Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

의 측면 루트 유도 성 시스템 doi: 10.3791/53481 Published: January 14, 2016
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

이 토양에서 앵커리지 및 물 섭취와 영양분을 보장 이후 루트 시스템은 식물 성장에 중요하다. 루트 시스템의 팽창은 주로 측면 뿌리의 생산에 사용하기 때문에, 그 개시 및 형성은 널리 연구되고있다. 측면 뿌리는 설립자 세포 1이라고 pericycle 세포의 특정 부분 집합으로 시작됩니다. 옥수수와 같은 외떡잎에, 그들은 사부 극 3에서 발견되는 반면, 같은 애기 장대와 같은 대부분의 dicots, 이러한 세포, protoxylem 기둥 2에 있습니다. 설립자 세포는 특정 세포주기 유전자의 발현에 이어 증가 옥신 반응 (4)에 의해 표시된다 (예를 들어, 사이클린 B1 1 / CYCB1는 1), 그 후 그들이 비대칭 배사 부문 (5)의 첫 번째 라운드를 겪는다. 조정 배사와 periclinal 부문의 일련의 후 측면 루트 primordium 최종적으로 부상 할 것으로 형성된다utonomous 측면 루트. 이러한 이벤트가 풍부한이나 동기화도 있기 때문에 위치 및 측면 루트 개시 타이밍은, 그러나 예측하지 않습니다. 여기에는이 과정을 연구하기 transcriptomics 분자 접근법의 사용을 방해한다.

이를 해결하기 위해, 횡 루트 유도 성 시스템 (LRIS)는, 6 개발되었다 (7).이 시스템에서는, 묘 먼저 따라서 횡 루트 개시를 막고, 옥신 전송 및 축적을 억제하는 N -1- naphthylphthalamic 산 (NPA)로 처리 8. 이어서 합성 옥신 -1- 나프탈렌 초산 (NAA)를 함유하는 배지에 종묘를 전송함으로써, 전체 pericycle 층함으로써 대규모 고가 옥신 레벨 유도부 횡 루트 개시 세포 분열 (6)에 응답한다. 이와 같이,이 시스템은 후반의 특정 스테이지에 대해 농후 루트 샘플의 수집을 용이하게, 고속 동기 및 광범위한 측면 뿌리 시작 (initiation)에 이르게RAL 루트 개발. 이어서, 이들 샘플은 횡 루트 형성 동안 게놈 전체의 발현 프로필을 결정하기 위해 사용될 수있다. LRIS 다른 식물 종에이 시스템을 적용하는 측면 루트 애기 장대의 시작과 옥수수 9-13,하지만 필요에 대해 이미 상당한 지식을 나왔고 더 게놈 서열대로보다 명확하게하고 경제적 중요한에게 지식을 전달하는 관심이 높아지고있다 종.

여기, 애기 장대와 옥수수 LRISs의 상세한 프로토콜이 제공됩니다. 다음, 시스템의 사용의 예는 옥수수 LRIS 얻은 transcriptomics 데이터가 다른 식물 종에 걸쳐 횡 루트 개시 동안 보존 된 기능을 가질 기능적 동족체를 식별하기 위해 사용할 수있는 방법을 예시하여 제공된다. 다른 종의 식물이 제안에 대해 마지막으로, 지침 LRIS을 최적화합니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. 애기 장대 LRIS 프로토콜

참고 : 텍스트는 "작은"또는 "큰"규모의 실험을 의미한다. 이러한 마커 라인 분석 및 조직 학적 염색법 6, 14 등의 소규모 실험은 단지 몇 개의 샘플을 필요로한다. 이러한 정량적 실시간 QRT-PCR 마이크로 어레이 9-11 또는 RNA 시퀀싱 같은 대규모 실험은 샘플의 더 많은 양을 필요로한다. 따라서, 샘플 1000 모종이 Vanneste 등의 알에 의해 사용되었다 ~의. (11) 양이 루트 세그먼트 절개 후 마이크로 어레이 실험을 수행 할 수 있습니다.

DAY 1

  1. 애기 씨의 살균
    참고 : 종자 살균을위한 다음 절차 중 하나를 선택합니다. 그들 중 임의의 프로토콜의 다음 단계에 적합하다. 가스 멸균 (1.1.2) 액체 살균 (1.1.1)을 통해 두 가지 장점을 제공합니다 : 큰 감각을 처리 할 때이 시간이 적게 걸립니다씨앗 어, 더 피펫 개별 샘플에 대한 발생이 없기 때문에, 및 소독 종자 장기간 저장 될 수있다. 그러나, 건조기 및 취급에주의가 필요합니다.
    1. 액체 살균
      1. 마이크로 원심 분리기 튜브에 종자의 수를 붓는다. 2 ml의 마이크로 원심 분리기 튜브에 1.5 ML 튜브에 20 mg의 (~ 800 씨앗) 또는 40 밀리그램 (~ 1600 씨앗)까지 사용할 수 있습니다.
      2. 70 % 에탄올 1 ML을 추가합니다. 반전 또는 부드럽게 2 분 동안 흔들어.
      3. 15 분 동안 1 ml의 살균 용액으로 70 % 에탄올을 교체합니다. (신선한 살균 솔루션 준비 : 3.85 ml의 차아 염소산 나트륨 (NaOCl에) 주식 (12 %) (주의 :이) 후드를 연기 5 μL 트윈 (20), 물 10 ㎖까지의 모든 씨앗이 올 있는지 확인하기 위해 튜브를 여러 번 전환. 용액과 접촉.
      4. 반복하여 층류 공기 유동 캐비닛, 5 분 동안 종자 5 회 1ml의 멸균 증류수로 멸균 용액을 대체 린스LY 신선한 멸균 증류수 1 ㎖로 교체.
    2. 가스 멸균
      1. 2 ml의 마이크로 원심 분리 튜브에 종자의 수를 붓는다. 여러 개의 독립적 인 라인 작업을 할 때 각각의 튜브를 사용하여, 그들을 플라스틱 마이크로 원심 분리기 튜브 상자 또는 홀더에 열 준비. 하나의 튜브에서 씨앗의 수가 500 (12.5 mg)을 초과하는 경우, 성공을 보장하기 위해 멸균 튜브의 적절한 수의 씨앗을 분할. 이웃 튜브의 캡은 서로를 가리지 않도록해야합니다. 이 살균뿐만 아니라 건조기에 있어야 같이, 하단 박스의 덮개를 함께 장착한다.
      2. 유리 비커와 함께, 데시 케이 터의 그릇에 상자를 놓고 (주의 :이 후드를 연기).
      3. (: 사용 흄 후드주의) 12 %의 NaOCl 100 mL로 비커를 입력합니다. 데시 케이 터에 뚜껑을하는 듯했으나 비이커 저장하는 작은 구멍을 둡니다.
      4. (CAU을 37 % 염산 (발연)의 3 ML을 추가TION : 사용은 작은 구멍을 통해 비커에 후드를) 연기 빠르게 건조기를 닫습니다. CL 2 - 가스 형성으로 인해 약간의 시간에 대한 솔루션 의지 거품. 시스템을 남기기는 O / N (또는 적어도 8 시간)을 마감했다.
      5. 데시 케이 터의 뚜껑을 제거합니다. 상자를 꺼내 운송 중에 오염을 방지하기 위해 뚜껑을 커버한다.
      6. , 층류 공기 흐름 캐비닛에 상자를 넣어 뚜껑을 제거하고 가스 방출을 허용하도록 실온에서 약 1 시간 동안 씨앗을 둡니다.
        참고 : 씨앗 안전하게 4 ° C에서 최대 2 주 동안 폐쇄 마이크로 원심 분리기 튜브에 건조를 저장할 수 있습니다.
  2. 애기 장대에서 측면 루트 유도
    1. 측면 루트 억제 (NPA 처리)
      1. 체외 성장을위한 성장 매체를 준비합니다. 배지는 무라 시게 및 반 강도 스쿡 염 혼합물 (15), 0.1 g / 리터 미오 - 이노시톨, 10g / L 수 크로스를 포함하고 0.5로 버퍼링G / L 2- (N- 모르 폴리 노) 에탄 산 (MES).
      2. 1 M KOH와 5.7 pH를 조정합니다. 식물 조직 한천 8g / L를 첨가하고 121 ℃에서 20 분 동안 오토 클레이브 매체.
      3. 디메틸 설폭 시드 (DMSO) (: 장갑을 사용주의) NPA의 25 mM의 주식 솔루션을 준비합니다. 층류 공기 유동 캐비닛 (병을 손에 유지 될 수있는 온도이다) 약 65 ° C까지 멸균 배지를 냉각하고, 10 μM NPA의 최종 농도를 얻기 위해 25 mM의 NPA 스톡 용액을 첨가.
      4. 부드럽게 10 초 동안 병을 흔들어 또한에 균질화. 사각형 페트리 접시 당 배지 50 ㎖ (12cm X 12cm)를 따르십시오.
        주 : 대규모 실험의 경우, 환경 전송을 보장하기 위해 나일론 메쉬 (20 ㎛의)을 적용한다. 고압 증기 멸균 (그림 1A)를위한 메쉬 (9cm X 9cm)를 준비합니다. 멸균되면 무균 핀셋 (도 1b)을 사용하여 성장 배지에 메쉬를 적용한다. 부드럽게 인트를 사용하여 성장 배지에 메쉬를 밀어(: 무균 조건에서 작업주의)는 성장 매체 (그림 1B)와 잘 접촉되어 있는지 확인 drigalsky을 rilized.
      5. NPA-접시에 씨앗을 뿌리고.
        , 경우 대규모 실험이 계획되어있다 (1.2.2.3 참조) 샘플링을 용이하게하기 위해 (50) 씨의 2 조밀하고 잘 정렬 된 행을 뿌리 참고.
        1. 액체 살균 경우, 200 μL 피펫을 사용하여 NPA-접시에 씨앗을 뿌리다. 3 잘라 - 위해 멸균 조건 (또는 팁 멸균 전)에 피펫 팁의 끝 4 MM은 씨앗을 피펫 할 수 있습니다. 피펫 위로 씨앗을 다시 중단 할 몇 번 다운 후 10 약 150 μL 멸균 물을 피펫 - (20) 씨와 팁의 맨 아래에있는 씨앗 침전물 때까지 기다립니다. (주의 : 무균 조건에 대한 작업)
          참고 : 끝으로 부드럽게 한천 또는 메쉬를 터치하면, 씨앗과 물 한 방울은 그것 (그림 1C)에서 발표 될 예정이다.
        2. <가스 멸균 경우 리>, 접착 표면을 보장하기 위해 씨앗을 복용하기 전에 멸균 toothpicks.Pinch에게 한천에 이쑤시개를 이용하여 씨앗을 뿌리다. 이쑤시개를 사용하여 하나 씨앗 하나를 들고 플레이트 (그림 1D)에 씨앗을 배포 할 수 있습니다. (: 무균 조건에서 작업주의) 또는 씨앗에 멸균 물을 추가하고 1.2.1.5.1에​​ 기술 된 바와 같이 뿌리다.
      6. 통기성 접착 테이프로 번호판을 봉인하고 최소 2 일 최대 일주일 동안 어둠 속에서 4 ° C에서 그들에게 접시를 저장합니다. 이것은 계층화 동기화 보장하고보다 효율적인 발아 필요하다.
        주 : 대안 적으로, 종자는 파종 전에 성층 적은 냉장고 공간을 필요 마이크로 원심 분리기 튜브, 증류수에 침지 될 수있다. 이 경우, 4 ° C에서 적어도 하나의 주 튜브를 저장하고, 즉시 (1.2.1.7 참조​​) 파종 후 생장 캐비닛 판을 이동.
        3 일 성장 캐비닛에 판을 이동 (연속 빛 (110 μE 분 -2 S-1), 21 ° C를) 거의 수직 위치에 오일 (발아 2 일 및 성장 3 일)에 대한 (80-90 °) 매체의 루트에 성장하지를 보장합니다.
        8 일
    2. 측면 루트 유도 (NAA 처리)
      1. 1.2.1.1 및 1.2.1.2에 기재된 것과 같은 성장 배지를 준비한다. (: 장갑을 사용주의) DMSO에서 NAA의 50 mM의 주식 솔루션을 준비합니다. 아래로 65​​ ° C로 멸균 매체 쿨 10 μm의 NAA의 최종 농도 얻기 위해 매체에 NAA 솔루션을 추가 (주의 : 무균 조건에서 작업을).
        1. 부드럽게 10 초 동안 병을 흔들어 또한에 균질화. 사각형 페트리 접시 당 배지 50 ㎖ (12cm X 12cm)를 따르십시오.
      2. 그 SUP 10 μM NPA 보충 된 성장 배지를 함유하는 플레이트로부터 모종을 전송할10 μm의 NAA와 plemented.
        1. 모종의 자엽에서 곡선 핀셋의 팔을 걸고 부드럽게 판에서 제거합니다. 만 뿌리가 완전히 바람직 아래로 NPA 성장 매체와 접촉 성장하는 모종을 전송합니다.
        2. 작은 거리에 걸쳐 NAA 함유 증식 배지 표면 위에 뿌리 탈지. 식물 뿌리가 성장 매체와 잘 접촉되어 있는지 확인합니다. 필요한 경우, 핀셋 성장 배지 표면에 부드럽게 루트를 누른다.
          주 : 대규모 실험의 경우, 핀셋 개의 상부 모서리에서 메쉬를 올려 메쉬와 전사와 접촉하지 않는 모든 묘목을 제거한다. 확인 메시는 작은 거리 (그림 1E)를 통해 한천 표면에 메쉬를 감추고하여 NAA 함유 매체와 좋은 접촉합니다.
      3. 통기성 테이프로 새 판을 밀봉 (성장 캐비닛에 콘을 배치연속적인 빛 샘플링까지 유도 후 원하는 시간에 대한 수직 위치 (110 μE 분 -2 S-1), 21 ° C를).
        주 : 대규모 실험의 경우, 메시 한꺼번에 직접 루트 세그먼트를 잘라내어 부드럽게 메쉬의 표면을 긁어 그들을 샘플 메스를 사용한다.

2. LRIS 옥수수 프로토콜

  1. 옥수수 커널의 계층화
    1. 최소 1 주일 동안 어둠 속에서 4 ° C에서 옥수수 커널을 품어.
      주 :이 프로토콜은 B73 옥수수 근친 라인을 사용하여 개발되어왔다.
  2. 옥수수 커널의 살균
    DAY 1
    주 : 옥수수 묘목 멸균 조건에서 재배 할 필요는 없지만, 그것은 종이 롤 곰팡이 성장을 방지하는 옥수수 커널을 살균 및 멸균 재료와 함께 작동하도록 권장체계.
    1. 멸균 유리 비커에 옥수수 커널의 필요한 번호를 넣습니다.
    2. (물에 6 %의 NaOCl) 살균 용액 (: 사용 흄 후드주의) 100 ㎖를 추가합니다.
    3. 자기 교반 막대를 추가하고 5 분 동안 실온에서 낮은 교반 속도 (약 250 RPM)에서 자석 교반기에 비커를 놓습니다.
    4. 신선한 멸균 물 100ml와 솔루션을 대체하여 5 분 동안 다섯 번 씻어.
  3. 옥수수 커널 파종
    1. 오염의 위험을 감소시키고, 종이 타올의 롤을하기 위해 장갑을 착용 할 것.
    2. 두 장 (약 92cm X 24cm)의 총 길이와 손 타월 용지 두 뻗어을 눈물과 깨끗한 표면 (그림 2A)에 서로의 상단에 배치합니다.
    3. 시트 길이 (약 92cm X 12cm) (그림 2A)를 통해 두 번 접습니다.
    4. T를 통해 상단에서 약 2cm에서 10 커널을 배포하는 핀셋을 사용하여그는 용지의 전체 길이, 양쪽 끝 (그림 2B)에서 무료로 각각의 커널과 8cm 사이 8cm의 공간을 유지하면서. 커널의 잔뿌리가 아래로 용지 (그림 2B)를 향하도록되어 있는지 확인합니다.
    5. 씨앗 장소에서 (그림 2B)를 유지하면서 부드럽게, 길이에 걸쳐 용지를 굴립니다. 압연을 용이하게하기 위해, 먼저 무균 물 종이 스프레이 선택적이다.
    6. 약 6cm 직경 14cm 높이 (예를 들어, 250 ML의 원심 분리기 튜브)의 멸균 유리 튜브의 용지 롤을 넣고 랙 (그림 2C)에 배치합니다.
  4. 옥수수의 측면 루트 유도
    1. (DMSO에 용해) 50 mM의 NPA 주식 솔루션 (: 장갑을 사용주의)를 준비합니다.
    2. 각 튜브를 들어, 멸균 유리 비이커에 125 ㎖의 멸균 수에 50 mM의 NPA 스톡 용액 125 μL를 첨가하여 50 μM NPA 용액을 만든다.
    3. 잘 믹스튜브에서 롤 페이퍼 위에 50 μM NPA 용액 125 ㎖에 붓는다. 종이 롤 용액을 흡수하여 완전히 침지 될 것이다.
      참고 : 다른 크기 용지 롤 및 튜브를 사용하는 경우, 그에 따라 볼륨을 조정합니다. 액체는 충분한 흡수를 보장하기 위해 중간 관에 도달한다.
    4. 삼일 (27 ° C, 연속 빛, 70 % 상대 습도)에 대한 성장 캐비닛에 용지 롤 시스템을 놓습니다. 이 솔루션은 시간 (그림 2D)를 통해 증발하기 때문에 용지 롤이 추가로 50 μm의 NPA 솔루션을 추가하여 젖은 상태로 있는지 확인합니다.
      4 일
    5. (DMSO에 용해)의 50 mM NAA 주식 솔루션 (: 장갑을 사용주의)를 준비합니다.
    6. 각 튜브를 들어, 멸균 유리 비이커에 125 ㎖의 멸균 수에 50 mM의 스톡 NAA 125 μL를 첨가하여 50 μM의 NAA 용액을 제조 하였다.
    7. 조심스럽게 종이 롤에 남아있는 NPA 솔루션의 대부분을 짜내 및 배치5 분 동안 멸균 M은 (: 장갑을 사용주의)을 씻어. 조심스럽게 종이 롤에서 대부분의 물을 짜내. 이 세척 단계를 세 번 반복합니다.
    8. 잘 믹스와 튜브의 용지 롤을 통해 50 μM의 NAA 솔루션을 붓는다. 그들이 완전히 담가되어 있는지 확인합니다.
    9. 유도 후 원하는 기간 동안 성장 캐비닛 (27 ° C, 연속 빛, 70 % 상대 습도)에 용지 롤 시스템을 놓습니다.
  5. 옥수수의 외래성 크라운 뿌리에 측면 루트 유도
    참고 : LRIS를 기본 루트에 측면 뿌리를 유도하는 상술 한 바와 같이. 그러나, 옥수수와 함께 그들의 측면 뿌리와 다른 외떡잎, 기본 루트와 배아 정액 뿌리에서, 개발 모종 동안 주로 중요하다. 식물 성장의 후기 단계에서, 포스트는 부정근 배아 줄기에 발생하고 또한 새로운 루트 시스템 (16)을 형성하는 측면 뿌리를 개발한다. LRIS도 사용 될 수 있습니다d는 배아 기본 루트에 LRIS에 약간의 조정에 따라이 후 배아 우발적 인 크라운 뿌리에 측면 뿌리를 유도한다.
    1. 용지 롤을하려면, 외부 측면에 손 타월 종이 각각 두 개의 층, 및 내 발아 용지 두 레이어 논문의 샌드위치를​​ 만들 수 있습니다. 발아 용지의 두 시트 사이에 살균 커널 (단계 2.2 2.1 참조) 놓습니다. 발아 용지, 핸드 타올 용지에 비해 용지의 개방 나중에 쉽게 롤 만들 것입니다 루트 머리와 측면 뿌리에 의해 침투 될 경향이 덜 될 것입니다. 한편, 핸드 타월 용지 두 외부 층은 액체의 흡수를 촉진 할 것이다.
    2. 700 mL 유리 튜브에 롤을 삽입하고 그들을 경찰청없이 멸균 물을 부어. 그들이 완전히 담가되어 있는지 확인합니다.
    3. 성장 캐비닛의 살균 커널 발아 (단계 2.4.9 참조).
    4. 우발적 인 크라운 뿌리까지 모종을 성장(B73 6 일간) 등장하기 시작합니다. 용지 롤이 필요한 경우 멸균 물을 추가하여 항상 젖은 유지되어 있는지 확인합니다.
    5. 세척 단계 후 50 μM의 NAA 솔루션 경찰청 솔루션을 대체하여 측면 루트 개시 유사한 유도 다음 사일 (단계 2.4.4에 2.4.1 참조) 25 μm의 NPA 용액에 전송한다 (단계 2.4 참조 2.4.9에 .5).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

LRIS의 응용 프로그램 측면 루트 개시 과정의 비교 Transcriptomics를 수행하는

LRIS의 하나의 응용은 다른 종에서 횡 루트 형성시와 비교하여 유전자 발현 양상의 상관 관계이다. 비교 transcriptomics는 다른 종의 측면 루트 개발 과정에 참여 orthologous 유전자를 찾아 낼 수있는 가능성을 만들어 접근한다. 이미 형성된 루트 축에 포함 된 셀의 서브 세트로부터 새로운 장기의 형성으로 구성되어 측면 루트 개시는 그들의 뿌리 구조를 제어 할 속씨 공유 주요 메커니즘이다. 결과적으로,이 공통 조상에서 본 기존 경로로부터 진화 및 진화에 걸쳐 보존 된 가능성이 높다. 실제로, 측면 루트 개시의 일반적인 잠재적 규​​제는 다른 종에서 발견 된 <SUP> 17, 18.

애기 장대와 옥수수의 LRIS를 사용하여 샘플링 재료 및 사체 분석

같은 두 종에서, 그것은 단지 NAA 처리 전의 식물을 샘플링하기로 결정 하였다 애기 옥수수 (10), (13), 곧 유도 후, 발병시, 또는 옥신 응답 중 :. LRIS은 두 개의 서로 다른 종에서 설립 된 웰의 발병로서, 또는 pericycle에서 첫번째 분열 동안. 또한, 형광은 19 (FACS)를 활성화 세포 분류 pericycle 전지용 선택 아라비돕시스 또는 옥수수의 레이저 현미경 캡처 20, 21 (LCM)에서 사용 하였다. 애기 장대에서 유도 후 2 및 6 시간의 시점이 선택 전사 pDR5 특성화 :: GUS 옥신 응답에 기초 하였다 pCYCB11 : GUS 세포주기 마커 라인 (9) (도 3). 옥수수에, 시간 (2), (3) 및 유도 후 4 시간을 가리키는, 미세한 세포 분열 활성의 특성화 및 실시간 정량적 역전사 중합 효소 연쇄 반응 (QRT-PCR) (13)를 사용하여 여러 세포주기 마커 유전자 발현의 분석 후에 선택되었다 . RNA는 분리 된 세포에서 추출 이전에 10, 13 설명한 바와 같이 마이크로 어레이 플랫폼에 하이브리드했다.

애기 장대 CYCB1의 Ortholog 찾기 1 (AtCYCB1을 1) 옥수수의

애기, 마커 라인 pCYCB1에서 1 :: GUS 널리 횡 루트 개시시의 제 pericycle 분열을 추적하는 데 사용되어왔다. 이러한 마커 매우 것옥수수에 유용합니다. AtCYCB1 여러 동족체 1은 옥수수 (www.maizesequence.org, 모든 펩티드, BLASTP, 기본 설정)에서 발견되었다. 그 중 여섯은 옥수수에서 LRIS 후 수행 마이크로 어레이에 존재 상당한 농축을 보였다. 1 (그림 4) 가장 BLAST 히트, GRMZM2G310115는 AtCYCB1에 대한 애기 장대에서 관찰 된 것과 유사한 LRIS 후 매우 높은 전사 수준을 보여 주었다.

LRIS의 적용은 개별 유전자 발현을 확인하기

AtCYCB1의 좋은 후보 ortholog로 GRMZM2G310115을 확인하려면 1을 옥수수 측면 루트 개시, LRIS (13)의 과정에서 수행 된 다른 시점에서 촬영 한 샘플에 실시간 QRT-PCR에. N 전 : 전술 한 프로토콜에 설명 된 다른 시점에서 수확 된 식물로 처리하여AA 처리 (NPA), 및 NAA 처리의 2, 3, 4 시간 후. 또한, 단지 물에서 자라는 식물의 물질 LRIS 중성 조건 사이의 유전자 발현을 비교하기 위해 수확 하였다. 수확 후 즉시, 루트 세그먼트는 5mm 루트 팁 위에서 15mm 아래 두눈 사이에 포함 해부 영역에 대응. 족집게 사용하여 피질은 별 (pericycle가 포함된다)에서 분리하고 RNA는 두 조직에서 추출 하였다. 이 검증을 위해 훨씬 빠르고 저렴하기 때문에이 마지막 단계는, 대신에 LCM의 시행 하였다. 다음 각각의 앞으로 사용 및 역방향 QRT-PCR 프라이머, AGCAGGACGCAGTTGGAGAG 및 GAGCCGAGAGCACAGAAGAAAG는 GRMZM2G310115 상향 조정 LRIS에로, 그리고 비석 조직 (그림 5)에 대해 구체적으로 확인되었다. 또한,이 실험은 동기 유발하지 않고, 물에서 성장하는 루트에서 일어나고있는 측면 루트 개시의 이산 이벤트가 검출되지 것을 보여준다, 횡 루트 개시하는 과정에 관련된 유전자의 발현 차이를 공개 LRIS의 필요성을 예시한다.

그림 1
그림 1. 애기 장대에 대한 측면 루트 유도 성 시스템 (A) 나일론 메쉬 (20 μm의) 준비 :., 나일론 메쉬 (9cm로 9cm)를 잘라 알루미늄 호일에 싸서 고압 증기 멸균을 위해 유리 비커에 넣어합니다. (B) 핀셋을 사용하여 NPA 함유 판 (10 μM)에 나일론 메쉬를 적용합니다. 이어서 기포를 제거하기 위하여 살균 drigalski를 사용한다. 나일론에 (C) 파종 씨앗 피펫을 사용하여 메쉬. 나일론에 (D) 파종 종자는 이쑤시개를 사용하여 메쉬. (E)는 나일론 핀셋을 사용 NAA 함유 플레이트 (10 μM)로 이동 메쉬.81 / 53481fig1large.jpg "대상 ="_ 빈 ">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
그림 2. 옥수수에 대한 측면 루트 유도 성 시스템.   장소 용지 두 층 (92cm X 24cm, 두 장의 길이) 서로의 상단에 그들을 길이에 걸쳐 두 배 (92cm X 12cm)에 배 (A) 용지 롤을 준비. (B)는 잔뿌리가 8cm의 사이 간격과 상단에서 2cm에서 종이에 아래를 향으로 10 소독 옥수수 커널을 넣습니다. 장소에 옥수수 커널을 유지하면서 다음 용지를 굴립니다. (C) 튜브의 용지 롤 (예를 들어, 250 ml의 원심 분리기 튜브)를 놓고 랙에 넣어. (D) 27 ° C, 연속 빛, 상대 습도에서 50 μm의 NPA 용액 (에 3 일 동안 옥수수 모종을 성장dity 70 %). (E) 왼쪽 : 그냥 NAA로 전송하기 전에 모종; 중동 : 그냥 NAA에 전송 및 NAA로 전송 후 2 일전 마이크로톰 횡단 섹션; 오른쪽 :. 오일 NAA로 전송 한 후 표시 등장 측면 뿌리 모종 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
그림 3. 측면 루트 개시는 pDR5 :: GUS 마커 행을 사용하여 NAA 치료 중 옥신 반응을 보여 장기간 NAA 처리. (AF) 시간 경과시 자극한다. 횡 루트 개시 트리거링 이벤트 중 하나가 먼저 인 옥신 응답은 NAA 처리의 개시 후 2 시간을 시작한다. 상단 패널에서 전체 모종의 개요가 제공됩니다; 하판 쇼루트 팁 옥신 반응이야. pCYCB1를 사용 NAA 처리 (GM) 시간 코스 1 :: GUS 마커 라인. GUS 신호 CYCB1의 발현을 나타내고, 1 유전자를, 횡 루트 형성으로 이어지는 제 세포 분열이 NAA 처리 개시 후 6 시간을 시작하는 것을 나타낸다. 상단 패널에서 전체 모종의 개요가 제공됩니다; 하단 패널은 CYCB1을 보여줍니다. (Beeckman과 엥글 러 1994 년 (22)에 따라 GUS 염색) 루트 팁 1의 발현 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 4
LRIS 동안 애기 장대와 옥수수에서 CYCB1 유전자의 그림 4. 식 프로필.   (A) AtCYCB1의 마이크로 어레이 발현 값 1을 LRIS 동안 드 SMET 등에 의해 설명 된 바와 같이. AtCYCB1의 잠재적 orthologs의 2008 년 5 월 10 (B) 마이크로 어레이 발현 값; LRIS 동안 1 얀센 등의 알에 의해 설명 된 바와 같이. 옥수수 게놈에 1, 2013 13 BLASTP 점수는 AtCYCB1의 단백질 서열을 폭파 할 때 얻은 점수입니다. 오차 막대는 표준 편차를 표현하고 **은 p - 값을 의미 ≤0.01. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 5
그림 5. 별에서 GRMZM2G310115의 발현과 LRIS 동안 옥수수 뿌리의 코어 텍스.의 표현 <EM> 옥수수의 LRIS 동안 GRMZM2G310115은 해부 비 및 피질 샘플에서 정량 실시간 QRT-PCR에 의해 평가 하였다. 추가 샘플링은 물에서 재배 식물을 실시 하였다. 값은 물에 비석의 발현을 정상화했다. 오차 막대는 표준 편차를 표현하고 **이 (얀센 등. 2013 13에 따라 프라이머 및 참조 유전자) P - 값 ≤0.01을 의미합니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

애기 LRIS 프로토콜에서, 오직 완전히 NPA 함유 증식 배지와 접촉 성장한 묘목을 전송하는 것이 중요하다. 이 측면 루트 개시는 전체 루트 길이에 걸쳐 차단되는 것을 보장한다. 전송 중에 묘목 부상 방지하기 위해, 만곡 된 포셉 팔 종묘의 자엽 하에서 후크 될 수있다. 전송시, 묘목의 뿌리가 NAA 함유 한천 배지와 충분한 접촉에 있는지 확인하십시오. 이것은 작은 거리에 걸쳐 한천 표면에 뿌리를 감추고에 의해 달성 될 수있다. 이것은 전체 루트 길이에 걸쳐 횡 루트 개시의 효율적인 동기화되도록 유도한다. 뿌리는 부정적인 측면과 성장 루트 유도에 영향을주지 않고 노광 성장 될 수있다.

옥수수 LRIS 프로토콜에서는 커널 잔뿌리 D가 증가 할 루트를 보장하기 위해 아래로 용지를 향해 대면하는 것이 중요ownwards 올바른 측 16 용지에 부착합니다. NPA 처리의 삼일 후, 모종은 작은 촬영, 기본 루트와 정액 뿌리 (16) 커널에서 등장한다. 기본 루트는 측면 루트 개시의 유도에 진행하기 전에 약 2cm 길이이어야한다. 이 프로토콜은 B73 옥수수 근친 라인을 사용하여 개발 된,하지만 다른 성장 속도와 옥수수 라인의 경우에 따라서, 배양 시간을 조정하고있다. 용지 롤은 액체가 시간이 지남에 따라 증발 할 때 비효율적이고 불필요한 초기 측면 루트 개발이 발생할 수 있습니다 될 수 그렇지 않으면, NPA 처리를 정기적으로 50 μm의 NPA 솔루션을 추가하여 젖은 상태로 있는지 확인합니다. 시스템 자체는 빛을 뿌리의 폭발을 방지 할 수 있지만 빛은 큰 문제가되지 않고, 뿌리 성장 및 측면 루트 유도에 영향을 미치지 않는다.

측면 뿌리의 제어 유도하기위한 다른 방법은 멕의 사용이다hanical 23 또는 gravistimulation 24 굽힘. 이러한 시스템의 주요 장점은 LRIS에서 호르몬 치료에 비해 더 '자연'유도를 가지고,하지만 단점은 주어진 시점에서 수확 될 수있는 물질의 양이 제한된다는 것이다 그들 만 때문에 LRIS에서 pericycle의 전체 유도에 비해 묘목 당 벤드의 한 측면 루트 개시 이벤트를 얻을 수 있습니다.

유리한 조건을 최적화 할 필요가 있지만 애기 옥수수에 사용 LRIS은 다양한 식물에 사용될 수있다. 옥신 수송 및 옥신 (2)의 축적 (1)가 횡 방향 차단 루트 개시를 유도 : LRIS를 설치하려면, 연속하는 두 개의 중요한 단계가 달성되어야한다. 성장 시스템은 화합물의 효율적이고 균일하게 흡수를 허용해야하고, 모종의 좋은 개발을 허용해야한다. 고체 배지 (애기 장대)와 종이 롤에 대체 시스템 (이러한 액체 문화, 수경, 또는 aeroponics 같은 옥수수), 다른 종에 사용될 수 있습니다. LRIS에서, 제 1 단계는, 옥신 수송 차단, 옥신 수송 저해제를 첨가함으로써 달성 될 수있다. NPA는 애기 장대와 옥수수에서 측면 루트 개시의 효율적인 블록에 이르게하지만 이러한 2,3,5- triiodobenzoic 산 (TIBA) 또는 P-chlorophenoxyisobutyric 산 (MG245X-EVB)와 같은 다른 화합물은 다른 종에서 더 잘 작동 할 수 있습니다. 유사한 최적화 LRIS 즉, 옥신 처리의 두 번째 단계에 대해 수행 될 수있다. NAA 보인다 합성 옥신은 LRIS에 가장 적합합니다. 또한 강하게 좌우 뿌리를 유도하고 다른 설비 (25), (26). 한편, 천연 옥신 인돌 -3- 아세트산 높은 생체 활성을 갖는 한 옥신 전구체 인돌 -3- 부티르산 (IBA)이 좋은 대안이 될 수도 (IAA)는 덜 안정적이고 더 쉽게 루트 (STABLE)에 자사의 약한 효과를 합리화, 27 대사예를 들어 옥수수 나 쌀 25, 26에 opment. 합성 옥신 2,4- 디클로로 페녹시 아세트산 (2,4D)이 pericycle 세포에서 고도의 축적이 셀 (28)에서 내 보낸되지 부분적으로 있기 때문에, 적절한 측면 루트 개시를 손상 인공 유도 융합 구조. 또한 12 naxillin 같은 옥신 경로로 작용하는 다른 화합물은 애기 장대에서 횡 루트 개시를 유도하는 것으로 나타났다 및 다른 종에서 시험 할 수있다.

어떤 경우에는, 발아 NPA의 존재 비효율적이고 하나는 제이어서 NPA - 함유 시스템과 모종을 전송, NPA의 부재하에 씨를 발아하도록 선택할 수도있다. 이것은 단지 NPA 처리시 신장 루트의 영역을 샘플링에 따라서, 그것은 중요 NAA 처리와 함께 측면 루트 유도 전에 시작 초기 측면 루트 primordia를 갖는 가능한 위험을 유도한다. 이 일반적인 전략에 따라, 하나 우거의 모든 (종자) 식물에 대한 LRIS을 최적화 할 수 자민련과 같은 쉬운 시스템을 가지고 관심의 식물에 대한 측면 루트 개발을 연구. 애기위한 예시 횡 루트 개시의 타이밍의 또 다른 특성은, 마커 라인을 통해 발생할 수있다. 마커 라인 구하기 어려운 경우, 상세한 조직 학적 연구는 수행 될 수 있지만, 이것은 시간 소모적이며, 제 1 셀 분할을 쉽게 인식 할 수 없다. 대안 적으로, 세포 분화 마커의 발현 분석은 제 1 셀의 분할 타이밍을 나타 내기 위해 사용될 수있다.

LRIS는 전 사체 분석 결과로서 간단히 9-13에서 설명뿐만 아니라 횡 루트 개시 14시 육안 및 현미경 수준에서의 조직 학적 관찰과 같은 다른 목적을 위해 사용될 수있다. 기관에서 세포 규모 (29)에 이르기까지 샘플링의 종류는, 이후의 다양한 측면을 탈피 허용 할 수 있습니다알 루트 개시. 또한 LRIS는 횡 루트 개시 12, 30에 상이한 화합물의 효과를 모니터링하는 데 사용될 수있다. 마지막으로, 리포터 라인을 사용하여, LRIS 사용할 수도있다 쉽게 횡 동안 유전자 발현 및 / 또는 단백질 지역화 특성화 루트 개발.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자가 공개하는 게 없다.

Materials

Name Company Catalog Number Comments
ARABIDOPSIS LRIS
Seeds
Arabidopsis seeds Col-0 ecotype
Gas sterilization of seeds
micro-centrifuge tubes 1.5 ml SIGMA-ALDRICH 0030 125.215 Eppendorf microtubes 3810X, PCR clean
micro-centrifuge tubes 2 ml SIGMA-ALDRICH 0030 120.094 Eppendorf Safe-Lock microcentrifuge tubes
hydrochloric acid Merck KGaA 1,003,171,000 37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu
glass desiccator SIGMA-ALDRICH Pyrex
glass beaker
plastic micro-centrifuge tubes box or holder
Bleach sterilization of seeds
ethanol Chem-Lab nv CL00.0505.1000 Ethanol, abs. 100% a.r. dilute to 70%
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
Tween 20 SIGMA-ALDRICH P1379
sterile water
Growth medium
Murashige and Skoog salt mixture DUCHEFA Biochemie B.V. M0221-0050
myo-inositol SIGMA-ALDRICH I5125-100G
2-(N-morpholino)ethanesulfonic acid (MES) DUCHEFA Biochemie B.V. M1503.0100
sucrose VWR, Internation LLC 27483.294 D(+)-Sucrose Ph. Eur.
KOH Merck KGaA 1050211000 pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur
Plant Tissue Culture Agar LabM Limited MC029
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 10 µM (Arabidopsis)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 10 µM (Arabidopsis)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Making a mesh for transfer
nylon mesh Prosep byba Synthetic nylon mesh 20 µm
Sowing and seedling handling
square petri dish plates GOSSELIN BP124-05 12 x 12 cm
50 ml DURAN tubes SIGMA-ALDRICH CLS430304 Corning 50 ml centrifuge tubes
drigalski Carl Roth K732.1
pipette
cut pipette tips Daslab 162001X Universal 200, cut off 5 mm of tip before autoclaving
breathable tape  3M Deutschland GmbH cat. no. 1530-1
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
Growth conditions
growth room 21 °C, continuous light
Materials Company Catalog Comments
MAIZE LRIS
Seeds
Maize kernels B-73
Bleach sterilization of kernels
glass beaker
magnetic stirrer  Fiers nv/sa C267.1
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
sterile water
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 50 µM (maize primary root), 25 µM (maize adventitious root)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 50 µM (maize)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Sowing and seedling handling
paper hand towels Kimberly-Clark Professional* 6681 SCOTT Hand Towels - Roll / White; sheet size (24 x 46 cm)
seed germination paper Anchor Paper Company 10 X 15 38# seed germination paper
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
250 ml (centrifuge) tubes SCHOTT DURAN 2160136 approx. 5.6 cm diameter and 14.7 cm height 
700 ml tubes DURAN GROUP 213994609 cylinders, round foot tube, D 60  x 250
rack for maize tubes, home made
sterile water
Growth conditions
growth cabinet 27 °C, continuous light, 70% relative humidity

DOWNLOAD MATERIALS LIST

References

  1. Van Norman, J. M., Xuan, W., Beeckman, T., Benfey, P. N. To branch or not to branch: the role of pre-patterning in lateral root formation. Development. 140, 4301-4310 (2013).
  2. Dolan, L., et al. Cellular organisation of the Arabidopsis thaliana root. Development. 119, 71-84 (1993).
  3. Bell, J. K., McCully, M. E. A histological study of lateral root initiation and development in Zea mays. Protoplasma. 70, 179-205 (1970).
  4. Benkova, E., et al. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell. 115, 591-602 (2003).
  5. Beeckman, T., Burssens, S., Inzé, D. The peri-cell-cycle in Arabidopsis. J. Exp. Bot. 52, 403-411 (2001).
  6. Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inzé, D., Beeckman, T. Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell. 14, 2339-2351 (2002).
  7. Jansen, L., Parizot, B., Beeckman, T. Inducible system for lateral roots in Arabidopsis thaliana and maize. Methods Mol Biol. 959, 149-158 (2013).
  8. Casimiro, I., et al. Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell. 13, 843-852 (2001).
  9. Himanen, K., et al. Transcript profiling of early lateral root initiation. Proc. Natl. Acad. Sci. USA. 101, 5146-5151 (2004).
  10. De Smet, I., et al. Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root. Science. 322, 594-597 (2008).
  11. Vanneste, S., et al. Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana. Plant Cell. 17, 3035-3050 (2005).
  12. De Rybel, B., et al. A role for the root cap in root branching revealed by the non-auxin probe naxillin. Nat. Chem. Biol. 8, 798-805 (2012).
  13. Jansen, L., et al. Comparative transcriptomics as a tool for the identification of root branching genes in maize. Plant Biotechnol. J. 11, 1092-1102 (2013).
  14. Parizot, B., et al. Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation. Plant Physiol. 146, 140-148 (2008).
  15. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 15, 473-497 (1962).
  16. Bellini, C., Pacurar, D. I., Perrone, I. Adventitious roots and lateral roots: similarities and differences. Annu Rev Plant Biol. 65, 639-666 (2014).
  17. Grunewald, W., Parizot, B., Inzé, D., Gheysen, G., Beeckman, T. Developmental biology of roots: One common pathway for all angiosperms? Int. J. Plant Dev. Biol. 1, 212-225 (2007).
  18. Parizot, B., Beeckman, T. Genomics of root development. Root Genomics and Soil Interactions. Crespi, M. 3-28 (2012).
  19. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. Journal of visualized experiments : JoVE. (2010).
  20. Nakazono, M., Qiu, F., Borsuk, L. A., Schnable, P. S. Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize. Plant Cell. 15, 583-596 (2003).
  21. Ludwig, Y., Hochholdinger, F. Laser microdissection of plant cells. Methods Mol Biol. 1080, 249-258 (2014).
  22. Beeckman, T., Engler, G. An easy technique for the clearing of histochemically stained plant tissue. Plant Mol. Biol. Rep. 12, 37-42 (1994).
  23. Ditengou, F. A., et al. Mechanical induction of lateral root initiation in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA. 105, 18818-18823 (2008).
  24. Lucas, M., Godin, C., Jay-Allemand, C., Laplaze, L. Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation. J. Exp. Bot. 59, 55-66 (2008).
  25. Wang, S., Taketa, S., Ichii, M., Xu, L., Xia, K., Zhou, X. Lateral root formation in rice (Oryza Sativa. L.): differential effects of indole-3-acetic acid and indole-3-butyric acid. Plant Growth Regul. 41, 41-47 (2003).
  26. Martinez-de la Cruz, E., Garcia-Ramirez, E., Vazquez-Ramos, J. M., Reyes de la Cruz, H., Lopez-Bucio, J. Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings. J Plant Physiol. 176, 147-156 (2015).
  27. Beyer, E. M., Morgan, P. W. Effect of ethylene on uptake, distribution, and metabolism of indoleacetic acid-1-14C and -2-14C and naphthaleneacetic acid-1-14C. Plant Physiol. 46, 157-162 (1970).
  28. Delbarre, A., Muller, P., Imhoff, V., Guern, J. Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta. 198, 532-541 (1996).
  29. Bailey-Serres, J. Microgenomics: genome-scale, cell-specific monitoring of multiple gene regulation tiers. Annu Rev Plant Biol. 64, 293-325 (2013).
  30. Perez-Torres, C. A., et al. Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor. Plant Cell. 20, 3258-3272 (2008).
의 측면 루트 유도 성 시스템<em&gt; 애기 장대</em&gt;과 옥수수
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).More

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter