Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Lateral sistema inducible Raíz en doi: 10.3791/53481 Published: January 14, 2016
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

El sistema radicular es crucial para el crecimiento de las plantas, ya que asegura el anclaje y la absorción de agua y nutrientes del suelo. Debido a la expansión de un sistema de raíces se basa principalmente en la producción de raíces laterales, su iniciación y la formación se han estudiado ampliamente. Raíces laterales se inician en un subconjunto específico de células pericycle, llamadas células fundadoras 1. En la mayoría de las dicotiledóneas, tales como Arabidopsis thaliana, estas células se encuentran en los polos protoxilema 2, mientras que en las monocotiledóneas, tales como maíz, que se encuentran en los polos del floema 3. Células fundadoras están marcados por un aumento de la respuesta auxina 4, seguido por la expresión de genes específicos del ciclo celular (por ejemplo, ciclina B1; 1 / CYCB1; 1), después de lo cual se someten a una primera ronda de divisiones anticlinales asimétricos 5. Después de una serie de divisiones anticlinales y periclinales coordinadas, se forma un primordio raíces laterales que finalmente emerger como un araíces laterales utonomous. La ubicación y el momento de la iniciación de las raíces laterales, sin embargo no son predecibles, ya que estos eventos no son ni abundantes ni sincronizada. Esto impide el uso de enfoques moleculares tales como la transcriptómica para estudiar este proceso.

Para hacer frente a esto, un sistema lateral inducible Root (LRIS) se ha desarrollado 6, 7. En este sistema, las plántulas se tratan primero con N -1-naftilftalámico (NPA), que inhibe el transporte de auxina y la acumulación, en consecuencia, el bloqueo de la iniciación de las raíces laterales 8. Por posteriormente transferir la plántula al medio que contiene la auxina sintética ácido acético 1-naftaleno (NAA), toda la capa periciclo responde a los niveles de auxina elevadas de ese modo masivamente raíz iniciar divisiones celulares laterales inductores 6. Como tal, este sistema conduce a las raíces rápidos, síncronos y extensas iniciaciones laterales, permitiendo una fácil colección de muestras de raíces enriquecidos para una etapa específica en los últimos tiemposdesarrollo de las raíces ral. Posteriormente, estas muestras se pueden utilizar para determinar los perfiles de expresión de todo el genoma durante la formación de raíces laterales. El LRIS ha dado conocimiento ya significativa sobre la iniciación lateral raíces en Arabidopsis y maíz 9-13, pero la necesidad de aplicar este sistema a otras especies de plantas se hace más evidente a medida que más genomas se secuencian y hay un interés creciente para transferir conocimientos a económica importante especies.

Aquí, se dan los protocolos detallados de la Arabidopsis y LRISs maíz. A continuación, se proporciona un ejemplo de la utilización del sistema, ilustrando cómo se pueden usar los datos obtenidos de la transcriptómica LRIS maíz para identificar homólogos funcionales que tienen una función conservada durante la iniciación de raíces laterales a través de diferentes especies de plantas. Por último, las directrices para optimizar la LRIS para se proponen otras especies de plantas.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Arabidopsis Protocolo LRIS

Nota: El texto se refiere a "pequeños" o "grandes" experimentos a escala. Experimentos a pequeña escala, tales como el análisis de línea de marcador y la tinción histológica 6, 14, requieren sólo unas pocas muestras. Experimentos a gran escala, tales como cuantitativa en tiempo real QRT-PCR, micro-arrays 9-11 o de secuenciación de RNA, requieren una mayor cantidad de muestras. Como tal, una cantidad de ~ 1000 plántulas por muestra fue utilizado por Vanneste et al. 11 para realizar microarray experimento después de la disección segmento de raíz.

DÍA 1

  1. Esterilización de semillas de Arabidopsis
    Nota: Seleccione uno de los siguientes procedimientos para la esterilización de semillas. Cualquiera de ellos es adecuado para los siguientes pasos del protocolo. Esterilización de gas (1.1.2) presenta dos ventajas principales sobre la esterilización de líquidos (1.1.1): se tarda menos tiempo en el manejo de una gran entumecidaer de semillas, ya que ninguna de pipeteo tiene que ocurrir para las muestras individuales; y las semillas esterilizadas se pueden almacenar durante un período más largo. Sin embargo, requiere un desecador y un manejo cuidadoso.
    1. La esterilización de líquidos
      1. Vierta la cantidad deseada de semillas en tubos de microcentrífuga. Utilice un máximo de 20 mg (~ 800 semillas) en un tubo de 1,5 ml o 40 mg (~ 1600 semillas) en unos 2 ml tubos de microcentrífuga.
      2. Añadir 1 ml de etanol al 70%. Invertir o agite suavemente durante 2 min.
      3. Sustituir el 70% de etanol con 1 ml de solución de esterilización para 15 min. (Preparar la solución de esterilización fresca: 3,85 ml de hipoclorito de sodio (NaOCl) stock (12%) (PRECAUCIÓN: El uso de humos campana), 5 l de Tween 20, hasta 10 ml con agua invertir los tubos varias veces para asegurarse de que todas las semillas vienen. en contacto con la solución.
      4. En una cabina de flujo de aire laminar, sustituir la solución de esterilización con 1 ml de agua destilada estéril y enjuagar las semillas 5 veces durante 5 min por repetidaLy sustituir con 1 ml de agua destilada estéril fresco.
    2. Esterilización Gas
      1. Verter el número deseado de semillas en un tubo de microcentrífuga de 2 ml. Utilice tubos individuales cuando se trabaja con varias líneas independientes, y organizar los abrieron en una caja o soporte de plástico tubos de microcentrífuga. Si el número de semillas en un tubo excede 500 (12,5 mg), subdividir las semillas en el número apropiado de tubos para asegurar la esterilización exitosa. Asegúrese de que las tapas de los tubos vecinos no cubren unos a otros. Encajar la tapa de la caja en la parte inferior, ya que tiene que estar en el desecador, así como para la esterilización.
      2. Coloque la caja en el plato de un desecador, junto con un vaso de vidrio (PRECAUCIÓN: El uso de humos campana).
      3. Llenar el vaso de precipitados con 100 ml de 12% NaOCl (PRECAUCIÓN: Use campana extractora de gases). Ponga la tapa en el desecador, pero deja una pequeña abertura donde se coloca el vaso de precipitados.
      4. Añadir 3 ml de ácido clorhídrico al 37% (furioso) (CAUCIÓN: Uso humos campana) al vaso de precipitados a través de la pequeña abertura y cierre rápidamente el desecador. La burbuja voluntad solución para algún tiempo debido a la formación de Cl 2 -gas. Deja el sistema cerrado O / N (o por lo menos 8 horas).
      5. Retire la tapa del desecador. Saque la caja y cubrirlo con la tapa para evitar la contaminación durante el transporte.
      6. Ponga la caja en una cabina de flujo laminar de aire, quitar la tapa y dejar las semillas durante aproximadamente 1 hora a RT para permitir la liberación de gas.
        Nota: Las semillas se pueden almacenar de forma segura en seco en tubos de microcentrífuga cerradas hasta por 2 semanas a 4 ° C.
  2. La inducción de raíz lateral en Arabidopsis
    1. Lateral Raíz Inhibición (NPA Personal)
      1. Preparar medio de crecimiento para el crecimiento in vitro. El medio contiene medio de Murashige y Skoog de ​​fuerza mezcla de sal 15, 0,1 g / L de mio-inositol, 10 g / L de sacarosa, y se tampona con 0,5g / L 2- (N-morfolino) etanosulfónico (MES).
      2. Ajustar el pH a 5,7 con 1 M de KOH. Añadir 8 g / L de agar tejido de la planta y el medio en autoclave durante 20 min a 121 ° C.
      3. Preparar una solución madre 25 mM de NPA en dimetilsulfóxido (DMSO) (PRECAUCIÓN: Use guantes). En una cabina de flujo de aire laminar, enfriar el medio en autoclave hasta aproximadamente 65 ° C (que es la temperatura a la que la botella se hace con la mano), y añadir 25 solución madre mM NPA para obtener una concentración final de 10 mM NPA.
      4. Homogeneizar la adición agitando suavemente la botella durante 10 segundos. Verter 50 ml de medio por placa de Petri cuadrada (12 cm x 12 cm).
        Nota: En caso de experimento a gran escala, aplicar una malla de nylon (20 micras) para garantizar la transferencia fácil. Preparar una malla (9 cm x 9 cm) por tratamiento en autoclave (Figura 1A). Cuando autoclave, aplicar la malla al medio de crecimiento con unas pinzas estériles (Figura 1B). Empuje suavemente la malla para el medio de cultivo utilizando un sterilized drigalsky para asegurarse de que está en buen contacto con el medio de crecimiento (Figura 1B) (PRECAUCIÓN: El trabajo en condiciones estériles).
      5. Siembre las semillas en los NPA placas.
        Nota: En caso de que se planea un experimento a gran escala, siembran 2 filas densas y bien alineados de 50 semillas para facilitar la toma de muestras (véase 1.2.2.3).
        1. En el caso de la esterilización líquido, sembrar las semillas en NPA placas utilizando una pipeta de 200 l. Corte 3 - 4 mm del final de las puntas de pipeteado en condiciones estériles (o antes de la esterilización de las puntas) con el fin de ser capaz de pipetear las semillas. Pipetear hacia arriba y abajo un par de veces para volver a suspender las semillas, a continuación pipetear agua aproximadamente 150 l estéril con 10 - 20 semillas y esperar hasta que el sedimento semillas en la parte inferior de la punta. (PRECAUCIÓN: El trabajo en condiciones estériles)
          Nota: Al tocar el agar o la malla suavemente con la punta, una gota de agua con una semilla se dará a conocer de ella (Figura 1C).
        2. <li> En el caso de la esterilización por gas, sembrar las semillas usando autoclave toothpicks.Pinch el palillo de dientes en el agar antes de tomar las semillas para asegurar una superficie pegajosa. Recoge la semillas una por una con el palillo de dientes y distribuir las semillas en las placas (Figura 1D). Alternativamente, añadir agua estéril para las semillas y sembrar como se describe en 1.2.1.5.1 (PRECAUCIÓN: El trabajo en condiciones estériles).
      6. Sellar las placas con cinta adhesiva transpirable y almacenarlos placas a 4 ° C en la oscuridad durante al menos 2 días y un máximo de una semana. Esto es necesario para la estratificación y garantiza sincronizados y germinación más eficiente.
        Nota: Como alternativa, las semillas pueden ser estratificados antes de la siembra, se sumergieron en agua destilada en tubos micro-centrífuga, lo que requiere menos espacio en el refrigerador. En este caso, almacenar los tubos durante al menos una semana a 4 ° C, y se mueven las placas al gabinete crecimiento inmediatamente después de la siembra (véase 1.2.1.7).
        DÍA 3 Mover las placas para el gabinete de crecimiento (luz continua (110 E · m -2 s -1), 21 ° C) durante 5 días (2 días de la germinación y 3 días de crecimiento) en una posición casi vertical (80 a 90 °) para garantizar el crecimiento de raíces en adelante, y no en el medio.
        DÍA 8
    2. Lateral Raíz de inducción (NAA Personal)
      1. Preparar el mismo medio de crecimiento como se describe en 1.2.1.1 y 1.2.1.2. Preparar una solución de 50 mM balance de NAA en DMSO (PRECAUCIÓN: Use guantes). Enfriar el medio en autoclave a 65 ° C y añadir una solución NAA al medio para obtener una concentración final de 10 mM NAA (PRECAUCIÓN: El trabajo en condiciones estériles).
        1. Homogeneizar la adición agitando suavemente la botella durante 10 segundos. Verter 50 ml de medio por placa de Petri cuadrada (12 cm x 12 cm).
      2. La transferencia de los plantones de las placas que contienen medio de cultivo suplementado con 10 mM NPA a los supcomplementado con 10 mM NAA.
        1. Enganche los brazos de pinzas curvas debajo de los cotiledones de la plántula y retire suavemente de la placa. Sólo transferir plantas de semillero de la cual las raíces han crecido totalmente en contacto con el medio NPA-crecimiento y, preferiblemente, hacia abajo.
        2. Rozar la raíz sobre la superficie del medio de crecimiento que contiene NAA-over una pequeña distancia. Asegúrese de que las raíces de las plantas están en buen contacto con el medio de crecimiento. Si es necesario, pulse la raíz suavemente a la superficie de medio de crecimiento con las pinzas.
          Nota: En caso de un experimento a gran escala, eliminar todas las plántulas que no están en contacto con la malla y la transferencia mediante el levantamiento de la malla en las dos esquinas superiores con unas pinzas. Asegúrese de que la malla está en buen contacto con el medio que contiene NAA-con una lectura rápida de la malla sobre la superficie del agar sobre una pequeña distancia (Figura 1E).
      3. Sellar las nuevas placas con cinta transpirable y colocarlos en el gabinete de crecimiento (conluz continua (110 E · m -2 s -1), 21 ° C) en posición vertical durante el tiempo deseado después de la inducción hasta el muestreo.
        Nota: En caso de un experimento a gran escala, el uso de un bisturí para cortar los segmentos de raíz todos a la vez directamente sobre la malla y probar ellos raspando suavemente la superficie de la malla.

2. LRIS Protocolo Maíz

  1. Estratificación de maíz Núcleos
    1. Incubar los granos de maíz a 4 ° C en la oscuridad durante al menos 1 semana.
      Nota: Este protocolo se ha desarrollado utilizando la línea consanguínea B73 maíz.
  2. Esterilización de maíz Núcleos
    DÍA 1
    Nota: Aunque las plántulas de maíz no tienen que ser cultivadas en condiciones estériles, se recomienda para esterilizar los granos de maíz y trabajar con material estéril para evitar el crecimiento de hongos en el rollo de papelsistema.
    1. Ponga el número necesario de granos de maíz en un vaso de precipitados de vidrio esterilizado.
    2. Añadir 100 ml de solución de esterilización (6% NaOCl en agua) (PRECAUCIÓN: El uso campana de humos).
    3. Añadir una barra de agitación magnética y colocar el vaso de precipitados sobre un agitador magnético a baja velocidad de agitación (aproximadamente 250 rpm) a temperatura ambiente durante 5 min.
    4. Enjuague cinco veces durante 5 min mediante la sustitución de la solución con 100 ml de agua estéril fresco.
  3. Siembra de maíz Núcleos
    1. Póngase los guantes para reducir el riesgo de contaminación, y tomar un rollo de toallas de papel.
    2. Arranque dos tramos de papel de toalla de mano con una longitud total de dos hojas (aproximadamente 92 cm x 24 cm) y colocarlos en la parte superior de uno al otro en una superficie limpia (Figura 2).
    3. Doblar las hojas dobles en toda la longitud (aproximadamente 92 cm x 12 cm) (Figura 2A).
    4. Use pinzas para distribuir 10 núcleos en aproximadamente 2 cm de la parte superior sobre tque toda la longitud del papel, mientras se mantiene un espacio intermedio de 8 cm entre cada núcleo y 8 cm libre en ambos extremos (Figura 2B). Asegúrese de que la radícula del kernel esté hacia abajo y hacia el papel (Figura 2B).
    5. Rodar suavemente el papel en toda la longitud, manteniendo las semillas en su lugar (Figura 2B). Para facilitar la rodadura, es opcional para pulverizar primero el papel con agua estéril.
    6. Coloque los rollos de papel en tubos de vidrio esterilizados de unos 6 cm de diámetro y 14 cm de altura (por ejemplo, 250 ml tubos de centrífuga) y colocarlos en una rejilla (Figura 2C).
  4. La inducción de raíz lateral de maíz
    1. Preparar una solución de 50 mM NPA acciones (disuelto en DMSO) (PRECAUCIÓN: Use guantes).
    2. Para cada tubo, hacer una solución NPA 50 M mediante la adición de 125 l de la solución madre mM NPA 50 a 125 ml de agua estéril en un vaso de vidrio esterilizado.
    3. Mezclar bien yverter 125 ml de la solución 50 mM NPA sobre el rollo de papel en el tubo. El rollo de papel absorberá la solución y llegar a ser completamente empapado.
      Nota: Cuando se utiliza rollos de papel y tubos con otras dimensiones, ajustar el volumen en consecuencia. El líquido debe llegar hasta la mitad del tubo para asegurar una buena absorción.
    4. Coloque el sistema de rollo de papel en un armario de crecimiento durante tres días (27 ° C, luz continua, humedad relativa del 70%). Asegúrese de que los rollos de papel quedan empapados añadiendo extra de solución 50 mM NPA, ya que la solución se evapora con el tiempo (Figura 2D).
      DÍA 4
    5. Preparar una solución de 50 mM NAA acciones (disuelto en DMSO) (PRECAUCIÓN: Use guantes).
    6. Para cada tubo, preparar una solución de NAA 50 M mediante la adición de 125 l de las acciones mM NAA 50 a 125 ml de agua estéril en un vaso de vidrio esterilizado.
    7. Apriete suavemente la mayor parte de la solución NPA restante de los rollos de papel y coloque elm en agua estéril durante 5 min para lavar a cabo (PRECAUCIÓN: Use guantes). Apriete suavemente la mayor parte del agua de los rollos de papel. Repita este paso de lavado tres veces.
    8. Mezcle bien y vierta la solución NAA 50 M en los rollos de papel en los tubos. Asegúrese de que estén completamente empapados.
    9. Coloque el sistema de rollo de papel en el gabinete de crecimiento (27 ° C, luz continua, 70% de humedad relativa) durante la duración deseada después de la inducción.
  5. La inducción de raíz lateral de raíces adventicias de la Corona de maíz
    Nota: El LRIS como se describe anteriormente induce raíces laterales en la raíz primaria. Sin embargo, en maíz y otros monocotiledóneas, la raíz primaria y las raíces seminales embrionarias, junto con sus raíces laterales, son principalmente importante durante el desarrollo de las plántulas. En una etapa posterior en el crecimiento de la planta, las raíces adventicias post-embrionarias surgen en el vástago y también desarrollan raíces laterales para formar un nuevo sistema de raíces 16. El LRIS también puede ser usod para inducir raíces laterales en estas raíces adventicias corona post-embrionarias siguiendo algunos ajustes menores a la LRIS en la raíz primaria embrionaria.
    1. Para hacer que los rollos de papel, crear un sándwich de papeles con respectivamente dos capas de papel toalla de mano en el lado exterior, y dos capas de papel dentro de la germinación. Coloca los granos esterilizados (vea los pasos 02.01 a 02.02) en entre las dos hojas de papel de germinación. Papel de germinación, en comparación con el papel toalla de mano, será menos propenso a ser penetrado por los pelos radiculares y raíces laterales, lo que hará la apertura de la rollos de papel más fácil después. Por otro lado, las dos capas externas de papel toalla de mano se facilitar la absorción del líquido.
    2. Inserte los rodillos en 700 ml tubos de vidrio y verter agua estéril sin NPA sobre ellos. Asegúrese de que estén completamente empapados.
    3. Germinar los granos esterilizados en el gabinete de crecimiento (véase el paso 2.4.9).
    4. Crezca las plantas de semillero hasta las raíces adventicias de la coronacomenzar a surgir (6 días para B73). Asegúrese de que los rollos de papel se mantienen húmeda en todo momento mediante la adición de agua estéril cuando sea necesario.
    5. Transferencia a una solución de 25 mM NPA durante 4 días (consulte los pasos 2.4.1 a 2.4.4), seguido de una inducción similar de la iniciación de la raíz lateral mediante la sustitución de la solución NPA con una solución NAA 50 mM después de una etapa de lavado (véase el paso 2.4 0.5 a 2.4.9).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aplicación del LRIS a Realizar Transcriptómica comparativos del lateral Proceso Raíz Iniciación

Una aplicación de la LRIS es la comparación y correlación de los perfiles de expresión génica durante la formación de raíces laterales en diferentes especies. Transcriptómica comparativos acerca a crear la posibilidad de identificar los genes ortólogos involucrados en el proceso de desarrollo de las raíces laterales en diferentes especies. Iniciación de las raíces laterales, que consiste en la formación de un nuevo órgano de un subconjunto de células contenidas en un eje de la raíz ya formado, es el principal mecanismo compartido por las angiospermas para controlar su arquitectura de las raíces. En consecuencia, es muy probable que evolucionó a partir de vías existentes presentes en un ancestro común y fue conservado durante la evolución. De hecho, los reguladores potenciales comunes de la iniciación de raíces laterales se han encontrado en diferentes especies <sup> 17, 18.

Material de muestreo mediante el LRIS en Arabidopsis y maíz, y el análisis del transcriptoma

El LRIS se ha establecido en dos especies diferentes:. Arabidopsis y maíz 10, 13 En ambas especies, se decidió probar las plantas justo antes del tratamiento NAA, y poco después de la inducción, en el inicio de, o durante la respuesta auxina, como así como en el inicio de, o durante las primeras divisiones en el periciclo. Además, clasificación de células activadas por fluorescencia 19 (FACS) se utilizó en Arabidopsis o microscopía láser de captura 20, 21 (LCM) en el maíz para seleccionar las células pericycle. En Arabidopsis, los puntos de tiempo de 2 y 6 horas después de la inducción fueron elegidos en base a la caracterización transcripcional del pDR5 :: respuesta auxina GUS y pCYCB1; 1 :: ciclo celular líneas de marcador GUS 9 (Figura 3). En el maíz, señala el tiempo 2, 3 y 4 h después de la inducción, fueron seleccionados después de la caracterización microscópica de la actividad de la división celular y el análisis de varios genes marcadores del ciclo celular de expresión usando inversa cuantitativa reacción en cadena de la polimerasa con transcripción en tiempo real (qRT-PCR) 13 . Se extrajo ARN de las células aisladas y se hibridó en las plataformas de microarrays como se describió previamente 10, 13.

Encontrar el ortholog de ​​Arabidopsis CYCB1; 1 (AtCYCB1; 1) en maíz

En Arabidopsis, la línea de marcador pCYCB1; 1 :: GUS ha sido ampliamente utilizado para rastrear las primeras divisiones de la periciclo durante la iniciación de la raíz lateral. Tal marcador sería muyútil en el maíz. Varios homólogos de AtCYCB1; 1 se encontraron en el maíz (www.maizesequence.org, todos los péptidos, BLASTP, ajustes por defecto). Seis de ellos estuvieron presentes en el microarray realizado después LRIS en el maíz y mostraron enriquecimiento significativo. La mejor BLAST afectados, GRMZM2G310115, mostró niveles muy altos de transcripción después LRIS, similar a lo observado en Arabidopsis para AtCYCB1; 1 (Figura 4).

Aplicación del LRIS a Compruebe individual Expresión Génica

Para validar GRMZM2G310115 como un buen candidato ortólogo de AtCYCB1; 1 en la iniciación de las raíces laterales de maíz, un tiempo real QRT-PCR en muestras tomadas en diferentes puntos de tiempo se llevó a cabo durante el curso de una LRIS 13. Las plantas se trataron como se describe en el protocolo mencionado anteriormente y se recogieron a diferentes puntos de tiempo: antes de NTratamiento AA (NPA), y después de 2, 3 y 4 h de tratamiento NAA. Además, el material de las plantas que crecen sólo en el agua se cosechó para comparar la expresión de genes entre LRIS y condiciones neutras. Inmediatamente después de la cosecha, los segmentos de raíz correspondiente a una región comprendida entre 5 mm y 15 mm por encima de la punta de la raíz fueron disecados bajo el binocular. El uso de pinzas, la corteza se separó de la estela (que contiene el periciclo), y el ARN se extrajo de ambos tejidos. Este último paso se realizó en lugar de LCM, porque es mucho más rápido y más barato para su validación. Usando el siguiente avance respectivo y atrás primers QRT-PCR, AGCAGGACGCAGTTGGAGAG y GAGCCGAGAGCACAGAAGAAAG, GRMZM2G310115 fue validado a ser hasta reguladas en LRIS, y ser específico para los tejidos estela (Figura 5). Además, este experimento muestra que sin inducción síncrono, los eventos discretos de la iniciación de raíces laterales que suceden en una raíz que crece en agua no son detectables, e ilustrar la necesidad de la LRIS para revelar la expresión génica diferencial relacionada con el proceso de la iniciación de la raíz lateral.

Figura 1
Figura 1. Lateral raíz sistema inducible de Arabidopsis (A) Preparación de la malla de nylon (20 m.): Cortar la malla de nylon (9 cm por 9 cm), envuélvalo en papel de aluminio y lo puso en un vaso de vidrio para autoclave. (B) Aplique la malla de nylon sobre una placa de NPA-que contiene (10 M) con unas pinzas. A continuación, utilice un Drigalski estéril con el fin de eliminar las burbujas de aire. (C) la siembra de semillas en la malla de nylon utilizando una pipeta. (D) la siembra de semillas en la malla de nylon utilizando un palillo de dientes. (E) Transferir el nylon con malla a una placa que contiene NAA-(10 M) con unas pinzas.81 / 53481fig1large.jpg "target =" _ blank "> Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2. Lateral sistema inducible Raíz de maíz.   (A) Preparación de los rollos de papel: lugar dos capas de papel (92 cm x 24 cm, longitud de dos hojas) en la parte superior de uno al otro y doblarlas duplican sobre la longitud (92 cm x 12 cm). (B) Ponga 10 granos de maíz esterilizados con la radícula hacia abajo en el papel a 2 cm de la parte superior con un espacio intermedio de 8 cm. Entonces enrollar el papel, manteniendo los granos de maíz en su lugar. (C) Coloque los rollos de papel en tubos (por ejemplo, 250 ml tubos de centrífuga) y los puso en un estante. (D) Crezca las plántulas de maíz durante tres días en una solución NPA 50 M (a 27 ° C, luz continua, Humi relativadity 70%). (E) Izquierda: plántulas justo antes de la transferencia a NAA; Secundaria: secciones transversales de micrótomo justo antes de la transferencia de NAA y 2 días después de la transferencia de NAA; Derecha:. Plántulas con raíces laterales surgido visibles 5 días después de la transferencia de NAA Haga clic aquí para ver una versión más grande de esta figura.

figura 3
Figura 3. Lateral Raíz Iniciación se estimula Tras prolongada supuesto NAA Tratamiento. (AF) Tiempo que muestra la respuesta auxina durante un tratamiento NAA utilizando la línea de marcador pDR5 :: GUS. La respuesta auxina, que es uno de los primeros eventos de activación la iniciación de raíces laterales, empieza 2 h después del inicio del tratamiento NAA. En el panel superior, se da una visión general de toda la planta de semillero; el show panel inferiors la respuesta auxina en la punta de la raíz. Curso (GM) Tiempo de un tratamiento NAA utilizando el pCYCB1; línea de marcador 1 :: GUS. La señal de GUS representa la expresión de la CYCB1; 1 gen, indicando que las divisiones celulares primeros conducen a la formación de raíces laterales comienzan 6 h ​​después del inicio del tratamiento NAA. En el panel superior, se da una visión general de toda la planta de semillero; el panel inferior muestra CYCB1;. 1 expresión en la punta de la raíz (tinción GUS según Beeckman y Engler, 1994 22) Haga clic aquí para ver una versión más grande de esta figura.

Figura 4
Figura 4. Expresión Perfil de Genes CYCB1 en Arabidopsis y maíz durante LRIS.   (A) los valores de expresión de microarrays de AtCYCB1; 1 durante LRIS como se describe por De Smet et al. 2008 valores de expresión 10 (B) Microarray de potenciales ortólogos de AtCYCB1; 1 durante LRIS según lo descrito por Jansen et al. 2.013 puntaje 13 BLASTP es la puntuación obtenida en la voladura de la secuencia de la proteína de AtCYCB1; 1 en el genoma del maíz. Las barras de error expresan desviación estándar y ** es sinónimo de un valor de p ≤0.01. Por favor haga clic aquí para ver una versión más grande de esta figura.

Figura 5
Figura 5. Expresión de GRMZM2G310115 en la estela y la corteza de las raíces del maíz durante LRIS. La expresión de <em> GRMZM2G310115 durante LRIS en el maíz fue evaluada por cuantitativa en tiempo real QRT-PCR en muestras de estela y la corteza disecados. Una muestra adicional se realizó en plantas cultivadas en agua. Los valores se normalizaron para la expresión en la estela en el agua. Las barras de error expresan desviación estándar y ** es sinónimo de un valor de p ≤0.01 (cebadores y los genes de referencia según Jansen et al. 2013 13). Por favor, haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En el protocolo de Arabidopsis LRIS, es importante sólo para transferir las plántulas que han crecido totalmente en contacto con el medio de crecimiento que contiene NPA. Esto asegura que la iniciación de la raíz lateral está bloqueado en toda la longitud de la raíz. A fin de evitar herir las plántulas durante la transferencia, los brazos de las pinzas curvas pueden ser conectados en virtud de los cotiledones de la plántula. Tras la transferencia, asegúrese de que las raíces de las plántulas están en suficiente contacto con el medio de agar que contiene NAA. Esto se puede lograr con una lectura rápida de la raíz sobre la superficie del agar durante una pequeña distancia. Esto asegurará una inducción eficiente sincronizada de la iniciación de las raíces laterales en toda la longitud de la raíz. Las raíces pueden ser cultivadas expuestas a la luz, sin afectar negativamente a su crecimiento y la inducción de raíces laterales.

En el protocolo LRIS maíz, es importante que la radícula del kernel se enfrenta hacia abajo y hacia el papel para garantizar la raíz crecerá downwards y adjuntar a la ponencia en el lado correcto 16. Después de tres días de tratamiento NPA, las plántulas deben haber surgido del núcleo con un pequeño brote, una raíz principal y raíces seminales 16. La raíz primaria debe ser de aproximadamente 2 cm de largo antes de proceder a la inducción de la iniciación de las raíces lateral. Este protocolo ha sido desarrollado utilizando la línea consanguínea B73 maíz, pero en caso de una línea de maíz con una tasa de crecimiento diferente, ajustar el tiempo de incubación en consecuencia. Asegúrese de que los rollos de papel quedan empapados añadiendo regularmente 50 mM solución NPA cuando el líquido se evapora con el tiempo, de lo contrario el tratamiento NPA podría ser temprano desarrollo de las raíces laterales ineficiente y no deseados podría ocurrir. El propio sistema evita la exposición de las raíces a la luz, pero la luz no es un problema importante y no afecta el crecimiento de la raíz y la inducción de raíces laterales.

Formas alternativas para la inducción controlada de raíces laterales son el uso de mechanical flexión 23 o 24 gravistimulation. La principal ventaja de estos sistemas es que tienen una inducción más "natural" en comparación con los tratamientos hormonales en el LRIS, pero la desventaja es que están limitados en la cantidad de material que puede ser cosechada en un momento dado, ya que sólo producir un evento de iniciación de las raíces laterales en la curva por plántula en comparación con una inducción completa del periciclo en el LRIS.

El LRIS utilizado en Arabidopsis y maíz se puede utilizar en una variedad de plantas, aunque las condiciones favorables necesitan ser optimizado. Para instalar una LRIS, dos importantes pasos sucesivos tienen que lograr: (1) el bloqueo de transporte de auxina y (2) la acumulación de auxina para inducir la iniciación de las raíces laterales. El sistema de cultivo debe permitir la captación eficiente y uniforme de los compuestos y debe permitir un buen desarrollo de las plántulas. Sistemas alternativos a medio sólido (Arabidopsis) y rollos de papel (maíz), tales como cultivo líquido, cultivo hidropónico, o aeroponics, podría ser utilizado para otras especies. La primera etapa en el LRIS, es decir, el bloqueo de la transporte de auxina, se puede lograr mediante la adición de un inhibidor de transporte de auxina. Aunque NPA conduce a un bloqueo eficaz de la iniciación de las raíces laterales en Arabidopsis y maíz, compuestos alternativos, tales como el ácido 2,3,5-triyodobenzoico (TIBA) o ácido clorofenoxiisobutírico p- (PCIB) podrían funcionar mejor en otras especies. Una optimización similar puede hacerse para el segundo paso del LRIS, es decir, el tratamiento de auxina. La auxina sintética NAA parece ser el más adecuado para un LRIS. El precursor de auxina indol-3-butírico (IBA) podría ser una buena alternativa ya que también induce fuertemente raíces laterales y tiene una alta bioactividad en diferentes plantas 25, Por otra parte, el ácido indol-3-acético auxina natural de 26. (IAA) es menos estable y más fácilmente metabolizado 27, racionalizando su efecto más débil sobre devel raízrrollo en, por ejemplo, el maíz o el arroz 25, 26. La auxina sintética del ácido 2,4-diclorofenoxiacético (2,4-D) se acumula en las células altamente pericycle, en parte porque no se exporta desde las celdas 28, impidiendo la iniciación de raíces laterales adecuado y la inducción artificial estructuras fusionadas. También otros compuestos que interactúan con las vías de auxina, tales como naxillin 12, se han mostrado para inducir la iniciación de raíces laterales en Arabidopsis y se pueden probar en otras especies.

En algunos casos, la germinación es ineficiente en presencia de NPA y uno podría elegir para germinar las semillas primero en ausencia de NPA, para transferir posteriormente las plántulas al sistema NPA-que contiene. Esto induce un posible riesgo de tener primeros primordios radiculares laterales iniciadas antes de la inducción de raíces laterales con el tratamiento NAA y, por lo tanto, es importante única muestra la región de la raíz que alarga durante el tratamiento NPA. Siguiendo esta estrategia general, se shoULD poder optimizar un LRIS para prácticamente cualquier (semillas) de la planta y, como tal, tiene un sistema fácil para estudiar el desarrollo de las raíces laterales de la planta de interés. Además de la caracterización de la temporización de la iniciación de las raíces lateral puede ocurrir a través de líneas de marcador, como se ejemplifica para Arabidopsis. Si las líneas de marcador son difíciles de obtener, un estudio histológico detallado podría hacerse, pero esto consume mucho tiempo y las primeras divisiones celulares no son fácilmente reconocibles. Alternativamente, el análisis de expresión de marcadores de la división celular se puede utilizar para indicar el tiempo de las primeras divisiones celulares.

El LRIS se puede utilizar para diferentes propósitos, tales como el análisis del transcriptoma 9-13 como se ha descrito brevemente en los resultados, así como las observaciones histológicas a nivel macroscópica y microscópica durante la iniciación de raíces laterales 14. Los diferentes tipos de muestreo, que van de órgano a escala celular 29, podría permitir desentrañar los diferentes aspectos de la tardeiniciación de las raíces al. Además, el LRIS puede ser usado para monitorear el efecto de diferentes compuestos sobre la iniciación de raíces laterales 12, 30. Por último, mediante el uso de líneas de reportero, un LRIS también se puede utilizar para caracterizar fácilmente la expresión de genes y / o localización de la proteína durante lateral desarrollo de las raíces.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Materials

Name Company Catalog Number Comments
ARABIDOPSIS LRIS
Seeds
Arabidopsis seeds Col-0 ecotype
Gas sterilization of seeds
micro-centrifuge tubes 1.5 ml SIGMA-ALDRICH 0030 125.215 Eppendorf microtubes 3810X, PCR clean
micro-centrifuge tubes 2 ml SIGMA-ALDRICH 0030 120.094 Eppendorf Safe-Lock microcentrifuge tubes
hydrochloric acid Merck KGaA 1,003,171,000 37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu
glass desiccator SIGMA-ALDRICH Pyrex
glass beaker
plastic micro-centrifuge tubes box or holder
Bleach sterilization of seeds
ethanol Chem-Lab nv CL00.0505.1000 Ethanol, abs. 100% a.r. dilute to 70%
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
Tween 20 SIGMA-ALDRICH P1379
sterile water
Growth medium
Murashige and Skoog salt mixture DUCHEFA Biochemie B.V. M0221-0050
myo-inositol SIGMA-ALDRICH I5125-100G
2-(N-morpholino)ethanesulfonic acid (MES) DUCHEFA Biochemie B.V. M1503.0100
sucrose VWR, Internation LLC 27483.294 D(+)-Sucrose Ph. Eur.
KOH Merck KGaA 1050211000 pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur
Plant Tissue Culture Agar LabM Limited MC029
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 10 µM (Arabidopsis)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 10 µM (Arabidopsis)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Making a mesh for transfer
nylon mesh Prosep byba Synthetic nylon mesh 20 µm
Sowing and seedling handling
square petri dish plates GOSSELIN BP124-05 12 x 12 cm
50 ml DURAN tubes SIGMA-ALDRICH CLS430304 Corning 50 ml centrifuge tubes
drigalski Carl Roth K732.1
pipette
cut pipette tips Daslab 162001X Universal 200, cut off 5 mm of tip before autoclaving
breathable tape  3M Deutschland GmbH cat. no. 1530-1
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
Growth conditions
growth room 21 °C, continuous light
Materials Company Catalog Comments
MAIZE LRIS
Seeds
Maize kernels B-73
Bleach sterilization of kernels
glass beaker
magnetic stirrer  Fiers nv/sa C267.1
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
sterile water
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 50 µM (maize primary root), 25 µM (maize adventitious root)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 50 µM (maize)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Sowing and seedling handling
paper hand towels Kimberly-Clark Professional* 6681 SCOTT Hand Towels - Roll / White; sheet size (24 x 46 cm)
seed germination paper Anchor Paper Company 10 X 15 38# seed germination paper
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
250 ml (centrifuge) tubes SCHOTT DURAN 2160136 approx. 5.6 cm diameter and 14.7 cm height 
700 ml tubes DURAN GROUP 213994609 cylinders, round foot tube, D 60  x 250
rack for maize tubes, home made
sterile water
Growth conditions
growth cabinet 27 °C, continuous light, 70% relative humidity

DOWNLOAD MATERIALS LIST

References

  1. Van Norman, J. M., Xuan, W., Beeckman, T., Benfey, P. N. To branch or not to branch: the role of pre-patterning in lateral root formation. Development. 140, 4301-4310 (2013).
  2. Dolan, L., et al. Cellular organisation of the Arabidopsis thaliana root. Development. 119, 71-84 (1993).
  3. Bell, J. K., McCully, M. E. A histological study of lateral root initiation and development in Zea mays. Protoplasma. 70, 179-205 (1970).
  4. Benkova, E., et al. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell. 115, 591-602 (2003).
  5. Beeckman, T., Burssens, S., Inzé, D. The peri-cell-cycle in Arabidopsis. J. Exp. Bot. 52, 403-411 (2001).
  6. Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inzé, D., Beeckman, T. Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell. 14, 2339-2351 (2002).
  7. Jansen, L., Parizot, B., Beeckman, T. Inducible system for lateral roots in Arabidopsis thaliana and maize. Methods Mol Biol. 959, 149-158 (2013).
  8. Casimiro, I., et al. Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell. 13, 843-852 (2001).
  9. Himanen, K., et al. Transcript profiling of early lateral root initiation. Proc. Natl. Acad. Sci. USA. 101, 5146-5151 (2004).
  10. De Smet, I., et al. Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root. Science. 322, 594-597 (2008).
  11. Vanneste, S., et al. Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana. Plant Cell. 17, 3035-3050 (2005).
  12. De Rybel, B., et al. A role for the root cap in root branching revealed by the non-auxin probe naxillin. Nat. Chem. Biol. 8, 798-805 (2012).
  13. Jansen, L., et al. Comparative transcriptomics as a tool for the identification of root branching genes in maize. Plant Biotechnol. J. 11, 1092-1102 (2013).
  14. Parizot, B., et al. Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation. Plant Physiol. 146, 140-148 (2008).
  15. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 15, 473-497 (1962).
  16. Bellini, C., Pacurar, D. I., Perrone, I. Adventitious roots and lateral roots: similarities and differences. Annu Rev Plant Biol. 65, 639-666 (2014).
  17. Grunewald, W., Parizot, B., Inzé, D., Gheysen, G., Beeckman, T. Developmental biology of roots: One common pathway for all angiosperms? Int. J. Plant Dev. Biol. 1, 212-225 (2007).
  18. Parizot, B., Beeckman, T. Genomics of root development. Root Genomics and Soil Interactions. Crespi, M. 3-28 (2012).
  19. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. Journal of visualized experiments : JoVE. (2010).
  20. Nakazono, M., Qiu, F., Borsuk, L. A., Schnable, P. S. Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize. Plant Cell. 15, 583-596 (2003).
  21. Ludwig, Y., Hochholdinger, F. Laser microdissection of plant cells. Methods Mol Biol. 1080, 249-258 (2014).
  22. Beeckman, T., Engler, G. An easy technique for the clearing of histochemically stained plant tissue. Plant Mol. Biol. Rep. 12, 37-42 (1994).
  23. Ditengou, F. A., et al. Mechanical induction of lateral root initiation in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA. 105, 18818-18823 (2008).
  24. Lucas, M., Godin, C., Jay-Allemand, C., Laplaze, L. Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation. J. Exp. Bot. 59, 55-66 (2008).
  25. Wang, S., Taketa, S., Ichii, M., Xu, L., Xia, K., Zhou, X. Lateral root formation in rice (Oryza Sativa. L.): differential effects of indole-3-acetic acid and indole-3-butyric acid. Plant Growth Regul. 41, 41-47 (2003).
  26. Martinez-de la Cruz, E., Garcia-Ramirez, E., Vazquez-Ramos, J. M., Reyes de la Cruz, H., Lopez-Bucio, J. Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings. J Plant Physiol. 176, 147-156 (2015).
  27. Beyer, E. M., Morgan, P. W. Effect of ethylene on uptake, distribution, and metabolism of indoleacetic acid-1-14C and -2-14C and naphthaleneacetic acid-1-14C. Plant Physiol. 46, 157-162 (1970).
  28. Delbarre, A., Muller, P., Imhoff, V., Guern, J. Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta. 198, 532-541 (1996).
  29. Bailey-Serres, J. Microgenomics: genome-scale, cell-specific monitoring of multiple gene regulation tiers. Annu Rev Plant Biol. 64, 293-325 (2013).
  30. Perez-Torres, C. A., et al. Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor. Plant Cell. 20, 3258-3272 (2008).
Lateral sistema inducible Raíz en<em&gt; Arabidopsis</em&gt; Y maíz
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).More

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter