण के लिए एक बढ़ती रुचि है प्रजातियों।

इधर, एराबिडोप्सिस और मक्का LRISs की विस्तृत प्रोटोकॉल दिया जाता है। इसके बाद, इस प्रणाली के उपयोग का एक उदाहरण मक्का LRIS से प्राप्त transcriptomics डेटा विभिन्न प्रजातियों के पौधे भर में पार्श्व रूट दीक्षा के दौरान एक संरक्षित समारोह है कि कार्यात्मक homologs की पहचान करने के लिए इस्तेमाल किया जा सकता है कि कैसे illustrating द्वारा प्रदान की जाती है। अन्य पौधों की प्रजातियों का प्रस्ताव कर रहे हैं के लिए अंत में, दिशा निर्देशों LRIS अनुकूलन करने के लिए।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. एराबिडोप्सिस LRIS प्रोटोकॉल

नोट: पाठ "छोटे" या "बड़े" पैमाने पर प्रयोग करने के लिए संदर्भित करता है। ऐसे मार्कर लाइन विश्लेषण और histological धुंधला 6, 14 के रूप में छोटे पैमाने पर प्रयोग, केवल कुछ नमूने की आवश्यकता है। ऐसे मात्रात्मक वास्तविक समय QRT- पीसीआर, माइक्रो-सरणियों 9-11 या आरएनए अनुक्रमण के रूप में बड़े पैमाने पर प्रयोग, नमूनों की एक बड़ी राशि की आवश्यकता है। जैसे, नमूना 1000 प्रति पौध Vanneste एट अल द्वारा इस्तेमाल किया गया था ~ की। 11 एक राशि जड़ खंड विच्छेदन के बाद माइक्रोएरे प्रयोग करने के लिए।

पहला दिन

  1. Arabidopsis बीज का बंध्याकरण
    नोट: बीज नसबंदी के लिए निम्नलिखित प्रक्रियाओं में से एक का चयन करें। उनमें से किसी भी प्रोटोकॉल के अगले कदम के लिए उपयुक्त है। गैस नसबंदी (1.1.2) तरल नसबंदी (1.1.1) पर दो मुख्य लाभ प्रस्तुत करता है: एक बड़े सुन्न से निपटने जब यह कम समय लगता हैबीज के एर, कोई pipetting व्यक्ति के नमूनों के लिए हो गया है के बाद; और निष्फल बीज एक लंबी अवधि के लिए भंडारित किया जा सकता है। हालांकि, यह एक desiccator और सावधानी से निपटने की आवश्यकता है।
    1. तरल नसबंदी
      1. सूक्ष्म अपकेंद्रित्र ट्यूब में बीज की वांछित संख्या डालो। एक 2 मिलीलीटर सूक्ष्म अपकेंद्रित्र ट्यूब में एक 1.5 मिलीलीटर ट्यूब में 20 मिलीग्राम (~ 800 बीज) या 40 मिलीग्राम (~ 1600 बीज) का प्रयोग करें।
      2. 70% इथेनॉल के 1 मिलीलीटर जोड़ें। पलटना या धीरे 2 मिनट के लिए हिला।
      3. 15 मिनट के लिए 1 मिलीलीटर नसबंदी समाधान के साथ 70% इथेनॉल बदलें। (ताजा नसबंदी समाधान तैयार: 3.85 मिलीग्राम सोडियम हाइपोक्लोराइट (NaOCl) शेयर (12%) (चेतावनी: का प्रयोग करें,) हुड धूआं 5 μl बीच 20, पानी के साथ 10 मिलीलीटर तक सभी बीज आया है कि यह सुनिश्चित करना नलियों कई बार पलटना। समाधान के साथ संपर्क में है।
      4. दोहराया द्वारा एक लामिना हवा का प्रवाह कैबिनेट में 5 मिनट के लिए बीज 5 बार 1 मिलीलीटर बाँझ आसुत जल से नसबंदी समाधान की जगह और कुल्लाLy ताजा बाँझ आसुत जल के 1 मिलीलीटर के साथ की जगह ले।
    2. गैस नसबंदी
      1. एक 2 मिलीलीटर सूक्ष्म अपकेंद्रित्र ट्यूब में बीज की वांछित संख्या डालो। कई स्वतंत्र लाइनों के साथ कार्य करते समय व्यक्ति ट्यूब का उपयोग करें, और उन्हें एक प्लास्टिक के सूक्ष्म अपकेंद्रित्र ट्यूब बॉक्स या धारक में खोला व्यवस्था। एक ट्यूब में बीज की संख्या 500 (12.5 मिलीग्राम) से अधिक है, सफल नसबंदी सुनिश्चित करने के लिए ट्यूब की उपयुक्त संख्या में बीज प्रतिभाग। पड़ोसी ट्यूब की टोपी एक दूसरे को कवर नहीं है सुनिश्चित करें। यह नसबंदी के लिए के रूप में अच्छी तरह से desiccator में होने की जरूरत है, के रूप में तल पर बॉक्स के ढक्कन एक साथ फिट।
      2. एक गिलास बीकर के साथ-साथ एक desiccator की कटोरी में बॉक्स प्लेस (चेतावनी: उपयोग हुड धूआं)।
      3. (: उपयोग धूआं हुड चेतावनी) 12% NaOCl के 100 मिलीलीटर के साथ बीकर भरें। Desiccator पर ढक्कन लगा, लेकिन बीकर रखा गया है, जहां एक छोटा सा छेद छोड़ दें।
      4. (CAU 37% हाइड्रोक्लोरिक एसिड (नाराज) के 3 मिलीलीटर जोड़ेंTION: उपयोग छोटा सा छेद के माध्यम से बीकर हुड) धूआं और जल्दी से desiccator बंद करें। सीएल के लिए 2 -gas गठन की वजह से कुछ समय के लिए समाधान इच्छा बुलबुला। सिस्टम को हे / एन (या कम से कम 8 घंटे) बंद हुआ।
      5. Desiccator के ढक्कन निकालें। बॉक्स के बाहर ले लो और परिवहन के दौरान संक्रमण से बचने के ढक्कन के साथ कवर।
      6. एक लामिना हवा का प्रवाह कैबिनेट में बॉक्स डाल ढक्कन हटाने और गैस रिलीज की अनुमति के लिए आरटी पर लगभग 1 घंटे के लिए बीज छोड़ दें।
        नोट: बीज को सुरक्षित रूप से 4 डिग्री सेल्सियस पर 2 सप्ताह के लिए बंद कर दिया सूक्ष्म अपकेंद्रित्र ट्यूब में सूखी संग्रहित किया जा सकता है।
  2. एराबिडोप्सिस में पार्श्व रूट प्रेरण
    1. पार्श्व रूट निषेध (एनपीए उपचार)
      1. इन विट्रो विकास के लिए विकास के माध्यम से तैयार करें। मध्यम आधा ताकत Murashige और Skoog नमक के मिश्रण 15, 0.1 ग्राम / एल म्यो-inositol, 10 ग्राम / एल सुक्रोज होता है, और 0.5 के साथ buffered हैजी / एल 2- (एन morpholino) ethanesulfonic एसिड (एमईएस)।
      2. 1 एम KOH के साथ 5.7 पीएच को समायोजित करें। संयंत्र के ऊतकों अगर की 8 ग्राम / एल जोड़ें और 121 डिग्री सेल्सियस पर 20 मिनट के लिए मध्यम आटोक्लेव।
      3. Dimethylsulfoxide में (DMSO) (: उपयोग दस्ताने चेतावनी) एनपीए की एक 25 मिमी शेयर समाधान तैयार है। एक लामिना हवा का प्रवाह कैबिनेट में, (बोतल हाथ से आयोजित किया जा सकता है, जिस पर तापमान है) लगभग 65 डिग्री सेल्सियस तक नीचे autoclaved मध्यम शांत, और 10 माइक्रोन एनपीए के अंतिम एकाग्रता प्राप्त करने के लिए 25 मिमी एनपीए शेयर समाधान जोड़ें।
      4. धीरे 10 सेकंड के लिए बोतल झटकों से अलावा पर Homogenize। वर्ग पेट्री डिश प्रति माध्यम के 50 एमएल (12 सेमी x 12 सेमी) डालो।
        नोट: बड़े पैमाने पर प्रयोग के मामले में, आसान हस्तांतरण सुनिश्चित करने के लिए एक नायलॉन जाल (20 माइक्रोन) लागू होते हैं। वाष्पदावी (चित्रा 1 ए) के लिए एक जाल (9 सेमी एक्स 9 सेमी) तैयार करें। Autoclaved जब, बाँझ चिमटी (चित्रा 1 बी) का उपयोग मध्यम विकास के लिए जाल लागू होते हैं। धीरे एक काएं का उपयोग कर मध्यम विकास के लिए जाल धक्का(: बाँझ परिस्थितियों में काम सावधानी) यह मध्यम विकास (चित्रा 1 बी) के साथ अच्छे संपर्क में है सुनिश्चित करने के drigalsky rilized।
      5. एनपीए-प्लेटों पर बीज बोना।
        मामले में एक बड़े पैमाने पर प्रयोग की योजना बनाई है (1.2.2.3 देखें) नमूने की सुविधा के लिए 50 बीज के 2 घने और अच्छी तरह से गठबंधन पंक्तियों बोना: ध्यान दें।
        1. तरल नसबंदी के मामले में, एक 200 μl pipet का उपयोग एनपीए-प्लेटों पर बीज बोना। 3 काट - क्रम में बाँझ शर्तों (या सुझावों की नसबंदी से पहले) में pipetting के सुझावों का अंत 4 मिमी बीज pipet करने में सक्षम हो। Pipet और बीज फिर से निलंबित करने के लिए समय की एक जोड़ी नीचे है, तो 10 के साथ लगभग 150 μl बाँझ पानी pipet - 20 बीज और टिप के तल पर बीज तलछट तक इंतजार। (चेतावनी: बाँझ परिस्थितियों में काम)
          नोट: टिप के साथ धीरे अगर या जाल छू जब एक बीज के साथ पानी की एक बूंद यह (चित्रा 1 सी) से जारी किया जाएगा।
        2. <गैस नसबंदी के मामले में li> एक चिपचिपा सतह सुनिश्चित करने के लिए बीज लेने से पहले autoclaved toothpicks.Pinch अगर में दंर्तखोदनी का उपयोग कर बीज बोना। दंर्तखोदनी का उपयोग करते हुए एक-एक करके बीज एक उठाओ और प्लेट (चित्रा -1) पर बीज वितरित। (: बाँझ परिस्थितियों में काम सावधानी) वैकल्पिक रूप से, बीज के लिए बाँझ पानी जोड़ने के लिए, और 1.2.1.5.1 में वर्णित के रूप में बोते हैं।
      6. सांस चिपकने वाला टेप के साथ प्लेटों को सील करने और कम से कम 2 दिन और अधिकतम एक सप्ताह के लिए अंधेरे में 4 डिग्री सेल्सियस पर उन्हें प्लेटों की दुकान। इस स्तरीकरण और सिंक्रनाइज़ सुनिश्चित करता है और अधिक कुशल अंकुरण के लिए आवश्यक है।
        नोट: वैकल्पिक, बीज, बुवाई से पहले स्तरीकृत कम रेफ्रिजरेटर अंतरिक्ष की आवश्यकता है जो सूक्ष्म अपकेंद्रित्र ट्यूब, में आसुत जल में डूब जा सकता है। इस मामले में, 4 डिग्री सेल्सियस पर कम से कम एक सप्ताह के लिए ट्यूब की दुकान, और तुरंत (1.2.1.7 देखें) बुवाई के बाद विकास कैबिनेट को प्लेटों के लिए कदम।
        तीसरा दिन विकास कैबिनेट को प्लेटें चाल (निरंतर प्रकाश (110 μE मीटर -2 एस -1), 21 डिग्री सेल्सियस) लगभग एक ऊर्ध्वाधर स्थिति में 5 दिन (अंकुरण के 2 दिन और विकास के 3 दिन) के लिए (80-90 डिग्री) मध्यम में रूट पर विकास, और नहीं सुनिश्चित करने के लिए।
        8 दिन
    2. पार्श्व रूट प्रेरण (NAA उपचार)
      1. 1.2.1.1 और 1.2.1.2 में वर्णित के रूप में ही विकास के माध्यम से तैयार। (: उपयोग दस्ताने चेतावनी) DMSO में NAA के एक 50 मिमी स्टॉक समाधान तैयार है। नीचे 65 डिग्री सेल्सियस के लिए autoclaved मध्यम कूल और 10 माइक्रोन NAA के अंतिम एकाग्रता प्राप्त करने के लिए माध्यम के लिए NAA समाधान जोड़ने (चेतावनी: बाँझ परिस्थितियों में काम)।
        1. धीरे 10 सेकंड के लिए बोतल झटकों से अलावा पर Homogenize। वर्ग पेट्री डिश प्रति माध्यम के 50 एमएल (12 सेमी x 12 सेमी) डालो।
      2. उन समर्थन करने के लिए 10 माइक्रोन एनपीए के साथ पूरक मध्यम विकास युक्त प्लेटों से पौध स्थानांतरण10 माइक्रोन NAA साथ plemented।
        1. अंकुर की बीजपत्र तहत घुमावदार चिमटी की बाहों मिला और धीरे थाली से हटा दें। केवल जड़ों पूरी तरह अधिमानतः नीचे की ओर एनपीए-मध्यम विकास और के साथ संपर्क में हो गए हैं, जिनमें से पौध हस्तांतरण।
        2. एक छोटी सी दूरी पर NAA युक्त मध्यम विकास सतह पर जड़ स्किम। पौधे की जड़ों मध्यम विकास के साथ अच्छे संपर्क में हैं कि सुनिश्चित करें। यदि आवश्यक हो, चिमटी के साथ मध्यम विकास की सतह के लिए धीरे जड़ दबाएँ।
          नोट: एक बड़े पैमाने पर प्रयोग के मामले में, चिमटी के साथ दो ऊपरी कोने पर जाल उठाने के द्वारा जाली और हस्तांतरण के साथ संपर्क में नहीं हैं कि सभी पौध को हटा दें। यकीन जाल एक छोटी सी दूरी (चित्रा 1E) पर अगर सतह के ऊपर जाल उड़े द्वारा NAA युक्त मध्यम के साथ अच्छे संपर्क में है।
      3. सांस टेप के साथ नई प्लेटों को सील करने और (विकास कैबिनेट में चोर उन्हें जगहtinuous प्रकाश नमूना तक शामिल होने के बाद वांछित समय के लिए एक ऊर्ध्वाधर स्थिति में (110 μE मीटर -2 एस -1), 21 डिग्री सेल्सियस)।
        नोट: एक बड़े पैमाने पर प्रयोग के मामले में, जाल पर सभी को एक बार सीधे जड़ खंडों में कटौती और धीरे जाल की सतह scraping द्वारा उन्हें नमूने के लिए एक छुरी का उपयोग करें।

2. LRIS मक्का प्रोटोकॉल

  1. मक्का गुठली का स्तरीकरण
    1. कम से कम 1 सप्ताह के लिए अंधेरे में 4 डिग्री सेल्सियस पर मक्का गुठली सेते हैं।
      नोट: इस प्रोटोकॉल B73 मक्का जन्मजात लाइन का उपयोग कर विकसित किया गया है।
  2. मक्का गुठली का बंध्याकरण
    पहला दिन
    नोट: मक्का पौध बाँझ परिस्थितियों में विकसित किया जा करने के लिए नहीं है, यह पेपर रोल में कवक विकास को रोकने के लिए मक्का गुठली बाँझ और बाँझ सामग्री के साथ काम करने के लिए सिफारिश की हैप्रणाली।
    1. एक निष्फल गिलास बीकर में मक्का गुठली की आवश्यक संख्या में रखो।
    2. (पानी में 6% NaOCl) नसबंदी समाधान (: उपयोग धूआं हुड चेतावनी) के 100 मिलीलीटर जोड़ें।
    3. एक चुंबकीय हलचल बार जोड़ें और 5 मिनट के लिए आरटी पर कम सरगर्मी गति (लगभग 250 आरपीएम) पर एक चुंबकीय दोषी पर बीकर जगह है।
    4. ताजा बाँझ पानी की 100 मिलीलीटर के साथ समाधान की जगह से 5 मिनट के लिए पांच बार कुल्ला।
  3. मक्का गुठली बुवाई
    1. संक्रमण के जोखिम को कम करने, और कागज तौलिए का एक रोल लेने के लिए दस्ताने पर रखो।
    2. दो चादरें (लगभग 92 सेमी x 24 सेमी) की कुल लंबाई के साथ हाथ तौलिया कागज के दो हिस्सों फाड़ और एक साफ सतह (2A चित्रा) पर एक दूसरे के शीर्ष पर उन्हें जगह है।
    3. शीट लंबाई (लगभग 92 सेमी x 12 सेमी) (2A चित्रा) पर डबल गुना।
    4. टी पर ऊपर से लगभग 2 सेमी से कम 10 गुठली वितरित करने के लिए चिमटी का प्रयोग करेंवह कागज की पूरी लंबाई, दोनों सिरों (चित्रा 2 बी) पर मुफ्त प्रत्येक गिरी और 8 सेमी के बीच 8 सेमी की एक अन्तराल रखते हुए। गिरी की रूटलेट नीचे और कागज (चित्रा 2 बी) की ओर का सामना करना पड़ रहा है सुनिश्चित करें।
    5. बीज प्लेस में (चित्रा 2 बी) रखते हुए धीरे, लंबाई पर पेपर रोल। रोलिंग की सुविधा के लिए, यह पहली बार बाँझ पानी के साथ स्प्रे के कागज के लिए वैकल्पिक है।
    6. लगभग 6 सेमी व्यास और 14 सेमी ऊंचाई (जैसे, 250 मिलीलीटर अपकेंद्रित्र ट्यूब) के निष्फल ग्लास ट्यूब में पेपर रोल रखो और एक रैक (चित्रा -2) में उन्हें जगह है।
  4. मक्का में पार्श्व रूट प्रेरण
    1. (DMSO में भंग) एक 50 मिमी एनपीए शेयर समाधान (: उपयोग दस्ताने चेतावनी) तैयार करें।
    2. प्रत्येक ट्यूब के लिए, एक निष्फल गिलास बीकर में 125 मिलीलीटर बाँझ पानी के लिए 50 मिमी एनपीए शेयर समाधान से 125 μl जोड़कर एक 50 माइक्रोन एनपीए समाधान करें।
    3. अच्छी तरह मिक्स औरट्यूब में पेपर रोल पर 50 माइक्रोन के एनपीए समाधान की 125 मिलीलीटर डालना। पेपर रोल समाधान को अवशोषित और पूरी तरह से लथपथ हो जाएगा।
      नोट: अन्य आयामों के साथ पेपर रोल और ट्यूबों का उपयोग करते समय, तदनुसार मात्रा समायोजित करें। तरल पर्याप्त तेज सुनिश्चित करने के लिए आधे रास्ते ट्यूब तक पहुंच जाना चाहिए।
    4. तीन दिन (27 डिग्री सेल्सियस, निरंतर प्रकाश, 70% सापेक्ष आर्द्रता) के लिए एक विकास कैबिनेट में पेपर रोल सिस्टम रखें। समाधान समय (चित्रा 2 डी) से अधिक का वाष्पीकरण के बाद पेपर रोल, अतिरिक्त 50 माइक्रोन एनपीए समाधान जोड़कर लथपथ रहते हैं कि सुनिश्चित करें।
      4 दिन
    5. (DMSO में भंग) एक 50 मिमी NAA शेयर समाधान (: उपयोग दस्ताने चेतावनी) तैयार करें।
    6. प्रत्येक ट्यूब के लिए, एक निष्फल गिलास बीकर में 125 मिलीलीटर बाँझ पानी के लिए 50 मिमी NAA शेयर से 125 μl जोड़कर एक 50 माइक्रोन NAA समाधान तैयार है।
    7. धीरे पेपर रोल से शेष एनपीए समाधान का सबसे बाहर निकल जाती है और जगह5 मिनट के लिए बाँझ पानी में मीटर (: उपयोग दस्ताने चेतावनी) इसे बाहर धोने के लिए। धीरे पेपर रोल से पानी की सबसे बाहर निचोड़। इस धोने कदम तीन बार दोहराएँ।
    8. अच्छी तरह मिक्स और ट्यूबों में पेपर रोल पर 50 माइक्रोन NAA समाधान डालना। वे पूरी तरह से भिगो कर रहे हैं सुनिश्चित करें।
    9. शामिल होने के बाद वांछित अवधि के लिए विकास कैबिनेट (27 डिग्री सेल्सियस, निरंतर प्रकाश, 70% सापेक्ष आर्द्रता) में पेपर रोल सिस्टम रखें।
  5. मक्का की आकस्मिक क्राउन जड़ें में पार्श्व रूट प्रेरण
    नोट: LRIS प्राथमिक जड़ में पार्श्व जड़ों लाती ऊपर वर्णित है। हालांकि, मक्का और साथ में अपने पार्श्व जड़ों के साथ अन्य monocotyledons, प्राथमिक जड़ और भ्रूण मौलिक जड़ों में, विकास अंकुर के दौरान मुख्य रूप से महत्वपूर्ण हैं। पौधों की वृद्धि में एक बाद में मंच पर, पोस्ट-भ्रूण आकस्मिक जड़ों स्टेम पर पैदा होती है और यह भी एक नया रूट प्रणाली 16 फार्म के लिए पार्श्व जड़ों का विकास। LRIS भी उपयोग किया जा सकता हैडी भ्रूण प्राथमिक रूट पर LRIS के लिए कुछ मामूली समायोजन का पालन करते हुए इन पोस्ट-भ्रूण आकस्मिक मुकुट जड़ों पर पार्श्व जड़ों प्रेरित करने के लिए।
    1. पेपर रोल बनाने के लिए, बाहर की ओर हाथ तौलिया कागज के क्रमश: दो परतों, और भीतर अंकुरण कागज के दो परतों के साथ कागज के एक सैंडविच बनाने के लिए। अंकुरण कागज के दो चादरें के बीच में निष्फल गुठली (कदम 2.1-2.2 देखें) रखें। अंकुरण पेपर, हाथ तौलिया कागज की तुलना में, कागज के उद्घाटन के अवसर पर बाद में आसान रोल करना होगा जो जड़ बाल और पार्श्व जड़ों, द्वारा प्रवेश किया कम होने का खतरा हो जाएगा। दूसरी ओर, हाथ तौलिया कागज के दो बाहरी परतों तरल के अवशोषण की सुविधा होगी।
    2. 700 मिलीलीटर ग्लास ट्यूब में रोल डालें और उन पर एनपीए बिना बाँझ पानी डालना। वे पूरी तरह से भिगो कर रहे हैं सुनिश्चित करें।
    3. विकास कैबिनेट में निष्फल गुठली उगना (कदम 2.4.9 देखें)।
    4. आकस्मिक मुकुट जड़ों तक बीज बोने(B73 के लिए 6 दिन) उभरने के लिए शुरू करते हैं। पेपर रोल जब आवश्यक बाँझ पानी जोड़कर हर समय गीला रखा जाता है सुनिश्चित करें।
    5. एक कपड़े धोने कदम के बाद एक 50 माइक्रोन NAA समाधान के साथ एनपीए समाधान की जगह से पार्श्व रूट दीक्षा का एक समान प्रेरण द्वारा पीछा 4 दिन (कदम 2.4.4 के लिए 2.4.1 देखें) के लिए एक 25 माइक्रोन के एनपीए समाधान, पर स्थानांतरण (2.4 कदम देखना 2.4.9 करने के लिए 0.5)।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

LRIS के आवेदन पार्श्व रूट दीक्षा प्रक्रिया का तुलनात्मक transcriptomics प्रदर्शन करने के लिए

LRIS से एक आवेदन विभिन्न प्रजातियों में पार्श्व रूट गठन के दौरान तुलना और जीन की अभिव्यक्ति प्रोफाइल के सहसंबंध है। तुलनात्मक transcriptomics विभिन्न प्रजातियों में पार्श्व रूट विकास प्रक्रिया में शामिल orthologous जीन इंगित करने के लिए संभावना बनाने के दृष्टिकोण। एक पहले से ही गठित जड़ अक्ष में निहित कोशिकाओं के एक सबसेट से एक नया अंग के गठन के होते हैं जो पार्श्व रूट दीक्षा, उनकी जड़ वास्तुकला नियंत्रित करने के लिए वनस्पतियों द्वारा साझा प्रमुख तंत्र है। नतीजतन, यह है कि यह एक आम पूर्वज में मौजूद मौजूदा रास्ते से विकसित और विकास भर संरक्षित किया गया है कि बहुत संभावना है। दरअसल, पार्श्व रूट दीक्षा के आम संभावित नियामकों विभिन्न प्रजातियों में पाया गया है <समर्थन> 17, 18।

एराबिडोप्सिस और मक्का में LRIS का उपयोग कर सैम्पलिंग सामग्री, और Transcriptome विश्लेषण

के रूप में, दोनों प्रजातियों में, यह सिर्फ NAA इलाज से पहले पौधों के नमूने के लिए निर्णय लिया गया एराबिडोप्सिस और मक्का 10, 13, और शीघ्र ही शामिल होने के बाद, की शुरुआत में, या auxin प्रतिक्रिया के दौरान:। LRIS दो अलग अलग प्रजातियों में स्थापित किया गया है अच्छी तरह से की शुरुआत में के रूप में, या पेरिसाइकिल में पहली डिवीजनों के दौरान। इसके अलावा, प्रतिदीप्ति 19 छंटनी (FACS) सेल सक्रिय पेरिसाइकिल कोशिकाओं के लिए चयन करने के लिए एराबिडोप्सिस या मक्का में लेजर कैद माइक्रोस्कोपी 20, 21 (एलसीएम) में इस्तेमाल किया गया था। एराबिडोप्सिस में शामिल होने के बाद 2 और 6 घंटे की समय अंक चुना ट्रांसक्रिप्शनल pDR5 के लक्षण वर्णन :: गस auxin प्रतिक्रिया और pCYCB1 पर आधारित थे; 1 :: गस सेल चक्र मार्कर लाइनों 9 (चित्रा 3)। मक्का में, समय 2, 3 और शामिल होने के बाद 4 घंटा बताते हैं, सूक्ष्म कोशिकाओं के विभाजन गतिविधि के लक्षण और वास्तविक समय मात्रात्मक रिवर्स प्रतिलेखन पोलीमरेज़ चेन रिएक्शन (QRT- पीसीआर) 13 का उपयोग कर कई सेल चक्र मार्कर जीन अभिव्यक्ति के विश्लेषण के बाद चयन किया गया था । आरएनए अलग कक्षों से निकाला और पहले 10, 13 के रूप में वर्णित माइक्रोएरे प्लेटफार्मों पर संकरित किया गया था।

एराबिडोप्सिस CYCB1 की ortholog ढूँढना; 1 (AtCYCB1; 1) मक्का में

एराबिडोप्सिस, मार्कर लाइन pCYCB1 में, 1 :: गस व्यापक रूप से पार्श्व रूट दीक्षा के दौरान पेरिसाइकिल के पहले डिवीजनों को ट्रैक करने के लिए इस्तेमाल किया गया है। इस तरह के मार्कर बहुत होगामक्का में उपयोगी है। AtCYCB1 के कई homologs, 1 मक्का (www.maizesequence.org, सभी पेप्टाइड्स, BLASTP, डिफ़ॉल्ट सेटिंग) में पाए गए। उनमें से छह मक्का में LRIS के बाद किया माइक्रोएरे पर मौजूद थे और महत्वपूर्ण संवर्धन दिखाया। 1 (चित्रा 4), सबसे अच्छा बम विस्फोट हिट, GRMZM2G310115, AtCYCB1 के लिए एराबिडोप्सिस में मनाया गया था कि क्या करने के लिए इसी तरह की LRIS के बाद बहुत उच्च प्रतिलेखन स्तर, पता चला है।

LRIS के आवेदन व्यक्तिगत जीन एक्सप्रेशन चेक करने के लिए

AtCYCB1 का एक अच्छा उम्मीदवार ortholog रूप GRMZM2G310115 मान्य करने के लिए, 1 मक्का पार्श्व रूट दीक्षा, एक LRIS 13 के दौरान प्रदर्शन किया गया था अलग समय बिंदुओं पर लिए गए नमूनों पर एक वास्तविक समय QRT- पीसीआर में। एन से पहले: उपर्युक्त प्रोटोकॉल में वर्णित है और अलग अलग समय बिंदुओं पर काटा रूप में पौधे इलाज किया गयाए.ए. उपचार (एनपीए), और NAA उपचार के 2, 3 और 4 घंटे के बाद। इसके अलावा, केवल पानी में बड़े पौधों की सामग्री LRIS और तटस्थ स्थिति के बीच जीन अभिव्यक्ति की तुलना करने के लिए काटा गया था। कटाई के तुरंत बाद, जड़ खंडों 5 मिमी और जड़ टिप ऊपर 15 मिमी दूरबीन के तहत विच्छेदित कर रहे थे के बीच शामिल एक क्षेत्र के लिए इसी। चिमटी का प्रयोग, कोर्टेक्स दस्ता (पेरिसाइकिल शामिल है) से अलग हो गया था, और आरएनए दोनों ऊतकों से निकाला गया था। यह सत्यापन के लिए बहुत तेजी से और सस्ता पड़ता है क्योंकि यह अंतिम कदम है, बजाय एलसीएम का प्रदर्शन किया गया था। निम्नलिखित संबंधित आगे का प्रयोग और रिवर्स QRT- पीसीआर प्राइमरों, AGCAGGACGCAGTTGGAGAG और GAGCCGAGAGCACAGAAGAAAG, GRMZM2G310115 अप विनियमित LRIS पर हो, और दस्ता ऊतकों (चित्रा 5) के लिए विशिष्ट होना मान्य किया गया था। साथ ही, इस प्रयोग तुल्यकालिक प्रेरण के बिना, पानी में बढ़ती जड़ में क्या हो रहा पार्श्व रूट दीक्षा के असतत घटनाओं पता लगाने योग्य नहीं हैं कि पता चलता है, और पार्श्व रूट दीक्षा की प्रक्रिया से संबंधित अंतर जीन अभिव्यक्ति प्रकट करने के LRIS की जरूरत को दर्शाते हैं।

आकृति 1
चित्रा 1. एराबिडोप्सिस के लिए पार्श्व रूट inducible प्रणाली (एक) नायलॉन जाल (20 माइक्रोन) तैयार कर रहा है:।, नायलॉन जाल (9 सेमी से 9 सेमी) में कटौती एल्यूमीनियम पन्नी में लपेट और वाष्पदावी के लिए एक गिलास बीकर में डाल दिया। (बी) चिमटी का उपयोग कर एक एनपीए युक्त प्लेट (10 माइक्रोन) पर नायलॉन जाल लागू करें। फिर हवा के बुलबुले को खत्म करने के क्रम में एक बाँझ drigalski का उपयोग करें। नायलॉन पर (सी) बुवाई बीज एक pipet का उपयोग जाल। नायलॉन पर (डी) बुवाई बीज एक दंर्तखोदनी का उपयोग कर जाल। (ई) नायलॉन चिमटी का उपयोग कर एक NAA युक्त प्लेट (10 माइक्रोन) के लिए जाल स्थानांतरण।81 / 53481fig1large.jpg "लक्ष्य =" _blank "> यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
चित्रा 2. मक्का के लिए पार्श्व रूट inducible प्रणाली।   जगह कागज की दो परतों (92 सेमी x 24 सेमी, दो चादरें की लंबाई) एक दूसरे के शीर्ष पर हैं और उन्हें लंबाई में दोगुनी (92 सेमी x 12 सेमी) गुना: (ए) पेपर रोल तैयार कर रहा है। (बी) रूटलेट 8 सेमी की एक interspacing के साथ ऊपर से 2 सेमी में कागज पर नीचे का सामना करना पड़ के साथ 10 निष्फल मक्का गुठली रखो। जगह में मक्का गुठली रखते हुए फिर कागज रोल। (सी) नलियों में पेपर रोल (जैसे, 250 मिलीलीटर अपकेंद्रित्र ट्यूब) की जगह और एक रैक में डाल दिया। (डी) 27 डिग्री सेल्सियस, निरंतर प्रकाश, रिश्तेदार Humi में एक 50 माइक्रोन के एनपीए समाधान (में तीन दिनों के लिए मक्का का बीज बोनेdity 70%)। (ई) वाम: सिर्फ NAA लिए स्थानांतरण से पहले अंकुर; मध्य: बस NAA करने के लिए स्थानांतरण और NAA करने के लिए स्थानांतरण के बाद 2 दिन पहले microtome आड़ा वर्गों; अधिकार:। 5 दिनों NAA करने के लिए स्थानांतरण के बाद दिखाई उभरा पार्श्व जड़ों के साथ अंकुर यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र तीन
चित्रा 3. पार्श्व रूट दीक्षा pDR5 :: गस मार्कर लाइन का उपयोग कर एक NAA उपचार के दौरान auxin प्रतिक्रिया दिखा लम्बे समय तक NAA उपचार। (वायुसेना) टाइम कोर्स करने पर प्रेरित है। पार्श्व रूट दीक्षा ट्रिगर पहले की घटनाओं में से एक है जो auxin प्रतिक्रिया, NAA उपचार की शुरुआत के बाद 2 घंटा शुरू होता है। ऊपरी पैनल में, पूरे अंकुर के एक सिंहावलोकन दिया जाता है; कम पैनल शोजड़ टिप में auxin प्रतिक्रिया है। PCYCB1 का उपयोग कर एक NAA उपचार की (जीएम) समय बेशक, 1 :: गस मार्कर लाइन। गस संकेत CYCB1 की अभिव्यक्ति का प्रतिनिधित्व करता है, 1 जीन, पार्श्व जड़ गठन के लिए अग्रणी पहली कोशिका विभाजन NAA उपचार की शुरुआत के बाद 6 घंटे के शुरू यह दर्शाता है कि। ऊपरी पैनल में, पूरे अंकुर के एक सिंहावलोकन दिया जाता है; कम पैनल CYCB1 पता चलता है;। (Beeckman और Engler, 1994 22 के अनुसार गस धुंधला) जड़ टिप में एक अभिव्यक्ति यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 4
LRIS दौरान एराबिडोप्सिस और मक्का में CYCB1 जीन की चित्रा 4. अभिव्यक्ति प्रोफ़ाइल।   (ए) AtCYCB1 की माइक्रोएरे अभिव्यक्ति मूल्यों; 1 LRIS दौरान डी Smet एट अल द्वारा वर्णित है। AtCYCB1 के संभावित orthologs के 2008 10 (बी) के माइक्रोएरे अभिव्यक्ति मूल्यों; LRIS के दौरान 1 Jansen एट अल द्वारा वर्णित है। मक्का जीनोम पर 1; 2013 13 BLASTP स्कोर AtCYCB1 के प्रोटीन अनुक्रम नष्ट करना प्राप्त जब स्कोर है। त्रुटि सलाखों के मानक विचलन को व्यक्त करने और ** एक पी -value के लिए खड़ा है ≤0.01। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 5
चित्रा 5 सितारे में GRMZM2G310115 की अभिव्यक्ति और LRIS दौरान मक्का जड़ें कॉर्टेक्स। की अभिव्यक्ति <उन्हें> मक्का में LRIS दौरान GRMZM2G310115 विच्छेदित दस्ता और कोर्टेक्स नमूनों पर मात्रात्मक वास्तविक समय QRT- पीसीआर द्वारा मूल्यांकन किया गया था। एक अनुपूरक नमूना पानी पर बड़े पौधों पर प्रदर्शन किया गया था। मानों पानी में मूठ में अभिव्यक्ति के लिए सामान्यीकृत थे। त्रुटि सलाखों के मानक विचलन को व्यक्त करने और ** (Jansen एट अल। 2013 13 के अनुसार प्राइमरों और संदर्भ जीन) एक पी -value ≤0.01 के लिए खड़ा है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

एराबिडोप्सिस LRIS प्रोटोकॉल में, यह केवल पूरी तरह से एनपीए युक्त मध्यम विकास के साथ संपर्क में हो गए हैं कि पौध हस्तांतरण करने के लिए महत्वपूर्ण है। इस पार्श्व जड़ दीक्षा पूरे रूट की लंबाई से अधिक अवरुद्ध है कि सुनिश्चित करता है। स्थानांतरण के दौरान पौधे लोग घायल हो गए रोकने के क्रम में, घुमावदार संदंश की बाहों अंकुर की बीजपत्र तहत आदी हो सकते हैं। हस्तांतरण पर, अंकुर जड़ों NAA युक्त अगर मध्यम के साथ पर्याप्त संपर्क में हैं कि सुनिश्चित करें। यह एक छोटी सी दूरी पर अगर सतह पर रूट उड़े द्वारा प्राप्त किया जा सकता है। इस कुल जड़ लंबाई से अधिक पार्श्व रूट दीक्षा के एक कुशल सिंक्रनाइज़ प्रेरण सुनिश्चित करेगा। जड़ों को नकारात्मक रूप से उनके विकास और पार्श्व रूट प्रेरण को प्रभावित किए बिना प्रकाश के संपर्क में उगाया जा सकता है।

मक्का LRIS प्रोटोकॉल में, यह कर्नेल के रूटलेट घ विकसित होगा जड़ सुनिश्चित करने के लिए नीचे और कागज की ओर का सामना करना पड़ता है कि महत्वपूर्ण हैownwards और सही पक्ष 16 पर कागज के लिए देते हैं। एनपीए उपचार के तीन दिनों के बाद, पौध एक छोटे से गोली मार, एक प्राथमिक जड़ और लाभदायक जड़ों 16 के साथ गिरी से उभरा है चाहिए। प्राथमिक जड़ पार्श्व रूट दीक्षा की प्रेरण के लिए आगे बढ़ने से पहले लगभग 2 सेमी लंबा होना चाहिए। इस प्रोटोकॉल B73 मक्का जन्मजात लाइन का उपयोग कर विकसित की है, लेकिन एक अलग विकास दर के साथ एक मक्का लाइन के मामले में, तदनुसार ऊष्मायन समय समायोजित कर दिया गया है। पेपर रोल तरल समय के साथ वाष्पीकृत जब अक्षम और अवांछित जल्दी पार्श्व रूट विकास हो सकता है हो सकता है अन्यथा, एनपीए उपचार नियमित रूप से 50 माइक्रोन के एनपीए समाधान जोड़कर लथपथ रहते हैं कि सुनिश्चित करें। सिस्टम ही प्रकाश को जड़ों की प्रदर्शनी से बचाता है, लेकिन प्रकाश एक प्रमुख मुद्दा नहीं है और जड़ विकास और पार्श्व रूट प्रेरण को प्रभावित नहीं करता।

पार्श्व जड़ों की नियंत्रित शामिल करने के लिए वैकल्पिक तरीकों एमईसी का उपयोग कर रहे हैंhanical 23 या gravistimulation 24 झुकने। इन प्रणालियों के मुख्य लाभ यह है कि वे LRIS में हार्मोन उपचार की तुलना में एक अधिक 'प्राकृतिक' प्रेरण है कि है, लेकिन नुकसान है कि वे एक निश्चित समय बिंदु पर काटा जा सकता है कि सामग्री की मात्रा में सीमित कर रहे हैं वह यह है कि वे केवल क्योंकि LRIS में पेरिसाइकिल की एक पूरी प्रेरण की तुलना में अंकुर प्रति मोड़ में एक पार्श्व रूट दीक्षा घटना निकलेगा।

अनुकूल परिस्थितियों अनुकूलित करने की आवश्यकता है, हालांकि एराबिडोप्सिस और मक्का में इस्तेमाल LRIS, पौधों की एक किस्म में इस्तेमाल किया जा सकता है। Auxin परिवहन और auxin (2) के संचय (1) के अवरुद्ध पार्श्व रूट दीक्षा प्रेरित करने के लिए: एक LRIS स्थापित करने के लिए दो महत्वपूर्ण लगातार कदम हासिल किया जाना है। बढ़ती प्रणाली यौगिकों के कुशल और वर्दी तेज के लिए अनुमति चाहिए और पौध के अच्छे विकास की अनुमति चाहिए। ठोस मध्यम (एराबिडोप्सिस) और पेपर रोल करने के लिए वैकल्पिक प्रणाली (इस तरह के तरल संस्कृति, हाइड्रोपोनिक्स, या aeroponics के रूप में मक्का), अन्य प्रजातियों के लिए इस्तेमाल किया जा सकता है। यानी LRIS में पहले चरण auxin परिवहन के अवरुद्ध, एक auxin परिवहन अवरोध करनेवाला जोड़कर प्राप्त किया जा सकता है। एनपीए एराबिडोप्सिस और मक्का में पार्श्व रूट दीक्षा के एक कुशल ब्लॉक की ओर जाता है, हालांकि इस तरह 2,3,5-triiodobenzoic एसिड (Tiba) या पी chlorophenoxyisobutyric एसिड (PCIB) के रूप में वैकल्पिक यौगिकों अन्य प्रजातियों में बेहतर काम हो सकता है। इसी तरह की एक अनुकूलन LRIS, यानी, auxin उपचार के दूसरे चरण के लिए किया जा सकता है। NAA लगती सिंथेटिक auxin एक LRIS के लिए सबसे उपयुक्त हो। यह भी दृढ़ता से पार्श्व जड़ों लाती है और विभिन्न संयंत्रों 25, 26। दूसरी ओर, प्राकृतिक auxin इण्डोल-3- एसिटिक एसिड में एक उच्च bioactivity के रूप में auxin अग्रदूत indol-3-butyric एसिड (आईबीए) एक अच्छा विकल्प हो सकता है (आई ए ए) कम स्थिर है और अधिक आसानी से जड़ गतिविधियों पर अपनी कमजोर प्रभाव को युक्तिसंगत बनाने, 27 metabolizedउदाहरण के मक्का या चावल 25, 26 के लिए में opment। सिंथेटिक auxin 2,4-dichlorophenoxyacetic एसिड (2,4D) पेरिसाइकिल कोशिकाओं में अत्यधिक जम जाता है, यह कोशिकाओं 28 से निर्यात नहीं है आंशिक रूप से, क्योंकि उचित पार्श्व रूट दीक्षा आई और कृत्रिम उत्प्रेरण आपस में जुड़े संरचनाओं। इसके अलावा ऐसे 12 naxillin रूप auxin रास्ते, के साथ बातचीत के अन्य यौगिकों, एराबिडोप्सिस में पार्श्व रूट दीक्षा प्रेरित करने के लिए दिखाया गया है और अन्य प्रजातियों में परीक्षण किया जा सकता है।

कुछ मामलों में, अंकुरण एनपीए की उपस्थिति में अक्षम है और एक पहले और बाद में एनपीए युक्त सिस्टम के लिए पौध हस्तांतरण करने के लिए, एनपीए के अभाव में बीज अंकुरित करने के लिए चुन सकते हैं। यह केवल एनपीए उपचार के दौरान लम्बी कि जड़ के क्षेत्र नमूने के लिए इसलिए, यह महत्वपूर्ण है NAA उपचार और, साथ पार्श्व रूट शामिल होने से पहले शुरू की जल्दी पार्श्व जड़ primordia होने के संभावित खतरे को प्रेरित करता है। यह सामान्य रणनीति के बाद, एक थानेदारव्यावहारिक रूप से किसी भी (बीज) संयंत्र के लिए एक LRIS अनुकूलन करने के लिए सक्षम हो uld और इस तरह एक आसान प्रणाली है के रूप में ब्याज के संयंत्र के लिए पार्श्व रूट विकास का अध्ययन करने के लिए। एराबिडोप्सिस के लिए उदाहरण के रूप में पार्श्व रूट दीक्षा के समय के आगे लक्षण वर्णन, मार्कर लाइनों के माध्यम से हो सकता है। मार्कर लाइनों प्राप्त करने के लिए मुश्किल हो जाता है, तो एक विस्तृत ऊतकीय अध्ययन किया जा सकता है, लेकिन इस समय लेने वाली है और पहली कोशिका विभाजन को आसानी से स्वीकार करने योग्य नहीं हैं। वैकल्पिक रूप से, कोशिका विभाजन मार्कर की अभिव्यक्ति विश्लेषण पहली कोशिका विभाजन के समय इंगित करने के लिए इस्तेमाल किया जा सकता है।

LRIS ऐसे transcriptome विश्लेषण के रूप में संक्षेप में परिणामों में वर्णित 9-13, साथ ही पार्श्व रूट दीक्षा 14 के दौरान स्थूल और सूक्ष्म स्तर पर ऊतकीय टिप्पणियों के रूप में विभिन्न प्रयोजनों के लिए इस्तेमाल किया जा सकता है। अंग से सेल पैमाने 29 से लेकर नमूने के विभिन्न प्रकार, बाद के विभिन्न पहलुओं को उजागर अनुमति हो सकती हैअल जड़ दीक्षा। इसके अलावा, LRIS पार्श्व रूट दीक्षा 12, 30 पर विभिन्न यौगिकों के प्रभाव पर नजर रखने के लिए इस्तेमाल किया जा सकता है। अंत में, संवाददाता लाइनों का उपयोग करके, एक LRIS भी इस्तेमाल किया जा सकता है आसानी से पार्श्व के दौरान जीन अभिव्यक्ति और / या प्रोटीन स्थानीयकरण चिह्नित करने के लिए जड़ विकास।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासे के लिए कुछ भी नहीं है।

Materials

Name Company Catalog Number Comments
ARABIDOPSIS LRIS
Seeds
Arabidopsis seeds Col-0 ecotype
Gas sterilization of seeds
micro-centrifuge tubes 1.5 ml SIGMA-ALDRICH 0030 125.215 Eppendorf microtubes 3810X, PCR clean
micro-centrifuge tubes 2 ml SIGMA-ALDRICH 0030 120.094 Eppendorf Safe-Lock microcentrifuge tubes
hydrochloric acid Merck KGaA 1,003,171,000 37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu
glass desiccator SIGMA-ALDRICH Pyrex
glass beaker
plastic micro-centrifuge tubes box or holder
Bleach sterilization of seeds
ethanol Chem-Lab nv CL00.0505.1000 Ethanol, abs. 100% a.r. dilute to 70%
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
Tween 20 SIGMA-ALDRICH P1379
sterile water
Growth medium
Murashige and Skoog salt mixture DUCHEFA Biochemie B.V. M0221-0050
myo-inositol SIGMA-ALDRICH I5125-100G
2-(N-morpholino)ethanesulfonic acid (MES) DUCHEFA Biochemie B.V. M1503.0100
sucrose VWR, Internation LLC 27483.294 D(+)-Sucrose Ph. Eur.
KOH Merck KGaA 1050211000 pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur
Plant Tissue Culture Agar LabM Limited MC029
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 10 µM (Arabidopsis)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 10 µM (Arabidopsis)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Making a mesh for transfer
nylon mesh Prosep byba Synthetic nylon mesh 20 µm
Sowing and seedling handling
square petri dish plates GOSSELIN BP124-05 12 x 12 cm
50 ml DURAN tubes SIGMA-ALDRICH CLS430304 Corning 50 ml centrifuge tubes
drigalski Carl Roth K732.1
pipette
cut pipette tips Daslab 162001X Universal 200, cut off 5 mm of tip before autoclaving
breathable tape  3M Deutschland GmbH cat. no. 1530-1
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
Growth conditions
growth room 21 °C, continuous light
Materials Company Catalog Comments
MAIZE LRIS
Seeds
Maize kernels B-73
Bleach sterilization of kernels
glass beaker
magnetic stirrer  Fiers nv/sa C267.1
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
sterile water
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 50 µM (maize primary root), 25 µM (maize adventitious root)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 50 µM (maize)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Sowing and seedling handling
paper hand towels Kimberly-Clark Professional* 6681 SCOTT Hand Towels - Roll / White; sheet size (24 x 46 cm)
seed germination paper Anchor Paper Company 10 X 15 38# seed germination paper
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
250 ml (centrifuge) tubes SCHOTT DURAN 2160136 approx. 5.6 cm diameter and 14.7 cm height 
700 ml tubes DURAN GROUP 213994609 cylinders, round foot tube, D 60  x 250
rack for maize tubes, home made
sterile water
Growth conditions
growth cabinet 27 °C, continuous light, 70% relative humidity

DOWNLOAD MATERIALS LIST

References

  1. Van Norman, J. M., Xuan, W., Beeckman, T., Benfey, P. N. To branch or not to branch: the role of pre-patterning in lateral root formation. Development. 140, 4301-4310 (2013).
  2. Dolan, L., et al. Cellular organisation of the Arabidopsis thaliana root. Development. 119, 71-84 (1993).
  3. Bell, J. K., McCully, M. E. A histological study of lateral root initiation and development in Zea mays. Protoplasma. 70, 179-205 (1970).
  4. Benkova, E., et al. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell. 115, 591-602 (2003).
  5. Beeckman, T., Burssens, S., Inzé, D. The peri-cell-cycle in Arabidopsis. J. Exp. Bot. 52, 403-411 (2001).
  6. Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inzé, D., Beeckman, T. Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell. 14, 2339-2351 (2002).
  7. Jansen, L., Parizot, B., Beeckman, T. Inducible system for lateral roots in Arabidopsis thaliana and maize. Methods Mol Biol. 959, 149-158 (2013).
  8. Casimiro, I., et al. Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell. 13, 843-852 (2001).
  9. Himanen, K., et al. Transcript profiling of early lateral root initiation. Proc. Natl. Acad. Sci. USA. 101, 5146-5151 (2004).
  10. De Smet, I., et al. Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root. Science. 322, 594-597 (2008).
  11. Vanneste, S., et al. Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana. Plant Cell. 17, 3035-3050 (2005).
  12. De Rybel, B., et al. A role for the root cap in root branching revealed by the non-auxin probe naxillin. Nat. Chem. Biol. 8, 798-805 (2012).
  13. Jansen, L., et al. Comparative transcriptomics as a tool for the identification of root branching genes in maize. Plant Biotechnol. J. 11, 1092-1102 (2013).
  14. Parizot, B., et al. Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation. Plant Physiol. 146, 140-148 (2008).
  15. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 15, 473-497 (1962).
  16. Bellini, C., Pacurar, D. I., Perrone, I. Adventitious roots and lateral roots: similarities and differences. Annu Rev Plant Biol. 65, 639-666 (2014).
  17. Grunewald, W., Parizot, B., Inzé, D., Gheysen, G., Beeckman, T. Developmental biology of roots: One common pathway for all angiosperms? Int. J. Plant Dev. Biol. 1, 212-225 (2007).
  18. Parizot, B., Beeckman, T. Genomics of root development. Root Genomics and Soil Interactions. Crespi, M. 3-28 (2012).
  19. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. Journal of visualized experiments : JoVE. (2010).
  20. Nakazono, M., Qiu, F., Borsuk, L. A., Schnable, P. S. Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize. Plant Cell. 15, 583-596 (2003).
  21. Ludwig, Y., Hochholdinger, F. Laser microdissection of plant cells. Methods Mol Biol. 1080, 249-258 (2014).
  22. Beeckman, T., Engler, G. An easy technique for the clearing of histochemically stained plant tissue. Plant Mol. Biol. Rep. 12, 37-42 (1994).
  23. Ditengou, F. A., et al. Mechanical induction of lateral root initiation in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA. 105, 18818-18823 (2008).
  24. Lucas, M., Godin, C., Jay-Allemand, C., Laplaze, L. Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation. J. Exp. Bot. 59, 55-66 (2008).
  25. Wang, S., Taketa, S., Ichii, M., Xu, L., Xia, K., Zhou, X. Lateral root formation in rice (Oryza Sativa. L.): differential effects of indole-3-acetic acid and indole-3-butyric acid. Plant Growth Regul. 41, 41-47 (2003).
  26. Martinez-de la Cruz, E., Garcia-Ramirez, E., Vazquez-Ramos, J. M., Reyes de la Cruz, H., Lopez-Bucio, J. Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings. J Plant Physiol. 176, 147-156 (2015).
  27. Beyer, E. M., Morgan, P. W. Effect of ethylene on uptake, distribution, and metabolism of indoleacetic acid-1-14C and -2-14C and naphthaleneacetic acid-1-14C. Plant Physiol. 46, 157-162 (1970).
  28. Delbarre, A., Muller, P., Imhoff, V., Guern, J. Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta. 198, 532-541 (1996).
  29. Bailey-Serres, J. Microgenomics: genome-scale, cell-specific monitoring of multiple gene regulation tiers. Annu Rev Plant Biol. 64, 293-325 (2013).
  30. Perez-Torres, C. A., et al. Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor. Plant Cell. 20, 3258-3272 (2008).
में पार्श्व रूट inducible प्रणाली<em&gt; एराबिडोप्सिस</em&gt; और मक्का
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).More

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter