Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Chemistry

Flow-mönster Guidad Tillverkning av hög densitet Barcode Antibody microarray

doi: 10.3791/53644 Published: January 6, 2016

Summary

Detta protokoll beskriver framställningen av en storskalig, multiplex tvådimensionell DNA eller antikropps array, med potentiella tillämpningar inom cellsignalering studier och biomarkör upptäckt.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Antikropps mikroarrayer har använts i stor utsträckning i proteomikstudier i decennier för att undersöka förekomsten av riktade proteiner, inklusive protein biomarkörer 1-3. Även detta område är för närvarande inför stora utmaningar från andra teknik med hög kapacitet såsom masspektrometri (MS), finns det fortfarande gott om utrymme för nyttan av microarrays antikropps, främst eftersom dessa enheter ge enkel tolkning av data och enkelt gränssnitt med andra analyser. Under de senaste åren har integrationen av microarrays i mikrochips byggnadsställningar förutsatt att antikroppen microarray en ny möjlighet att frodas 4-7. Exempelvis har streckkoden microarray integreras i en encelliga mikrochip använts i cellkommunikationsstudier 8,9. Denna teknik har distinkta fördelar jämfört med andra tillgängliga microarray teknik. Den har arrayelement på 10-100 ^ m, mycket mindre än den typiska 150 fim storlek som används i konventionella microarray elements. Konstruktionen av mindre arrayelement åstadkommes med användning av systematiska flödesmönstrings metoder, och detta ger upphov till kompakta mikromatriser som kan upptäcka encelliga utsöndrade proteiner och intracellulära proteiner. En annan fördel är att använda en enkel, instrument fri installation. Detta är särskilt viktigt, eftersom de flesta laboratorier och små företag som inte kan ha möjlighet att få tillgång till microarray core faciliteter. Sådan streckkod microarrays antikropps funktionen förbättrad analys genomströmning och kan användas för att utföra mycket multiplexerade analyser på enskilda celler och samtidigt uppnå hög känslighet och specificitet jämförbar med den för konventionellt sandwich-enzymkopplad immunabsorberande analys (ELISA 8). Denna teknik har ett antal användningsområden i att upptäcka proteiner från glioblastom 9-11, T-celler 12, och cirkulerande tumörceller 13. Alternativt, ensam streckkod DNA microarrays har använts i exakt positionering av nervceller och astrocyter för mimicking monteringen av hjärnvävnad 14 in vivo.

Detta protokoll fokuserar enbart på de experimentella stegen och bygga upp block av den tvådimensionella (2-D) streckkod antikroppsmicroarray som har potentiella tillämpningar inom detektion av biomarkörer i fluidprover och i enskilda celler. Tekniken bygger på en adresserbar enkelsträngad, endimensionell (1-D) DNA microarray konstrueras med hjälp ortogonala oligonukleotider som mönstrade spatialt på glassubstrat. Den 1-D-mönstret bildas när parallella flödeskanaler används i flödes-mönstringssteget, och ett sådant mönster visas som diskreta band visuellt liknar en-D Universal Product Code (UPC) streckkoder. Byggandet av en 2-D (n x m) antikropp array - påminner om en 2-D Quick Response (QR) matriskod - behöver mer komplexa mönstrings strategier, men tillåter immobilisering av antikroppar vid en högre densitet 8,15. Tillverkningenkräver två DNA-mönstringssteg, med det första mönstret är vinkelräta mot den andra. Skärningspunkterna av dessa två mönster utgör n x m element i uppsättningen. Genom att strategiskt välja sekvenserna av enkelsträngat DNA (ssDNA) som utnyttjas i flödes mönstring, är varje element i en given matris tilldelas en specifik adress. Denna rumsliga referens är nödvändigt att skilja mellan fluorescenssignaler på microarray bild. SsDNA matrisen omvandlas till en antikropp matris genom inkorporeringen av komplementära DNA-antikropp-konjugat, som bildar en plattform som kallas DNA-kodade antikroppsbibliotek (GIV 16).

Denna video protokoll beskriver de viktigaste stegen för att skapa NxM arrayer antikropps bland annat förbereder polydimetylsiloxan (PDMS) streckkod formar, flödes mönstring ssDNA i två riktningar, förbereda antikropp-oligonukleotid DEAL konjugat, och omvandla 3 x 3 DNA array i en 3x 3-antikropp matris.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Varning: Flera kemikalier som används i detta protokoll är irriterande och är farligt i fall av hudkontakt. Rådgör säkerhetsdatablad (SDB) och bära lämplig personlig skyddsutrustning innan du utför detta protokoll. Den Piranha lösning som används i steg (1.1.1) är starkt frätande och bör förberedas genom att tillsätta peroxid långsamt syran med agitation. Hantera denna lösning med yttersta försiktighet i ett dragskåp. Använd lämpligt ögonskydd och syrafasta skyddshandskar. Trimetylklorsilan (TMCS) är en frätande, brandfarliga kemikalier som används i ett valfritt steg efter (1.1.6). Hantera denna kemikalie i ett dragskåp.

Obs: Utför streckkodsglid tillverkning och kritiska flödesmönster förfaranden i ett renrum för att minimera kontaminering av partiklar. Dammpartiklar kan blockera portar och mikro av PDMS formar och störa flödes mönstring.

1. Konstruktion av One-dimensional DNA Barcode Slide

  1. Framställning av SU-8 master för streckkod strömningsmönster
    Obs: Ritningarna för vinkelräta strömningsmönster (Figur 1A-B) skapas med hjälp av en datorstödd konstruktion (CAD) programvara. Dessa mönster återges på en kromfotomask. Genomskinliga områden i masken motsvarar särdragen i SU-8 mästare.
    1. Rengör en kiselskiva (100 mm diameter) noggrant i en blandning av 3 H 2 SO 4: 1 30% H2O 2 (Piranha-lösning) upphettad till 96 ° C. Tvätta skivan med avjoniserat vatten och isopropylalkohol, följt av torkning med en kväveblåspistol.
    2. Häll ca 4 ml SU-8 2025 fotoresist på skivan. Använd en programmerbar spinnbeläggningsanordning för att likformigt sprida fotoresisten på skivan för 10 sekunder vid 500 varv per minut, sedan 30 sekunder vid 3000 varv per minut. Detta skapar ett fotoresistskikt med en tjocklek av ~ 25 | im. Så småningom tillåter spinning att bromsa innan du stoppar - detta är Maintain en jämn beläggning på skivan yta.
    3. Baka den belagda wafern på en värmeplatta under en minut vid 65 ° C och därefter under 5 minuter vid 95 ° C. Detta steg gör det möjligt för beläggningen att stelna. Kyl till RT i 5 min.
    4. Placera krommasken (Figur 1C) på fotoresist pälsen. Exponera maskfunktioner till nära-UV-ljus (350 till 400 nm, exponeringsenergi 150-160 mJ / cm 2) under 20 sek.
      Obs: Designen på krommasken innehåller 20 kanaler, som var och en är 20 nm bred med 50 um tonhöjd. Kanalerna är lind från en ände av mönstret till den motsatta änden. Sammanlagt har 20 kanaler täcker ett rektangulärt område med en längd av ~ 40 mm och en bredd av ~ 20 mm. Varje kanal är flankerad av två cirkulära funktioner som motsvarar ett inlopp och ett utlopp. Inlopp och utlopp är utbytbara.
    5. Baka den exponerade skivan på en värmeplatta under 5 min vid 95 ° C. Kyl till RT gradvis.
    6. Sänk skivan i SU-8 utvecklare med omrörningunder 5 min. Tvätta skivan med en liten portion av färskt SU-8 utvecklare, följt av isopropylalkohol. Torka skivan med hjälp av en kväveblåspistol. Hård-baka skivan på en 200 ° C värmeplatta i 30 min, och låta skivan svalna gradvis till RT.
      Obs: Utveckling kan genomföras under en längre tid om en vit film observeras efter tvättning i detta steg.
      Valfritt: silaniseras SU-8 mästare genom att utsätta den för trimetylklorsilan ånga i en sluten petriskål under 10 min.
  2. Framställning av PDMS streckkod mögel
    1. Kombinera 40,0 g silikonelastomerbas med 4,0 g härdare. Omrör prepolymeren blandningen kraftigt i 10 minuter. Degas under 20 min under vakuum.
      Anmärkning: Som allmän regel är att använda en 10: 1 (bas: härdare) massförhållande.
    2. Häll förpolymeren i en petriskål med en kiselskiva med SU-8 mästare i streckkodsmönstret. Höjden på PDMS blandningen bör vara ca 7,5 mm eller däröver. Avlufta blandningen i PetrJag skålen för en andra gång för att avlägsna alla återstående bubblor, sedan baka blandningen under 1 timme vid 75 ° C för att tillåta PDMS att bota.
      Obs: Det är viktigt att upprätthålla tillräckligt tjocklek av PDMS platta på ~ 7,5 mm eller högre för att undvika att lägga alltför mycket spänning till PDMS-glasbindning vid införande av stift / slangar genom hål i PDMS mögel i steg (1.3.3.1)
    3. Med användning av en skalpell, försiktigt skära runt området av PDMS platta som innehåller streckkodsformegenskaper och skala av plattan från skivan.
    4. Trimma kanterna av plattan för att uppnå den önskade formen hos PDMS streckkod mögel. Punch 20 hål (1,0 mm diameter) genom formen med hjälp av en biopsi punch med kolven. Se till att hålen ligger i linje med de cirkulära funktionerna i streckkodsmönstret. Dessa hål tjänar som inlopp och utlopp.
  3. Endimensionell mönstring av poly-L-lysin (PLL)
    1. Ta bort allt damm på ytan av en poly-L-lysin belagda glasskiva med hjälp av en kväveblåspistol. Attach PDMS formen till den rent objektglas. Se till att kanterna hos formen och sliden är i linje.
    2. Baka i 1,5 h vid 75 ° C för att stärka bindningen mellan PDMS formen och PLL-belagda objektglas. Samtidigt förbereder 20 stycken av flexibelt rör polyeten (3- till 4-tums bitar, med en innerdiameter av 0,5 mm och en ytterdiameter på 1,5 mm).
      Obs: Antalet bitar av slang motsvarar antalet inkast i PDMS streckkod mögel. Slangen tjänar till att koppla de kanaler på PDMS streckkod formen till en kvävgastank utrustad med en tryckregulator.
    3. Till en ände av varje slang, bifoga en rostfri ihålig tapp (1 mm diameter). Aspirera sterilfiltrerad poly-L-lysin lösningen genom stiftet, tills minst 1 cm av rörledningen är fylld med lösningen.
      1. Fäst pinnarna (anslutna till lösning fyllda slangar) och inlopp PDMS streckkods formen (Figur 1E). Anslut den andra änden av rören tillen tryckreglerad kvävetank set-up. Låt lösningen att strömma genom formen med användning av ett tryckområde av 0,5-1 psi under minst 6 timmar.
        Obs: Se steg (1.3.3) för alla flödes mönstring förfaranden.
  4. Endimensionell mönstring av ssDNA 14
    Obs: fosfatbuffrad saltlösning (PBS) som används i efterföljande steg framställs från 137 mM NaCl, 10 mM Na 2 HPO 4, och 2 mM KH 2 PO 4. pH hos bufferten är 7,4.
    1. Förbered 2 mM bis (sulfosuccinimidyl) suberat (BS3) lösning i PBS. Bered 300 pM lösningar av A, B och C ssDNA (5'-aminmodifierad, 80 nukleotider) i PBS eller ultrarent vatten.
      Obs! Använd BS3 lösning inom ca 30 minuter efter beredning, eftersom N-hydroxisuccinimidester undergår lätt hydrolys.
    2. Kombinera 2,5 pl av 300 pM A, B eller C ssDNA med 2,5 | il av 2 mM bis (sulfosuccinimidyl) suberat i PBS för varje kanal. A, B, och C-DNA betecknas med kanalerna 1, 2, och 3, respektive. Denna order är också tillämpas på återstående kombinationer av 3 kanaler (figur 2A).
    3. Utför steg (1.3.3). Den här gången, aspirera 5-il BS3 / DNA-lösningar genom stift av rostfritt stål och in slangen polyeten, sedan paret PDMS formen till kvävekällan. Låt BS3 / DNA-lösningen att strömma genom streckkods formen under omkring 40 min eller tills vid kanalerna är fyllda.
    4. Stoppa flödet när alla kanaler är fyllda, då inkubera BS3 / DNA-lösning i streckkoden vid RT under 2 h. Låt inte lösningen torka upp. Grädda PDMS formen med tillhörande streckkod bild för en timme vid 75 ° C.
      Obs: För att underlätta anpassningen i efterföljande flödesmönstersteg, kan kanterna på kanalmönstret på streckkoden glida att beskrivas. Detta görs genom att försiktigt skrapa glasytan med användning av en diamant Scribe för att generera justeringsmarkeringar på undersidan av glasskivan. Anpassningen i senare skeden av protokollet kan kontrolleras under ett mikroskop.
    5. Ta bort PDMS mögel från streckkoden bilden. Tvätta bilden försiktigt med 0,01% SDS gång och tre gånger med ultrarent vatten.
      1. Torka streckkods sliden med hjälp av ett mikroskopobjektglas spinnaren. Förvara streckkods sliden i en ren 50-ml centrifugrör för efterföljande användning.

2. Validering av den endimensionella mönster på Barcode Slide

Obs! Den här validerings kan även anpassas för användning vid bedömning av kvaliteten på efterföljande flödesmönstringssteg.

  1. Blockering av sliden
    1. Bered en% bovint serumalbumin (BSA) i PBS. Filtrera lösningen genom ett 0,45 um sprutfilter före användning. Med användning av en gel-laddning spets, applicera 50 pl 1% BSA-lösning till en kant av streckkods sliden.
    2. Inkubera 1% BSA lösnion under 1 h vid RT.
  2. Inkubation med Cyanine 3 (Cy3) -konjugerad komplementärt DNA
    1. Bered en cocktail av A ', B' och C 'oligonukleotider konjugerade till Cy3 vid en ände. Sekvenserna av A ', B' och C 'är komplementära med de för A, B och C, respektive. Arbets koncentrationen av Cy3-DNA är 0,05 um i 0,1% BSA.
    2. Ta BSA-lösningen från bilden genom pipettering, sedan tillämpa 30 il av DNA-cocktail lösningen på samma kant av bilden. Inkubera Cy3-DNA-cocktail på objektglaset vid RT under 1 timme. Utför denna inkubation steg i mörkret för att skydda Cy3 delen från fotoblekning.
  3. Analys av fluorescensintensitet
    1. Pipett ut Cy3-DNA cocktail och tvätta bilden i 1% BSA, PBS, och slutligen i utspädd PBS (1 pkonst PBS med 50 delar ultrarent vatten). Torka sliden med hjälp av en spinner.
    2. Observera fluorescens (figur 2B) med användning av ett fluorescensmikroskop eller en mikromatris skanner. När du använder en microarray scanner, ställ in våglängden laseremissionen till 532 nm, pixelstorleken på 5 mikrometer, fotomultiplikatorrör (PMT) vinst på 450 och effekt vid 15%.

3. Tillverkning av 2-dimensionella (3x3) DNA-Array 14

  1. Framställning av PDMS streckkod mögel
    1. Utför proceduren (1,1) för att konstruera en annan SU-8 mästare, men den här gången använder en krommask med ett flödesmönster vinkelrätt mot den för den första designen. Utför proceduren (1,2) för att konstruera en ny PDMS mögel med den vinkelräta mönster.
  2. Två-dimensionell flöde mönstring av ssDNA
    1. För en 3 x 3 matris, förbereda 150 iM stamlösningar av A'-i, B'-ii, c'-iii, A'-iv, B'-v, C'-VI, A'-vii, B"-viii och C'-ix DNA i 3% BSA / PBS. Dessa oligonukleotider fungerar som "överbryggningssekvenser" (Figur 2A). Kombinera de oligonukleotid-lösningar (Lösningar 1 till 3) så att arbetskoncentrationen är 50 | iM för varje oligonukleotid. Använd guiden tillhandahålls i tabell 1.
    2. Flöde 3% BSA / PBS-blockeringslösning i alla 20 kanalerna för en timme vid 0,5-1 psi.
    3. Flow Solutions 1, 2, och 3 i kanaler 1, 2, och 3, respektive. Följ denna ordning för efterföljande kombinationer av 3 kanaler. Flow är oftast klar i ca 40 min. Inkubera DNA-lösningarna vid RT i 2 h för att tillåta DNA att hybridisera.
    4. Flöde 3% BSA / PBS-blockeringslösning i alla 20 kanalerna för en timme vid 0,5-1 psi för avlägsnande ohybridiserad DNA. Dra av PDMS platta och tvätta den resulterande DNA microarray bild genom att doppa glasskiva i 3% BSA / PBS gång och PBS två gånger, följt av utspädd PBS (1 del PBS och 50 delar ultrarent vatten). Dry sliden med hjälp av ett mikroskopobjektglas spinnaren.
    5. Utför en andra valideringssteg (figur 2C) liknar den i avsnitt 2. Använd oligonukleotider i 'IX "som är Cy3-konjugerad. Förvara 3 x 3 matris glida i ett 50-ml centrifugrör för efterföljande användning.
      Obs: Den DNA-microarray kan lagras vid RT i en torkapparat i månader.

4. Omvandling av 3 x 3 DNA Array i en antikropp Array

  1. Framställning av antikropp-oligonukleotid (affären) konjugat
    1. Bered lösningar av 200 mM succinimidyl-4-formylbensoat (S-4FB) och 40 mM succinimidyl-6-hydrazinonicotinamide (S-HyNic) i vattenfri N, N-dimetylformamid (DMF).
    2. Bered upp till 7 separata lösningar av infångningsantikroppar (1 mg / ml) i PBS.
      Obs: Om antikroppsstamlösningar innehåller natriumazid bakteriostat, utför buffertutbyte med PBS genom att använda spin avsaltning columns med 7 kDa molekylvikt cut-off (MWCO).
    3. Bered separata 400 iM lösningar av i ", ii", iii ", iv", v ", vi", och vii DNA. Tilldela varje infångningsantikroppen till en oligonukleotidsekvens. Kombinera 40 pl 400 iM DNA med 12,25 il DMF i mikrocentrifugrör och snurra ner för att blanda väl.
      1. Till varje DNA / DMF-lösning, tillsätt 2,3 pl av 200 mM S-4FB i DMF. För varje 100 mikrogram av infångningsantikroppen, tillsätt 2,25 il 40 mM S-HyNic i DMF.
    4. Inkubera antikropp / S-HyNic och DNA / S-4FB lösningar för 4 h vid RT.
    5. Som en förberedelse för antikroppen-DNA kopplingsreaktionen, förbereda nya spin avsaltningskolonner (en för varje DNA-lösning och en för varje antikropp) genom att tvätta dem med citratbuffert vid pH 6.
    6. Efter 4 h inkubation, utför buffertutbyte för varje antikropp / S-HyNic och DNA / S-4FB lösning. Kombinera S-4FB-konjugerad VII" oligonukleotider med antikropp-S-HyNic konjugat. Inkubera blandningarna under 2 h vid RT.
    7. Inkubera reaktions O / N vid 4 ° C.
  2. Rening av antikropp-oligonukleotid (affären) konjugat
    Obs! För att rena antikropps oligonukleotidkonjugat, utföra snabb protein vätskekromatografi (FPLC) på en standard FPLC-system utrustat med en Superose 6 10/300 GL kolumn.
    1. Ställ in våglängden av UV-detektor av FPLC-system till 280 nm. Använd isokratisk flöde av PBS (pH 7,4) vid 0,3 ml / min för att separera de antikropps oligonukleotid konjugat från överskottet S-4FB-DNA.
    2. Slå samman fraktionerna innehållande konjugatet och koncentrera fraktionerna till en volym av 150 pl med användning av spinnfilter med en 10 kDa MWCO.
  3. Tvådimensionell mönstring av antikroppar
    1. Förbered en annan PDMS mögel med microchambers eller mikrobrunnar ossing tillverkningsprocedurer i steg (1,2). PDMS Formen kan innehålla mikroliter till nanoliterbrunnar för immunanalyser.
      Obs: För allmän biomarkör detektering i fluidprover, en PDMS mögel med flera brunnar parad med arrayen bilden. Särdragen hos PDMS mögel beror på systemet som studeras. Exempelvis kan detektion av proteiner från en enda cell experiment utföras med en PDMS form innehållande microchambers med 0,15-nl volymer.
    2. (Tillval) Ämne PDMS formen till plasma rengöring (18 W) för 1,5 minuter för att göra sin mönstrade ythydrofil. Före plasma rengöring, använd tejp för att blockera alla andra ytor som kommer att vara direkt bundna till 3 x 3 matris bild.
      Obs: Steg (4.3.2) är valfri men utförs vanligtvis när PDMS formen är avsedd att användas i en enda cell experiment.
    3. Mate PDMS formen med 3 x 3 matris glida, sedan blockera sliden med 1% BSA i PBS. Inkubera i en timme vid RT. Meanwhile, förbereda en cocktail (200 pl slutlig volym) av antikropps oligonukleotidkonjugat. Den arbetskoncentration av varje konjugat är 10 | ig / ml i 1% BSA / PBS.
    4. Tillsätt antikropps oligonukleotiden cocktail, sedan inkubera i 1 timme vid 37 ° C för att tillåta oligonukleotiden delen av konjugaten för att hybridisera med specifika fläckar på de 3 x 3 arrayer, därigenom omvandla DNA arrayen till en antikropp matris.
    5. Upprepa steg (3.2.4) för att rengöra och torka bilden. Den högsta känsligheten kan uppnås om antikroppen arrayen används omedelbart. Långvarig lagring kan leda till förlust av känslighet.
  4. Detektion av proteiner
    1. Lös rekombinanta proteiner eller förbereda en filtrerad cellprov.
    2. Mate microarray med ett skräddarsytt chip, och blockera ytan med 3% BSA i PBS under 1 timme. Ta sedan bort BSA-lösning, och applicera prov och inkubera i 2 h.
    3. Tvätta proven med användning av 3% BSA i PBS tre gånger, end sedan lägga detektionsantikroppar vid en koncentration som tillhandahålls av produktblad. Inkubera i 2 h.
    4. Tvätta bort detektionsantikroppar med 3% BSA i PBS tre gånger, och sedan lägga Cyanine 5 (Cy5) -streptavidin vid 1 mikrogram / ml, följt av inkubation under 1 timme.
    5. Upprepa steg (3.2.4) för att rengöra och torka bilden för skanning.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De mönster för PDMS formar (Figur 1A-1B) drogs med hjälp av ett CAD-program (AutoCAD). Två mönster som visas har kanaler för flödes mönstring, en horisontell och en vertikal. De vänstra och högra delarna av varje design är symmetriska; någon av dem skulle kunna vara inlopp eller utlopp. Var och en av 20 kanaler är slingrande från en ände hela vägen till den andra änden. Varje design skrivs ut på en kromfotomask (Figur 1C). Den tillverkade SU-8 mästare på en skiva visas i Figur 1D. För att underlätta flödet-mönstring av PLL eller DNA, PDMS formen kopplad till en kvävgasflöde set-up (figur 1E).

Det finns tre flödesmönstersteg som används i detta protokoll. Det första steget immobiliserar PLL på glassubstratet, medan de efterföljande stegen både införa oligonukleotid-lösningar. I tabell 1, den oligonucleotide kompositioner av Lösningar 1-3 är givna. Den arbetskoncentration av varje oligonukleotid är 50 | iM och den totala volymen av varje lösning är 39 | il. Dessa lösningar framställs genom att kombinera 13 pl av varje oligonukleotid stamlösning (150 | iM).

De mönstrade DNA microarray enheter är repetitiva och intilliggande över hela glasskivan. För 3 x 3 mikromatriser, är den maximala densiteten ca 400 tusen fläckar på en glasskiva. Side-by-sida jämförelse med kommersiella DNA microarray visar att vår teknik är cirka 5 gånger känsligare när bindning till Cy3 märkt komplementära DNA. De mönstrade DNA är relativt jämn med ~ 5% variation över flera upprepningar. Dessa egenskaper lovar höga kvantifiering förmåga vår teknik vid mätning proteinhalten från biologiska prover. Dessutom ortogonaliteten av DNA i kombination med flödeskanaldesignen erbjuda flexibility av mönstring i en mängd olika geometrier (figur 2D).

Efter omvandling av DNA-kedjan i en antikropp matris genom hybridisering med DNA-antikropp-konjugat (figur 3B), är den resulterande antikroppen panelen som används i multiplex detektion, främst genom sandwich-ELISA-plattformen, såsom visas i fig 3C. I sandwich-ELISA, biotinylerade detektions (sekundära) antikroppar binder till de infångade proteinerna, och efterföljande märkning med fluorofor-konjugerat streptavidin möjliggör fluorescensbaserad detektering (figur 3C-E). Detektion av proteiner visar <10% variation från en ände till den andra änden av glasskivan (Figur 3D). Med 3 x 3 matris, vi kan upptäcka upp till 7-proteiner, medan tilldela ett arrayelement som referens (Cy3 märkt) och ett annat element som negativ kontroll. Exempelvis utförs i en encelliga Experiment förtumörstudier, proteinerna interleukin-6 (IL-6), matris metallopeptidase 9 (MMP9), hepatocyte growth factor (HGF), vaskulär endotelial tillväxtfaktor (VEGF), interleukin-8 (IL-8), och migration av makrofager hämmande faktor (MIF) från en enda cell kan detekteras samtidigt (figur 3E).

Vi kalibrerat också systemet med rekombinanta proteiner vid olika koncentrationer. I fig 3F, kalibreringskurvor för rekombinanta proteiner interferon γ (IFN-y), tumörnekrosfaktor α (TNF-a), interleukin-13 (IL-13), tumömekrosfaktor β (TNF p), granzym B, interleukin -4 (IL-4), och interleukin-8 (IL-8) är visade. Känsligheten hos detekteringen är ganska lik den hos konventionella sandwich-ELISA på brunnsplattor även med högre laddning av DNA och eventuellt antikroppar på substratet.

Streckkods Antibody microarray kan användas för att detektera biomarkörer i fluidprover samt i enskilda celler. Eftersom encelliga analys är inte i fokus för detta protokoll, exemplifierade vi helt enkelt tillämpningen av 3 x 3-antikropp microarray vid detektion av cytokiner. Genom antikropps ytmarkör interaktioner, kluster av differentiering 8 (CD8) -positiva celler fångades på en av microarray element (figur 3G, en PDMS chip på toppen), och resten av elementen användes för att detektera utsöndrade cytokiner ( Figur 3H). Med denna cell fångstmetod, "cellgrupper" kan bildas. Denna matris infångningsteknik medger även kontroll över antalet celler som utsatts för varje ELISA-experimentet. Cellerna fysiskt isolerade i microchambers så att de detekterade proteinerna avsåg särskilda enstaka celler. I figur 3H, visas att varje mikrokammaren är utrustad med 16 microarray element för att säkerställa inkapsling aven komplett 3 x 3 microarray set.

Figur 1
Figur 1. Design och tillverkning av PDMS streckkod formar för flödesbaserad DNA mönstring. Panel (A) visar AutoCAD-ritningar för horisontella och vertikala endimensionella streckkodsmönster. Panel (B) visar de överlagrade horisontella och vertikala streckkodsmönster från (A). Gröna rutorna bifoga områden mönstrade med diskreta 3 x 3 matriser. (C) Chrome mask för tillverkning av SU-8 mästare. (D) SU-8 mästare tillverkad på en kiselskiva. (E) Set-up för flödes mönstring. Klicka här för att se en större version av denna siffra.

Figur 2 Figur 2. Konstruktion och validering av en 3 x 3 DNA array. Denna siffra har ändrats från "kvantifiering Cell-cellinteraktion funktioner med Ansökan till glioblastoma multiforme cancerceller," av Wang, J. et al., 2012, Nano Lett 12 . Copyright 2012 av American Chemical Society. Anpassad med tillstånd. (A) System för DNA-flödesmönstersteg. (B) Fluorescensintensitet profilen för 20 kanaler i ett utvalt område (spåras med en vertikal linje) av 1D streckkoden. Cy3-konjugerade oligonukleotider hybridiserades med DNA-arrayer för validering. (C) Fluorescence intensitetsprofilen hos matriser validerade med Cy3-konjugerade DNA efter att ha avslutat den andra DNA mönstringssteget. (D) Alternativa fluorescerande mönster från olika flow-mönstring strategier. Klicka här för att se en större version av denna siffra.

Figur 3
Figur 3. Tillämpningar av 3 x 3 microarray. (A) schema för syntes av antikropps oligonukleotid DEAL konjugat. (B) System för konvertering av DNA-array till en antikropp array genom hybridisering med antikropps oligonukleotidkonjugat. (C) System för användning av 3 x 3 microarray i en sandwich-ELISA plattform. Denna siffra har ändrats från "kvantifiering Cell-cellinteraktion funktioner med Ansökan till glioblastoma multiforme cancerceller," av Wang, J. et al., 2012, Nano Lett 12. Copyright 2012 av American Chemical Society. Anpassad med tillstånd. Panel (D) visar en fluorescens avläsning som genereras under ett Cy5-kanal. Detta motsvarar en sandwich-ELISA experiment som upptäcks 6 proteiner. Panel (E) är en inzoomad i profilen för en 3 x 3 matris avläsning enligt Cy3 och Cy5 kanaler. Panel (F) visar sandwich-ELISA kalibreringskurvor för rekombinanta proteiner. Panel (G) visar en "celluppsättning" som bildas genom att fånga celler genom bindning med antikroppar på matrisen. Panel (H) visar detekteringsresultatet överlagrade med microchambers i ett mikrochip. Klicka här för att se en större version av denna siffra.

1
Lösning Oligonukleotid Sammansättning
A'-i, B'-ii, C'-iii
2 A'-iv, B'-v, C'-vi
3 A'-vii, B'-viii, C'-ix

Tabell 1. Sammansättning av lösningar 1-3 för DNA Flow mönstring.

Förankringssekvenser
en ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA-ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA
B GCCTCATTGAATCATGCCTA-AAAAAAAAAAAAAAAAAAAA-GCCTCATTGAATCATGCCTA-
AAAAAAAAAAAAAAAAAAAA
C GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA-GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA
Bridging sekvenser
A'-i TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-ATGGTCGAGATGTCAGAGTA
B'-ii TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATGTGAAGTGGCAGTATCTA
C'-iii TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-ATCAGGTAAGGTTCACGGTA
A'-IV TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-GAGTAGCCTTCCCGAGCATT
B'-v TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATTGACCAAACTGCGGTGCG
C'-vi TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-TGCCCTATTGTTGCGTCGGA
A'-vii TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-TCTTCTAGTTGTCGAGCAGG
B'-viii TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-TAATCTAATTCTGGTCGCGG
C'-ix TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-GTGATT AAGTCTGCTTCGGC
Cy3-konjugerade oligonukleotider för validering
EN' TACGGACTTAGCTCCAGGAT
B " TAGGCATGATTCAATGAGGC
C TAGCGATAGTAGACGAGTGC
jag' TACTCTGACATCTCGACCAT
ii " TAGATACTGCCACTTCACAT
iii " TACCGTGAACCTTACCTGAT
iv ' AATGCTGGGGAAGGCTACTC
v ' CGCACCGCAGTTTGGTCAAT
VI " TCCGACGCAACAATAGGGCA
vii ' CCTGCTCGACAACTAGAAGA
VIII ' CCGCGACCAGAATTAGATTA
ix " GCCGAAGCAGACTTAATCAC
"Fo: keep-together.within-page =" 1 "> Tabell 2. Sekvenser som används i DNA-flow-mönstring.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Flödesmönsterdesign är det första kritiska steget i tillverkning av 2-D microarray. För att generera två överlappande DNA-mönster på ett glassubstrat, bör kanal särdragen hos den första utformningen vara vinkelrät mot de i den andra (Figur 1A-B). Mönstren anser också nedströms tillämpningar av microarray. I fallet med en enda cell analys, är microarray används för att detektera proteiner från enstaka celler inneslutna i microchambers, därför kanaldimensioner görs förenliga med de microchambers som anpassa med 2-D-arrayer. Varje design återges på en fotomask och standardfotolitografitekniker används för att tillverka kanalfunktionerna i SU-8 på en kiselskiva (Figur 1C-D). Detta fungerar som master för form PDMS. När formen har tillverkats, är det bundet till en PLL-belagda objektglas och kopplas sedan med en kvävgasflöde set-up (figur 1E). Set-up vianvändning är enkel och har den fördelen av att vara lätt integreras i alla laboratorier med en tryckreglerad kvävgaskälla. Vi använder en sammansättning av billiga flera 3-vägs ventiler är anslutna till en kvävgastank. Luftflödet för mönstring måste hållas vid låga tryck (0,5-1 psi) för att undvika delaminering av glasskivan från formen. Läckor inom PDMS mögel kan äventyra integriteten av mönstren.

DNA flödesmönster steg i detta protokoll utnyttjar ssDNA med noggrant utvalda ortogonala sekvenser (Figur 2A). Före strömma-mönstring, bör de unika sekvenserna på dessa oligonukleotider testas för frånvaron av överhörning. Ett enkelt test för överhörning sker genom modifiering av valideringsförfarande vi introducerar i våra protokoll (steg 2). Istället för att använda en cocktail av Cy3-märkt komplementär DNA, är bara en typ av komplementär sekvens som används vid en tid för ett markerat område i bilden som multipelDNA-sekvenser är immobiliserade. I avsaknad av DNA överhörning, bör endast ett streck (för 1-D DNA array) eller en plats (för 2-D DNA array) ha fluorescerande under Cy3 filter. Exempel på väl validerade ortogonala sekvenser kan hittas i tabellen för material och utrustning. Den första DNA mönstringssteget introducerar tre typer av "ankare" oligonukleotider. Dessa 80-nt sekvenser består av två 20-mer poly-A-regioner som alternerar med två unika 20-mer-sekvenser. 5'-amin modifiering på dessa ankarsekvenser är nödvändig för amin till amin tvärbindning 17 med PLL förmedlas av BS3. Den andra DNA-mönstringssteget kräver inte en tvärbindare. Detta steg introducerar "överbryggande" oligonukleotider som delvis hybridiserar med ankarsekvenserna. Varje 60-nt överbryggande sekvens består av en 20-mer region som är komplementär till en förankringssekvens, en 20-mer poly-A-distansorgan, och en unik 20-mer-sekvens. Validering av DNA-arrayer (Figure 2B-C) genomförs efter varje DNA flödes mönstring steg för att bedöma kvaliteten på mönstrings steg och att säkerställa att ingen korskontaminering 14. Detta utförs genom att införa Cy3-konjugerad oligonukleotidsonder som hybridiserar med DNA-mönster. Med de parametrar som anges i steg (2.3.2) för att analysera fluorescensintensiteten bör DNA-mönster uppvisar fluorescensintensiteter minst 40.000 au för att maximera känsligheten hos de efterföljande immun utförs med hjälp av microarray. Strategisk användning av olika Cy3-DNA uppsättningar under valideringen ger upphov till alternativa mönster (figur 2D), vilket sålunda visar flexibiliteten hos DNA-mönstring steg 8. Underlåtenhet att uppnå enhetliga mönster kan bli följden av läckor eller mekaniska hinder (t.ex. dammpartiklar) påträffas i flödesmönstersteg.

Framställningen av antikropps oligonukleotid DEAL konjugat är ett kritiskt steg i thär protokollet. Valet av antikroppar dikteras av det biologiska systemet som studeras. De oligonukleotider som användes i konjugation bör ha sekvenser som är komplementära till de som förankrade på DNA-array. Stamlösningar av S-4FB och S-HyNic linkers bör beredas och hållas borta från fukt för att undvika hydrolys. Inkubationstiderna som används i vårt konjugering protokollet är tillräckligt lång för att införa de önskade funktionaliteter på antikropparna och DNA. Den slutliga kopplingsreaktionen endast släcktes genom att ta bort de oreagerade S-4FB-konjugerade oligonukleotider via FPLC. Sålunda bör FPLC rening utföras direkt efter avslutad konjugering. Vid utförande FPLC med det system som beskrivs i våra protokoll, lägre flödeshastigheter (0,2-0,25 ml / min) kan också användas för att förbättra upplösningen. Konjugaten elueras som en bred topp (elueringsvolym på cirka 9-15 ml) som visas innan ett smalare och högre DNA topp (17-20 ml elueringsvolym). Vi rekommenderar inte att lagra lösningarav konjugat med överskott S-4FB-DNA, eftersom detta kan leda till förlust av antigenbindningsställen i antikroppen vid konjugering med överskott funktion DNA. Känsligheten, specificiteten och reproducerbarhet av sandwich ELISA använder DEAL konjugat har visats i tidigare studier. 8,9,11,12,16 att bedöma kvaliteten på antikropps DNA-konjugat, kan konjugaten inkuberas på DNA-arrayer för att generera antikropp matris, som därefter används i sandwich-ELISA-experiment för att generera kalibreringskurvor för proteindetektion (figur 3F). För att generera dessa kalibreringskurvor kan rekombinanta proteinerna tillhandahållna i en konventionell sandwich-ELISA-kit användas. Användningen av högkvalitativa konjugat bör ge upphov till linjära intervall och lägre detektionsgränser som är jämförbara med dem i satsen. Som ett exempel, de nedre gränserna för INFy och TNFa för sandwich-ELISA med vår antikropps array (Figur 3F) är ~ 50-100 pg / ml och är jämn,t med den linjära detekteringsområde ~ 15-1,000 pg / ml anges i produktdatablad för den konventionella sandwich-ELISA-kit. Dålig signal avläsning erhållen i nedströmssandwich ELISA-experiment kunde tillskrivas den låga kvaliteten på DNA-matris, inblandning av överskott DNA i konjugatet lösningar, eller alternativt, ofullständig konjugering av ssDNAs med antikroppar.

Stora problem för att utföra sandwich-ELISA på antikroppen matrisen inkluderar överhörning mellan reagenser och om signalen återspeglar de verkliga biologiska händelser. De ortogonala DNA som vi använder i detta protokoll har blivit grundligt valideras för att ha mindre än 0,1% överhörning. Därför någon överhörning observeras vid immun steget är främst från antikroppar och ELISA reagenser. Testning för överhörning mellan antikroppar i gruppen bör utföras innan du genomför analyser på verkliga prov. När en antikropp panel är konstruerad, ska några sandwich ELISA kontrollexperiment vara perfOrmed med följande villkor: 1. Utan antigener, 2. Utan detektionsantikroppar, och 3. Detection antikroppar och bara märkningsreagens. Om överhörning observeras vid immunoanalysen skede bör paren antikropp och / eller ELISA-reagens ersättas. Det bör noteras att användningen av kommersiellt tillgängliga antikroppar från konventionella ELISA-kit inte garanterar tillämpbarhet till arrayen baserade sandwich-ELISA-teknik.

Fördelarna med denna teknik inkluderar billig tillverkning, miniatyr storlek och flexibilitet design. Vår tillverkning protokollet inte behöver en microarray spotter som inte kan vara tillgängliga för många användare av matriser antikroppar. Flödes mönstring set-up kan enkelt monteras i enkla laboratorier. För laboratorier som inte är utrustade med instrument för fotolitografi, kan CAD-ritningar som vi tillhandahåller i våra protokoll vidarebefordras till företag som erbjuder mikrofabrikationstjänster. Downsizing den konventionella microarray iden kompakta arrayen tillverkas med våra protokoll möjliggör kompatibilitet med mikrochip som används i encelliga experiment. Vår protokoll terar produktionen av arrayen som en ssDNA matris först före omvandling till en antikropp matris. Preliminär mönstring med ssDNAs har ett antal fördelar. Först ssDNAs är kemiskt mer stabil jämfört med antikroppar, således ssDNA mönstrade bilderna kan lagras i en exsickator i minst 6 månader utan signifikant nedbrytning 8,16. För det andra, erbjuder vår strategi slutanvändaren möjlighet att välja de analyser som behövs, genom att helt enkelt blanda de selektiva konjugat tillsammans i en lösning utan ändring av microarray; Tvärtom konventionella protein / antikropp arrayer är redan utformade och fixeras på ett substrat, så förändringen av analyser skulle kräva mönstringen / utskrift av proteiner / antikroppar från första början. Representativa studier illustrerar användningen av streckkoden antikroppmicroarray i hög genomströmning detection av multipla signalerande proteiner från enstaka celler. Genom att variera flödesmönsterdesigner och / eller oligonukleotid mönster lösningar som används, kan en mängd array layouter undersökas. Som ett exempel på denna tillämpning kan funktionella proteiner från enskilda celler studeras. Chipet för encelliga analys omfattar så många som ~ 8,700 microchambers, var i linje med en komplett 3 x 3-antikropp array (Figur 3H). En sådan uppställning möjliggör hög genomströmning detektering. Proteiner utsöndrade av celler odlade i microchambers kan detekteras genom denna matris. Den mångsidiga microarray utformning möjliggör också multiplexade detektion av proteiner från serum, cellysat, och enstaka celler efter att kombinera microarray med andra generiska komponenter 8,15. Förutom proteindetektion, är antikroppen arrayen 3 x 3 även användbara i att fånga celler (figur 3G).

Den största nackdelen med detta tillvägagångssätt är dess skönare komplexity jämfört med tillverkning av konventionella microarrays. Strategier för mönstring och för array konstruktion måste noggrant conceptualized med beaktande av de specifika tillämpningar av den tillverkade uppsättningen. Detta tillvägagångssätt kräver också ett antal kritiska steg, inkluderande förfaranden validering och test för överhörning. Den 3 x 3 matris konstrueras med användning av våra protokoll är begränsad till detektering av 7-proteiner åt gången. Dock kan denna gräns överträffas genom att skapa större matriser. Protokollet som visas här är inte begränsat till tillverkningen av 3 x 3 mikromatriser. Vi har lyckats med att tillverka 5 x 5 mikroarrayer och andra dimensioner av arrayelement. I princip kan andra n x m matriser tillverkas med användning av liknande tekniker, så länge som oligonukleotiden uppsättningar som används för att skapa den preliminära DNA-mönstrade raden är ortogonala för att undvika överhörning mellan arrayelement. Skapandet av utökade matriser uppnås genom flödes patterning n typer av ssDNA ankare för den första DNA-mönstringssteget, följt av n X m överbryggande ssDNA-sekvenser för den andra mönstringssteget. Till exempel, för att skapa en 5 x 5 array, kan ankarsekvenser A till E ska användas, samtidigt som överbryggande sekvenser A'-i att E'-xxv utnyttjas. För att automatisera flödet mönstringsprocessen, har en robotplattform utvecklats 18 även om detta endast har utnyttjat en DNA-flöde mönstringssteg. I princip kan samma plattform utökas till det andra steget i vinkelrät flödes mönstring, medan omkopplingen mellan två steg kan kräva manuellt skala av den första PDMS formen efter det första mönstringssteget, följt av tvättning och torkning av objektglaset (detta steg skulle ta ca 10 min) innan parning sliden med en annan PDMS formen för att underlätta vinkelrätt orienterade andra mönstringssteget.

Vi har diskuterat detaljerade förfaranden för tillverkning av en nXm array mönstradmed antikroppar med hög densitet, vilket är mycket lovande för framtida tillämpningar inom proteomik studier och cellsignalering. Protokollet presenteras här kan också tjäna som vägledning för byggandet av mer genomarbetade uppsättningar DNA / antikropps för andra ändamål.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Sylgard 184 silicone elastomer base Dow Corning 3097366-1004
Sylgard 184 silicone elastomer curing agent Dow Corning 3097358-1004
SU-8 2025 photoresist MicroChem Y111069
Silicon wafers  University Wafers 452
Poly-L-lysine coated glass slides Thermo Scientific C40-5257-M20
Oligonucleotides Integrated DNA Technologies *Custom-ordered from Integrated DNA Technologies, see Table 2.
Poly-L-lysine adhesive stock solution Newcomer Supply 1339
Bis (sulfosuccinimidyl) suberate  (BS3) Thermo Scientific 21585
1x Phosphate buffered saline, pH 7.4 Quality Biological 114-058-101
Äkta Explorer 100 Fast Protein Liquid Chromatography (FPLC) System GE (Amersham Pharmacia)  18-1112-41
Superose 6 10/300 GL column GE Healthcare Life Sciences 17-5172-01
Capture antibodies various various *Antibody selection depends on application
Succinimidyl-6-hydrazino-nicotinamide (S-HyNic) Solulink S-1002
Succinimidyl-4-formylbenzamide (S-4FB) Solulink S-1004
N,N-dimethylformamide Sigma-Aldrich 227056
Citric acid, anhydrous Acros 42356
Sodium hydroxide Fisher Scientific S318
Amicon Ultra spin filter 10 kDa MWCO EMD Millipore UFC201024
Spin coater Laurell Technologies WS-650-MZ
Biopsy punch with plunger (1.0 mm diameter) Ted Pella, Inc. 15110-10
Diamond scribe (Style 60) SPI supplies 6004
Trimethylchlorosilane Sigma Aldrich 92361

DOWNLOAD MATERIALS LIST

References

  1. Alhamdani, M. S. S., Schroder, C., Hoheisel, J. D. Oncoproteomic profiling with antibody microarrays. Genome Med. 1, (7), (2009).
  2. Angenendt, P. Progress in protein and antibody microarray technology. Drug Discov Today. 10, (7), 503-511 (2005).
  3. Sun, H. Y., Chen, G. Y. J., Yao, S. Q. Recent advances in microarray technologies for proteomics. Chem Biol. 20, (5), 685-699 (2013).
  4. Fan, R., et al. Integrated barcode chips for rapid, multiplexed analysis of proteins in microliter quantities of blood. Nat Biotechnol. 26, (12), 1373-1378 (2008).
  5. Chattopadhyay, P. K., Gierahn, T. M., Roederer, M., Love, J. C. Single-cell technologies for monitoring immune systems. Nat Immunol. 15, (2), 128-135 (2014).
  6. Varadarajan, N., et al. Rapid, efficient functional characterization and recovery of HIV-specific human CD8(+) T cells using microengraving. Proc Natl Acad Sci USA. 109, (10), 3885-3890 (2012).
  7. Ma, S., et al. Electroporation-based delivery of cell-penetrating peptide conjugates of peptide nucleic acids for antisense inhibition of intracellular bacteria. Integr Biol-Uk. 6, (10), 973-978 (2014).
  8. Wang, J., et al. Quantitating cell-cell interaction functions with applications to glioblastoma multiforme cancer cells. Nano Lett. 12, (12), 6101-6106 (2012).
  9. Kravchenko-Balasha, N., Wang, J., Remacle, F., Levine, R. D., Heath, J. R. Glioblastoma cellular architectures are predicted through the characterization of two-cell interactions. Proc Natl Acad Sci USA. 111, (17), 6521-6526 (2014).
  10. Xue, M., et al. Chemical methods for the simultaneous quantitation of metabolites and proteins from single cells. J Am Chem Soc. 137, (12), 4066-4069 (2015).
  11. Shi, Q. H., et al. Single-cell proteomic chip for profiling intracellular signaling pathways in single tumor cells. Proc Natl Acad Sci USA. 109, (2), 419-424 (2012).
  12. Ma, C., et al. A clinical microchip for evaluation of single immune cells reveals high functional heterogeneity in phenotypically similar T cells. Nat Med. 17, (6), 738-743 (2011).
  13. Deng, Y., et al. An integrated microfluidic chip system for single-cell secretion profiling of rare circulating tumor cells. Sci Rep. 4, 7499 (2014).
  14. Vermesh, U., et al. High-density, multiplexed patterning of cells at single-cell resolution for tissue engineering and other applications. Angew Chem Int Ed. 50, (32), 7378-7380 (2011).
  15. Yu, J., et al. Microfluidics-based single-cell functional proteomics for fundamental and applied biomedical applications. Annu Rev Anal Chem. 7, 275-295 (2014).
  16. Bailey, R. C., Kwong, G. A., Radu, C. G., Witte, O. N., Heath, J. R. DNA-encoded antibody libraries: A unified platform for multiplexed cell sorting and detection of genes and proteins. J Am Chem Soc. 129, 1959-1967 (2007).
  17. Alegria-Schaffer, A. General protein-protein cross-linking. Methods Enzymol. 539, 81-87 (2014).
  18. Ahmad, H., et al. A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins. Rev Sci Instrum. 82, 094301 (2011).
Flow-mönster Guidad Tillverkning av hög densitet Barcode Antibody microarray
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ramirez, L. S., Wang, J. Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray. J. Vis. Exp. (107), e53644, doi:10.3791/53644 (2016).More

Ramirez, L. S., Wang, J. Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray. J. Vis. Exp. (107), e53644, doi:10.3791/53644 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter