Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Lateral Root Induserbare System i doi: 10.3791/53481 Published: January 14, 2016
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Rotsystemet er avgjørende for plantevekst, da det sikrer forankring og opptak av vann og næringsstoffer fra jorden. På grunn av at utvidelsen av et rotsystem hovedsakelig er avhengig av produksjonen av lateral røtter, har sin initiering og dannelse blitt mye studert. Lateral røtter er initiert i en bestemt undergruppe av pericycle celler, kalt grunnleggeren celler 1. I de fleste dicots, slik som Arabidopsis thaliana, er disse cellene plassert ved protoxylem polene 2, mens det i enfrøbladete planter, så som mais, er de funnet på barken polene 3. Grunnlegger-celler er merket med et øket auxin respons til 4, etterfulgt av ekspresjon av spesifikke cellesyklus-gener (for eksempel cyklin B1; 1 / CYCB1, 1), hvoretter de gjennomgår en første runde av asymmetriske anticlinal divisjoner 5. Etter en rekke koordinerte anticlinal og periclinal divisjoner, er en lateral root primordium dannet som til slutt vil fremstå som en enutonomous lateral root. Plasseringen og timing av lateral root initiering er imidlertid ikke forutsigbar, siden disse hendelsene er verken rik eller synkronisert. Dette vanskeliggjør bruk av molekylære metoder som transcriptomics å studere denne prosessen.

Å takle dette, har en Lateral Root induserbar System (LRIS) er utviklet 6, 7. I dette systemet, er frøplanter først behandlet med N -1-naphthylphthalamic syre (NPA), som hemmer auxin transport og oppbygging, dermed blokkerer lateral root initiering 8. Ved deretter å overføre frøplante til medium inneholdende det syntetiske auxin 1-naftalen-eddiksyre (NAA), svarer hele pericycle laget til de forhøyede nivåene auxin derved massivt induserende laterale rot initiere celledel 6. Som sådan, fører dette systemet til raske, synkrone og omfattende lateral røtter innvielser, noe som gir enkel samling av rot prøver beriket for et bestemt stadium av senral rot utvikling. Deretter kan disse prøvene brukes til å bestemme på genom uttrykk profil ved lateral rot formasjonen. Den LRIS har gitt allerede betydelig kunnskap om lateral root innvielse i Arabidopsis og mais 9-13, men behovet for å bruke dette systemet til andre plantearter blir mer tydelig etter hvert som flere genomer er sekvensert, og det er en økende interesse for å overføre kunnskap til økonomisk viktig arter.

Her er de detaljerte protokoller for Arabidopsis og mais LRISs gitt. Deretter blir et eksempel på bruk av systemet gitt, ved å illustrere hvordan transcriptomics data oppnådd fra mais LRIS kan brukes til å identifisere funksjonelle homologer som har en konservert funksjon under lateral rot initiering tvers av forskjellige plantearter. Endelig retningslinjer optimalisere LRIS for andre plantearter er foreslått.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Arabidopsis LRIS Protocol

Merk: Teksten refererer til "små" eller "store" skala eksperimenter. Småskala eksperimenter, slik som markør line analyse og histologisk farging 6, 14, krever bare noen få eksempler. Storskalaforsøk som kvantitativ real-time QRT-PCR, mikro-arrays 9-11 eller RNA-sekvensering, krever en større mengde av prøver. Som sådan, i en mengde på ~ 1000 frøplanter pr prøve ble brukt ved Vanneste et al. 11 utfører mikroarray eksperimentet etter rot segment disseksjon.

DAG 1

  1. Sterilisering av Arabidopsis Seeds
    Merk: Velg ett av følgende prosedyrer for frø sterilisering. Noen av dem er egnet for de neste trinnene i protokollen. Gassterilisering (1.1.2) presenterer to hoved fordeler fremfor flytende sterilisering (1.1.1): det tar kortere tid ved håndtering av en stor nummeneh av frø, siden ingen pipettering må skje for de enkelte prøvene; og de steriliserte frøene kan lagres for en lengre periode. Men det krever en eksikator og forsiktig håndtering.
    1. Flytende sterilisering
      1. Hell ønsket antall frø i mikro-sentrifugerør. Bruk opp til 20 mg (~ 800 frø) i en 1,5 ml tube eller 40 mg (~ 1600 frø) i en 2 ml mikro-sentrifugerør.
      2. Tilsett 1 ml 70% etanol. Snu eller rist i 2 min.
      3. Sett på 70% etanol med 1 ml oppløsning sterilisering i 15 min. (Forbered fersk sterilisering løsning: 3,85 ml natriumhypokloritt (NaOCl) lager (12%) (OBS: Bruk ryke hette), 5 pl Tween 20, opp til 10 ml med vann Snu rørene flere ganger for å være sikker på at alle frø kommer. i kontakt med oppløsningen.
      4. I en laminær luftstrøm skap, erstatte sterilisering løsning med 1 ml sterilt destillert vann og skyll frøene 5 ganger for 5 min med gjentattly erstatte med 1 ml friskt sterilt destillert vann.
    2. Gassterilisasjon
      1. Hell ønsket antall frø i en 2 ml mikrosentrifuge-rør. Bruke individuelle rørene når du arbeider med flere uavhengige linjer, og ordne dem åpnet i en plast mikro-sentrifugerør boks eller innehaveren. Hvis antall frø i en tube overstiger 500 (12,5 mg), dele frøene i riktig antall rør for å sikre en vellykket sterilisering. Pass på at Caps i nabo rør ikke dekker hverandre. Passer sammen lokket på esken på bunnen, så det må være i eksikkator samt for sterilisering.
      2. Plasser boksen i bollen av et tørke, sammen med et glass beger (FORSIKTIG: Bruk avtrekk).
      3. Fyll begeret med 100 ml 12% NaOCl (FORSIKTIG: Bruk avtrekk). Sett lokket på eksikkatoren, men la en liten åpning hvor begeret er plassert.
      4. Tilsett 3 ml av 37% saltsyre (rykende) (CAUSJON: Bruk ryke hette) til begeret gjennom den lille åpningen og raskt lukke eksikkator. Løsningen vil boble en stund på grunn av Cl 2-gass formasjon. La systemet lukkes O / N (eller minst 8 timer).
      5. Fjerne lokket fra eksikatoren. Ta ut boksen og dekke den med lokket for å unngå forurensning under transporten.
      6. Sett boksen i en laminær luftstrøm skap, ta av lokket og la frøene i ca 1 time ved RT for å tillate gass utgivelse.
        Note: Frø kan trygt lagret tørt i lukkede mikro-sentrifugerør for inntil to uker ved 4 ° C.
  2. Lateral Root Induksjon i Arabidopsis
    1. Lateral Root Hemming (NPA Treatment)
      1. Forbered vekstmedium for in vitro vekst. Mediet inneholder halv styrke Murashige og Skoog saltblanding 15, 0,1 g / l myo-inositol, 10 g / l sukrose, og er bufret med 0,5g / l 2- (N-morfolino) etansulfonsyre (MES).
      2. Juster pH til 5,7 med 1 M KOH. Tilsett 8 g / l av plantevev agar og autoklaveres mediet i 20 minutter ved 121 ° C.
      3. Forbered en 25 mM stamløsning av Norsk Folkehjelp i dimetylsulfoksyd (DMSO) (OBS: Bruk hansker). I en laminær luftstrøm kabinett, avkjøle den autoklaveres mediet ned til omtrent 65 ° C (som er den temperatur ved hvilken flasken kan holdes for hånd), og tilsett 25 mM NPA-stamløsning for å oppnå en sluttkonsentrasjon på 10 uM NPA.
      4. Homogeniseres etter tilsetning ved forsiktig risting av flasken i 10 sek. Hell 50 ml medium per kvadrat petriskål (12 cm x 12 cm).
        Merk: Ved storskala eksperiment, bruke en nylon mesh (20 mm) for å sikre enkel overføring. Forbered en mesh (9 cm x 9 cm) for autoklave (figur 1A). Når autoklavert, påføre maske til vekstmediet ved hjelp av sterile pinsetter (figur 1B). Skyv mesh til vekstmedium med en sterilized drigalsky å sørge for at den er i god kontakt med vekstmedium (figur 1B) (OBS: Arbeid i sterile forhold).
      5. Sår frøene på NPA-plater.
        Merk: I tilfelle en storstilt eksperiment er planlagt, purke 2 tette og godt justert rader med 50 frø til rette for prøvetaking (se 1.2.2.3).
        1. Ved flytende sterilisering, så frø på NPA-plater ved hjelp av en 200 mL pipette. Klipp av 3 - 4 mm i slutten av pipettering tips i sterile forhold (eller før sterilisering av tipsene) for å kunne pipettér frøene. Pipet opp og ned et par ganger for å re-suspendere frøene, da pipettér ca 150 mL sterilt vann med 10 - 20 frø og vente til frø sediment på bunnen av spissen. (OBS: Arbeid i sterile forhold)
          Merk: Når berøre agar eller mesh forsiktig med spissen, vil en vanndråpe med et frø bli gitt ut fra den (figur 1C).
        2. <li> I tilfelle av gass sterilisering, så frøene ved hjelp autoklaveres toothpicks.Pinch tannpirker inn i agar før du tar frøene for å sikre en klebrig overflate. Plukk opp frø én etter én med tannpirker og fordele frøene på platene (figur 1D). Alternativt legge sterilt vann til frøene, og sår som beskrevet i 1.2.1.5.1 (OBS: Arbeid i sterile forhold).
      6. Forsegl platene med pustende klebebånd og lagre dem platene ved 4 ° C i mørke i minst 2 dager og maksimalt en uke. Dette er nødvendig for stratifisering og sikrer synkronisert og mer effektiv spiring.
        Merk: Alternativt kan frø stratifisert før såing, nedsenket i destillert vann i mikro-sentrifuge rør, som krever mindre kjøleskap plass. I dette tilfellet, lagre rørene i minst en uke ved 4 ° C, og bevege platene til veksten skapet umiddelbart etter såing (se 1.2.1.7).
        DAG 3 Bevege platene til vekst kabinettet (kontinuerlig lys (110 m μE -2 s-1), 21 ° C) i 5 dager (2 dager for spiring og 3 dagers vekst) i en nesten vertikal stilling (80 til 90 °) for å sikre rotvekst på, og ikke i mediet.
        Dag 8
    2. Lateral Root Induksjon (NAA Treatment)
      1. Forbered samme vekstmedium som beskrevet i 1.2.1.1 og 1.2.1.2. Forbered en 50 mM stamløsning av NAA i DMSO (OBS: Bruk hansker). Avkjøl autoklaveres mediet ned til 65 ° C og tilsett NAA løsning til mediet for å oppnå en sluttkonsentrasjon på 10 uM NAA (FORSIKTIG: Arbeid i sterile betingelser).
        1. Homogeniseres etter tilsetning ved forsiktig risting av flasken i 10 sek. Hell 50 ml medium per kvadrat petriskål (12 cm x 12 cm).
      2. Overfør frøplantene fra skåler inneholdende vekstmedium supplert med 10 uM NPA for de supsuppleres med 10 mm NAA.
        1. Hekt armer buede pinsett under cotyledons av frøplante og forsiktig fjerne den fra platen. Bare overføre frøplanter av hvilke røttene har vokst helt i kontakt med NPA-vekstmedium og fortrinnsvis nedover.
        2. Skumme roten over NAA-inneholdende vekstmedium overflate over en liten distanse. Sørg for at planterøttene er i god kontakt med vekstmedium. Hvis det er nødvendig, trykker roten forsiktig til vekstmediet overflaten med pinsett.
          Merk: Ved en storstilt eksperiment, fjerne alle frøplanter som ikke er i kontakt med mesh og overføring ved å løfte mesh på de to øverste hjørnene med pinsett. Kontroller at maskene er i god kontakt med NAA-inneholdende medium ved skimming maske over agaroverflaten over en liten distanse (figur 1E).
      3. Forsegle de nye platene med pustende tape og plassere dem i veksten kabinett (conkontinuerlig lys (110 m μE -2 s-1), 21 ° C) i en vertikal posisjon for den ønskede tid etter induksjon før prøvetaking.
        Merk: Ved en storstilt eksperiment, bruk en skalpell til å kutte roten segmentene på en gang direkte på nett og prøve dem ved å forsiktig skrape overflaten av mesh.

2. LRIS Maize Protocol

  1. Lagdeling av Mais Kjerner
    1. Inkuber maiskjerner ved 4 ° C i mørke i minst en uke.
      Merk: Denne protokollen er utviklet ved hjelp av B73 mais innavlet linje.
  2. Sterilisering av Mais Kjerner
    DAG 1
    Merk: Selv om mais frøplanter ikke trenger å bli dyrket i sterile forhold, anbefales det å sterilisere mais kjerner og jobbe med sterilt materiale for å hindre soppvekst i papirrullensystem.
    1. Sett det nødvendige antall maiskjerner i et sterilisert glass beger.
    2. Tilsett 100 ml sterilisering løsning (6% NaOCl i vann) (OBS: Bruk avtrekk).
    3. Legg til en magnetisk rørestav og plassere begeret på en magnetrører ved lav rørehastighet (ca. 250 rpm) ved RT i 5 min.
    4. Skyll fem ganger i 5 min ved erstatning av oppløsningen med 100 ml friskt sterilt vann.
  3. Såing Mais Kjerner
    1. Ta på hansker for å redusere risikoen for smitte, og ta en rull med papirhåndklær.
    2. Riv av to strekninger av håndkle papir med en total lengde på to ark (ca 92 cm x 24 cm) og legg dem oppå hverandre på en ren overflate (Figur 2A).
    3. Brett arkene dobbelt over lengden (ca. 92 cm x 12 cm) (Figur 2A).
    4. Bruk pinsett til å distribuere 10 kjerner på ca 2 cm fra toppen over than hele lengden av papir, samtidig som et mellomrom på 8 cm mellom hver kjerne og 8 cm fri ved begge ender (figur 2B). Kontroller at radicle av kjernen vender ned og mot papiret (figur 2B).
    5. Forsiktig rulle papiret over lengden, samtidig som frøene på plass (figur 2B). For å lette valsingen, er det valgfritt å spraye første papiret med sterilt vann.
    6. Sett papirruller i steriliserte glass rør på ca 6 cm i diameter og 14 cm høyde (f.eks 250 ml sentrifugerør) og plassere dem i et stativ (figur 2C).
  4. Lateral Root Induksjon i Maize
    1. Forbered en 50 mM NPA stamløsning (oppløst i DMSO) (OBS: Bruk hansker).
    2. For hvert rør, kan en 50 uM NPA-løsning ved å tilsette 125 ul fra 50 mM NPA stamløsning til 125 ml sterilt vann i et sterilisert glassbeger.
    3. Bland godt ogHell 125 ml av 50 mM NPA løsning over papirrullen i røret. Papirrullen vil absorbere løsningen og bli helt gjennomvåt.
      Merk: Ved bruk av papirruller og rør med andre dimensjoner, justere volumet tilsvarende. Væsken skal nå halvveis av røret for å sikre tilstrekkelig opptak.
    4. Plasser papirrull-systemet i en vekst skap i tre dager (27 ° C, kontinuerlig lys, 70% relativ fuktighet). Sørg for at papirruller forbli gjennomvåt ved å legge til ekstra 50 M NPA løsning, siden løsningen fordamper over tid (figur 2D).
      DAG 4
    5. Forbered en 50 mM NAA stamløsning (oppløst i DMSO) (OBS: Bruk hansker).
    6. For hvert rør, forberede en 50 mikrometer NAA løsning ved å legge 125 mL fra 50 mM NAA aksjen til 125 ml sterilt vann i et sterilisert glass beger.
    7. Klem forsiktig ut det meste av den gjenværende NPA løsning fra papirruller og plasserm i sterilt vann i 5 min for å vaske det ut (FORSIKTIG: Bruk hansker). Klem forsiktig ut mesteparten av vannet fra papirruller. Gjenta dette vasketrinn tre ganger.
    8. Bland godt og hell 50 M NAA løsning i løpet av de papirruller i rørene. Sørg for at de er helt gjennomvåt.
    9. Plasser papirrullen system i veksten skapet (27 ° C, kontinuerlig lys, 70% relativ fuktighet) for ønsket varighet etter induksjon.
  5. Lateral Root Induksjon i adventitious Crown Roots of Maize
    Merk: LRIS som beskrevet ovenfor induserer lateral røtter i primær roten. Men i mais og andre Enfrøbladede, primær rot og de embryonale nyskapende røtter, sammen med sine lateral røtter, er hovedsakelig viktig under frøplante utvikling. På et senere stadium i plantevekst, etter embryonale adventivskudd røtter oppstår på stammen, og også utvikle lateral røtter for å danne et nytt rotsystem 16. Den LRIS kan også være brukd å indusere lateral røtter på disse post-embryonale adventivskudd krone røtter ved å følge noen mindre justeringer i LRIS på embryonale primære roten.
    1. For å gjøre papirruller, lage en sandwich av papirer med henholdsvis to lag med håndkle papir på yttersiden, og to lag med spiring papir innenfor. Plasser steriliserte kjerner (se trinn 02.01 til 02.02) i mellom to ark av spiring papir. Spiring papir, sammenlignet med håndkle papir, vil være mindre tilbøyelig til å bli gjennomtrengt av rothår og lateral røtter, som vil gjøre åpningen av papiret ruller lettere senere. På den annen side, vil de to ytre lag av håndkle papir lette absorpsjon av væsken.
    2. Sett rullene i 700 ml glassrør og hell sterilt vann uten NPA over dem. Sørg for at de er helt gjennomvåt.
    3. Spire de steriliserte kjerner i vekst kabinettet (se trinn 2.4.9).
    4. Grow spirene til de adventitious krone røtterbegynner å dukke opp (6 dager for B73). Kontroller at papirruller holdes fuktig hele tiden ved å legge sterilt vann når det er nødvendig.
    5. Overføring til en 25 uM løsning NPA i 4 dager (se trinn 2.4.1 til 2.4.4), etterfulgt av en tilsvarende induksjon av lateral rot initiering ved erstatning av NPA-løsning med en 50 mM løsning NAA etter et vasketrinn (se trinn 2.4 0,5 til 2.4.9).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bruk av LRIS å utføre Sammenlignings transcriptomics av Lateral Root Initiation Process

En anvendelse av LRIS er sammenligningen og korrelasjonen av genekspresjonsprofiler under lateral rot-dannelse i forskjellige arter. Sammenlignings transcriptomics nærmer skape mulighet for å fastslå ortologe gener som er involvert i den laterale rot utviklingsprosessen i ulike arter. Lateral rot initiering, som består av dannelse av en ny organ fra en undergruppe av celler inneholdt i en allerede dannet rot akse, er hovedmekanismen delt av angiosperms å kontrollere deres rot-arkitektur. Derfor er det svært sannsynlig at det utviklet seg fra eksisterende trasé til stede i en felles stamfar, og ble bevart gjennom evolusjonen. Faktisk har felles potensielle regulatorer av lateral root initiering blitt funnet i forskjellige arter <sup> 17, 18.

Prøvetaking Material bruker LRIS i Arabidopsis og mais, og transkriptom analyse

Den LRIS er etablert i to forskjellige arter. Arabidopsis og mais 10, 13 I begge arter, ble det besluttet å prøve plantene rett før NAA behandling, og kort tid etter induksjon, ved utbruddet av, eller i løpet av auxin respons, som vel som ved starten av eller i løpet av de første avdelinger i den pericycle. Videre Fluorescence Activated Cell Sorting 19 (FACS) ble brukt i Arabidopsis eller lasermikros Capture 20, 21 (LCM) i mais å selektere for pericycle celler. I Arabidopsis, ble tidspunktene for to og seks timer etter induksjon valgt basert på den transkripsjonelle karakteriseringen av pDR5 :: GUS auxin respons og pCYCB1; 1 :: GUS cellesyklus iletau 9 (figur 3). I mais, peker den tid to, tre og fire timer etter induksjon, ble valgt etter mikroskopisk karakterisering av celledeling aktivitet og analyse av flere cellesyklus markørgener ekspresjon ved hjelp av sanntids-kvantitativ revers transkripsjon polymerasekjedereaksjon (QRT-PCR) 13 . RNA ble ekstrahert fra de isolerte celler og hybridisert på microarray plattformer som tidligere beskrevet, 10, 13.

Finne ortolog av Arabidopsis CYCB1; 1 (AtCYCB1; 1) i Maize

I Arabidopsis, markørlinjen pCYCB1; 1 :: GUS har vært mye brukt til å spore de første divisjonene i pericycle under lateral root innvielse. En slik markør kan være megetnyttige i mais. Flere homologer av AtCYCB1; 1 ble funnet i mais (www.maizesequence.org, alle peptider, BLASTP, standardinnstillinger). Seks av dem var til stede på microarray utført etter LRIS i mais og viste betydelig berikelse. Den beste BLAST hit, GRMZM2G310115, viste svært høye transkripsjons nivåer etter LRIS, tilsvarende det som ble observert i Arabidopsis for AtCYCB1; 1 (figur 4).

Bruk av LRIS å sjekke Individuell Gene Expression

For å validere GRMZM2G310115 som en god kandidat ortolog av AtCYCB1; en i mais lateral root initiering, en real-time QRT-PCR på prøver tatt ved ulike tidspunkt ble utført i løpet av en LRIS 13. Plantene ble behandlet som beskrevet i den ovennevnte protokoll og høstet ved forskjellige tidspunkter: før NAA behandling (NPA), og etter to, tre og fire timers behandling av NAA. Også materiale av planter dyrkes bare i vann ble høstet for å sammenligne genuttrykk mellom LRIS og nøytrale forhold. Umiddelbart etter høsting, rot segmenter som tilsvarer et område på mellom 5 mm og 15 mm over rotspissen ble dissekert under kikkerten. Ved hjelp av pinsett, ble cortex skilt fra stele (som inneholder pericycle), og RNA ble ekstrahert fra begge vevene. Dette siste trinnet ble utført i stedet for LCM, fordi det er mye raskere og billigere for validering. Med følgende respektive framover og bakover QRT-PCR primere, AGCAGGACGCAGTTGGAGAG og GAGCCGAGAGCACAGAAGAAAG ble GRMZM2G310115 validert å være oppregulert ved LRIS, og for å være spesifikk for stele vev (figur 5). I tillegg viser dette eksperimentet at uten synkron induksjon, de diskrete hendelsene i lateral root initiering skjer i en rot vokser i vann er ikke oppdages, og illustrerer behovet for LRIS å avsløre differensial genekspresjon i forbindelse med prosessen for lateral rot initiering.

Figur 1
Figur 1. Lateral Root Induserbare System for Arabidopsis (A) Klar nylon mesh (20 mikrometer). Kutte nylon mesh (9 cm x 9 cm), pakk den inn i aluminiumsfolie og legg den i en glassbeholder for autoklavering. (B) Påfør nylon mesh på en NPA holdig plate (10 mm) ved hjelp av pinsett. Deretter bruker en steril Drigalski for å eliminere luftbobler. (C) sådd frø på nylon mesh ved hjelp av en pipette. (D) så frø på nylon mesh bruker en tannpirker. (E) Overfør nylon mesh til en NAA-inneholdende plate (10 mm) ved hjelp av en pinsett.81 / 53481fig1large.jpg "target =" _ blank "> Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2. Lateral Root Induserbare System for Maize.   (A) Klarpapirruller: place to lag papir (92 cm x 24 cm, lengde på to ark) på toppen av hverandre og brett dem dobbelt over lengden (92 cm x 12 cm). (B) Sett 10 steriliserte mais kjerner med radicle vendt ned på papiret på 2 cm fra toppen med en interspacing på 8 cm. Deretter rulle opp papiret samtidig som mais kjerner på plass. (C) Plasser papirruller i rør (f.eks 250 ml sentrifugerør) og legg dem i en rack. (D) Grow mais frøplanter i tre dager i en 50 M NPA løsning (ved 27 ° C, kontinuerlig lys, relativ HUMIdity 70%). (E) Venstre: frøplante like før overføring til NAA; Midten: mikrotom tverrgående seksjoner like før overføring til NAA og 2 dager etter overføring til NAA; Høyre:. Frøplante med synlige dukket lateral røtter 5 dager etter overføringen til NAA Klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3. Lateral Root Initiation stimuleres Ved Langvarig NAA Treatment. (AF) Tid løpet viser auxin respons under en NAA behandling med pDR5 :: GUS markør linje. Den auxin respons, som er en av de første hendelsene utløsende lateral rot initiering begynner 2 timer etter start av NAA behandlingen. I det øvre panelet, er en oversikt over hele frøplante gitt; nedre panel showeter den auxin respons i roten spissen. (GM) Tid løpet av en NAA behandling ved hjelp av pCYCB1; 1 :: GUS markør linje. GUS-signalet representerer ekspresjon av CYCB1, 1-genet, noe som indikerer at de første celledelinger som fører til lateral rot dannelse starte 6 timer etter starten av NAA behandlingen. I det øvre panelet, er en oversikt over hele frøplante gitt; nedre panelet viser CYCB1;. 1 uttrykk i rotspissen (GUS farging ifølge Beeckman og Engler 1994 22) Klikk her for å se en større versjon av dette tallet.

Figur 4
Figur 4. Expression Profil CYCB1 Gener i Arabidopsis og mais i løpet LRIS.   (A) Microarray uttrykk verdier av AtCYCB1; en i løpet LRIS som beskrevet av De Smet et al. 2008 10 (B) Microarray uttrykk verdier av potensielle ortologer av AtCYCB1; 1 under LRIS som beskrevet av Jansen et al. 2 013 13 BLASTP poengsum er poengsummen oppnådd når sprengningsproteinsekvensen av AtCYCB1; en på maisgenomet. Feilfelt uttrykke standardavvik og ** står for en p-verdi ≤0.01. Klikk her for å se en større versjon av dette tallet.

Figur 5
Figur 5. Uttrykk av GRMZM2G310115 i Stele og Cortex Mais Roots under LRIS. Uttrykket av <em> GRMZM2G310115 under LRIS i mais ble evaluert av kvantitativ real-time QRT-PCR på dissekert stele og cortex prøver. En supplerende prøvetaking ble utført på planter dyrket på vann. Verdier ble normalisert for uttrykk i stele i vann. Feilfelt uttrykke standardavvik og ** står for en p-verdi ≤0.01 (primere og referanse gener ifølge Jansen et al. 2013 13). Klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I Arabidopsis LRIS protokollen, er det viktig å bare overføre spirene som har vokst helt i kontakt med NPA-inneholdende vekstmedium. Dette sikrer at lateral rot initiering blokkert over hele roten lengde. For å hindre at småplantene såret under overføringen, kan armene av de buede tang hektes under cotyledons av frøplante. Ved overføring, sørg for at de frøplante røtter er i tilstrekkelig kontakt med NAA holdige agar medium. Dette kan oppnås ved skumming roten over agaroverflaten over en liten distanse. Dette vil sikre en effektiv synkronisert induksjon av lateral rot initiering i den totale lengde roten. Røttene kan dyrkes utsettes for lys uten negativt påvirker deres vekst og lateral root induksjon.

I mais LRIS protokollen, er det viktig at radicle av kjernen vender nedover og mot papiret for å sikre at roten vokser downwards og feste til papiret på riktig side 16. Etter tre dager med NPA behandling, bør frøplantene har dukket opp fra kjernen med en liten shoot, en primær rot og nyskapende røtter 16. Den primære roten bør være ca 2 cm lang tid før du går videre til induksjon av lateral root innvielse. Denne protokollen er utviklet ved hjelp av B73 mais innavlet linje, men i tilfelle av en maislinje med en annen vekst, justere inkubasjonstid tilsvarende. Sørg for at papirruller forbli gjennomvåt ved å legge regelmessig 50 M NPA løsning når væsken fordamper over tid, ellers NPA behandling kan være ineffektiv og uønsket tidlig lateral rotutvikling kan oppstå. Systemet i seg selv hindrer utredning av røttene til lyset, men lyset er ikke et stort problem, og påvirker ikke rotvekst og lateral root induksjon.

Alternative metoder for kontrollert induksjon av lateral røtter er bruk av mechanical bøying 23 eller gravistimulation 24. Den største fordelen med disse systemene er at de har en mer "naturlig" induksjon sammenlignet med de hormonbehandlinger i LRIS, men ulempen er at de er begrenset i mengden av materiale som kan høstes på et gitt tidspunkt, fordi de bare dannelse av en lateral rot initiering hendelse i bendet per frøplante forhold til en full induksjon av pericycle i LRIS.

Den LRIS brukes i Arabidopsis og mais kan brukes i en rekke planter, men gunstige betingelser må optimaliseres. Slik installerer du et LRIS, to viktige suksessive trinn må gjøres: (1) blokkering av auxin transport og (2) opphopning av auxin å indusere lateral root innvielse. Den voksende Systemet skal muliggjøre effektiv og enhetlig opptak av forbindelsene og bør tillate god utvikling av frøplantene. Alternative systemer til solid medium (Arabidopsis) og papirruller (mais), for eksempel flytende kultur, hydroponisk dyrking eller aeroponics, kan brukes for andre arter. Det første trinn i LRIS, dvs. blokkering av auxin transport, kan oppnås ved tilsetning av en auxin transport inhibitor. Selv om Norsk Folkehjelp fører til en effektiv blokk med lateral root innvielse i Arabidopsis og mais, alternative forbindelser som for eksempel 2,3,5-trijodbenzoesyre (TIBA) eller p- chlorophenoxyisobutyric acid (PCIB) kan fungere bedre i andre arter. En lignende optimalisering kan bli gjort for det andre trinnet av LRIS, dvs. auxin behandling. Den syntetiske auxin NAA synes å være mest egnet for en LRIS. Den auxin forløper indol-3-smørsyre (IBA) kan være et godt alternativ som det også sterkt induserer lateral røtter og har en høy bioaktivitet i forskjellige planter 25, 26. På den annen side, den naturlige auxin indol-3-eddiksyre (IAA) er mindre stabile og lettere metaboliseres 27, rasjonalisere sin svakere effekt på rot utvikling på for eksempel mais eller ris 25, 26. Det syntetiske auxin 2,4-D (2,4D) akkumulerer i pericycle høyt cellene, delvis fordi den ikke er eksportert fra cellene 28, svekke skikkelig lateral rot initiering og indusere kunstig smeltet strukturer. Også andre forbindelser som vekselvirker med auxin-reaksjonsveier, slik som naxillin 12, har vist seg å indusere lateral rot initiering i Arabidopsis og kan testes i andre arter.

I noen tilfeller er spiring ineffektive i nærvær av NPA og man har til den første frøene spire i fravær av NPA, for deretter å overføre frøplanter til NPA-holdige system. Dette induserer en mulig risiko for å ha tidlig laterale rot primordia igangsatt før lateral rot induksjonsbehandling med NAA, og følgelig er det viktig at kun prøve området av roten som forlenget under NPA behandling. Etter denne generelle strategi, en should være i stand til å optimalisere en LRIS for praktisk talt en hvilken som helst (seed) anlegg og som sådan har et enkelt system for å studere lateral rotutviklingen for planten av interesse. Ytterligere karakterisering av tidspunktet for den laterale rot initiering kan skje via iletau, som er eksemplifisert for Arabidopsis. Dersom iletau er vanskelig å oppnå, kan en detaljert histologisk undersøkelse utføres, men dette er tidkrevende og de første celledelinger ikke er lett gjenkjennelig. Alternativt kan ekspresjon analyse av celledelings markører anvendes for å indikere tidspunktet for den første celledelinger.

Den LRIS kan brukes til ulike formål, for eksempel transkriptomet analyse 9-13 som kort beskrevet i resultatene, samt histologiske observasjoner på makroskopisk og mikroskopisk nivå under lateral root initiering 14. Ulike typer prøvetaking, alt fra organ til celle skala 29, kan tillate rakne ulike aspekter ved senereal root innvielse. I tillegg kan LRIS brukes til å overvåke effekten av forskjellige forbindelser på den laterale rot initiering 12, 30. Til slutt, ved hjelp av reporter linjer, en LRIS kan også brukes for enkelt å karakterisere genekspresjon og / eller protein lokalisering i løpet av sideveis rotutvikling.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Materials

Name Company Catalog Number Comments
ARABIDOPSIS LRIS
Seeds
Arabidopsis seeds Col-0 ecotype
Gas sterilization of seeds
micro-centrifuge tubes 1.5 ml SIGMA-ALDRICH 0030 125.215 Eppendorf microtubes 3810X, PCR clean
micro-centrifuge tubes 2 ml SIGMA-ALDRICH 0030 120.094 Eppendorf Safe-Lock microcentrifuge tubes
hydrochloric acid Merck KGaA 1,003,171,000 37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu
glass desiccator SIGMA-ALDRICH Pyrex
glass beaker
plastic micro-centrifuge tubes box or holder
Bleach sterilization of seeds
ethanol Chem-Lab nv CL00.0505.1000 Ethanol, abs. 100% a.r. dilute to 70%
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
Tween 20 SIGMA-ALDRICH P1379
sterile water
Growth medium
Murashige and Skoog salt mixture DUCHEFA Biochemie B.V. M0221-0050
myo-inositol SIGMA-ALDRICH I5125-100G
2-(N-morpholino)ethanesulfonic acid (MES) DUCHEFA Biochemie B.V. M1503.0100
sucrose VWR, Internation LLC 27483.294 D(+)-Sucrose Ph. Eur.
KOH Merck KGaA 1050211000 pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur
Plant Tissue Culture Agar LabM Limited MC029
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 10 µM (Arabidopsis)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 10 µM (Arabidopsis)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Making a mesh for transfer
nylon mesh Prosep byba Synthetic nylon mesh 20 µm
Sowing and seedling handling
square petri dish plates GOSSELIN BP124-05 12 x 12 cm
50 ml DURAN tubes SIGMA-ALDRICH CLS430304 Corning 50 ml centrifuge tubes
drigalski Carl Roth K732.1
pipette
cut pipette tips Daslab 162001X Universal 200, cut off 5 mm of tip before autoclaving
breathable tape  3M Deutschland GmbH cat. no. 1530-1
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
Growth conditions
growth room 21 °C, continuous light
Materials Company Catalog Comments
MAIZE LRIS
Seeds
Maize kernels B-73
Bleach sterilization of kernels
glass beaker
magnetic stirrer  Fiers nv/sa C267.1
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
sterile water
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 50 µM (maize primary root), 25 µM (maize adventitious root)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 50 µM (maize)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Sowing and seedling handling
paper hand towels Kimberly-Clark Professional* 6681 SCOTT Hand Towels - Roll / White; sheet size (24 x 46 cm)
seed germination paper Anchor Paper Company 10 X 15 38# seed germination paper
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
250 ml (centrifuge) tubes SCHOTT DURAN 2160136 approx. 5.6 cm diameter and 14.7 cm height 
700 ml tubes DURAN GROUP 213994609 cylinders, round foot tube, D 60  x 250
rack for maize tubes, home made
sterile water
Growth conditions
growth cabinet 27 °C, continuous light, 70% relative humidity

DOWNLOAD MATERIALS LIST

References

  1. Van Norman, J. M., Xuan, W., Beeckman, T., Benfey, P. N. To branch or not to branch: the role of pre-patterning in lateral root formation. Development. 140, 4301-4310 (2013).
  2. Dolan, L., et al. Cellular organisation of the Arabidopsis thaliana root. Development. 119, 71-84 (1993).
  3. Bell, J. K., McCully, M. E. A histological study of lateral root initiation and development in Zea mays. Protoplasma. 70, 179-205 (1970).
  4. Benkova, E., et al. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell. 115, 591-602 (2003).
  5. Beeckman, T., Burssens, S., Inzé, D. The peri-cell-cycle in Arabidopsis. J. Exp. Bot. 52, 403-411 (2001).
  6. Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inzé, D., Beeckman, T. Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell. 14, 2339-2351 (2002).
  7. Jansen, L., Parizot, B., Beeckman, T. Inducible system for lateral roots in Arabidopsis thaliana and maize. Methods Mol Biol. 959, 149-158 (2013).
  8. Casimiro, I., et al. Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell. 13, 843-852 (2001).
  9. Himanen, K., et al. Transcript profiling of early lateral root initiation. Proc. Natl. Acad. Sci. USA. 101, 5146-5151 (2004).
  10. De Smet, I., et al. Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root. Science. 322, 594-597 (2008).
  11. Vanneste, S., et al. Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana. Plant Cell. 17, 3035-3050 (2005).
  12. De Rybel, B., et al. A role for the root cap in root branching revealed by the non-auxin probe naxillin. Nat. Chem. Biol. 8, 798-805 (2012).
  13. Jansen, L., et al. Comparative transcriptomics as a tool for the identification of root branching genes in maize. Plant Biotechnol. J. 11, 1092-1102 (2013).
  14. Parizot, B., et al. Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation. Plant Physiol. 146, 140-148 (2008).
  15. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 15, 473-497 (1962).
  16. Bellini, C., Pacurar, D. I., Perrone, I. Adventitious roots and lateral roots: similarities and differences. Annu Rev Plant Biol. 65, 639-666 (2014).
  17. Grunewald, W., Parizot, B., Inzé, D., Gheysen, G., Beeckman, T. Developmental biology of roots: One common pathway for all angiosperms? Int. J. Plant Dev. Biol. 1, 212-225 (2007).
  18. Parizot, B., Beeckman, T. Genomics of root development. Root Genomics and Soil Interactions. Crespi, M. 3-28 (2012).
  19. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. Journal of visualized experiments : JoVE. (2010).
  20. Nakazono, M., Qiu, F., Borsuk, L. A., Schnable, P. S. Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize. Plant Cell. 15, 583-596 (2003).
  21. Ludwig, Y., Hochholdinger, F. Laser microdissection of plant cells. Methods Mol Biol. 1080, 249-258 (2014).
  22. Beeckman, T., Engler, G. An easy technique for the clearing of histochemically stained plant tissue. Plant Mol. Biol. Rep. 12, 37-42 (1994).
  23. Ditengou, F. A., et al. Mechanical induction of lateral root initiation in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA. 105, 18818-18823 (2008).
  24. Lucas, M., Godin, C., Jay-Allemand, C., Laplaze, L. Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation. J. Exp. Bot. 59, 55-66 (2008).
  25. Wang, S., Taketa, S., Ichii, M., Xu, L., Xia, K., Zhou, X. Lateral root formation in rice (Oryza Sativa. L.): differential effects of indole-3-acetic acid and indole-3-butyric acid. Plant Growth Regul. 41, 41-47 (2003).
  26. Martinez-de la Cruz, E., Garcia-Ramirez, E., Vazquez-Ramos, J. M., Reyes de la Cruz, H., Lopez-Bucio, J. Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings. J Plant Physiol. 176, 147-156 (2015).
  27. Beyer, E. M., Morgan, P. W. Effect of ethylene on uptake, distribution, and metabolism of indoleacetic acid-1-14C and -2-14C and naphthaleneacetic acid-1-14C. Plant Physiol. 46, 157-162 (1970).
  28. Delbarre, A., Muller, P., Imhoff, V., Guern, J. Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta. 198, 532-541 (1996).
  29. Bailey-Serres, J. Microgenomics: genome-scale, cell-specific monitoring of multiple gene regulation tiers. Annu Rev Plant Biol. 64, 293-325 (2013).
  30. Perez-Torres, C. A., et al. Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor. Plant Cell. 20, 3258-3272 (2008).
Lateral Root Induserbare System i<em&gt; Arabidopsis</em&gt; Og Maize
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).More

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter